E3 Ubiquitin Ligase FBXO3 Drives Neuroinflammation to Aggravate Cerebral Ischemia/Reperfusion Injury
Abstract
:1. Introduction
2. Results
2.1. FBXO3 Was Significantly Elevated in the Peri-Infarcted Brain Tissue of SD Rats Subjected to Middle Cerebral Artery Occlusion/Reperfusion (MCAO/R) and Specifically Expressed in Neurons
2.2. Interference of FBXO3 Rescued the Neurological Outcomes after MCAO/R
2.3. Interference of FBXO3 Attenuated OGD/R-Induced Neuronal Death
2.4. Treatment of si-FBXO3 Inhibited Inflammatory Response after I/R Injury In Vivo and In Vitro
2.5. FBXO3 Facilitated Inflammation, Probably through Binding and Degrading HIPK2 in HT22 Cells after OGD/R Stimulation
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Cell Lines
4.3. Middle Cerebral Artery Occlusion/Reperfusion (MCAO/R) Model
4.4. FBXO3 Interference in Rats
4.5. Neurological Function Tests
4.6. Quantification of Infarct Volume
4.7. HE and Nissl Staining
4.8. OGD/R Treatment
4.9. FBXO3 siRNA and FBXO3 Inhibitor BC-1215 Interference in Cells
4.10. Cell Viability
4.11. Flowcytometry
4.12. Calcein/PI Cell Viability/Cytotoxicity Assay
4.13. Western Blotting
4.14. Co-Immunoprecipitation (Co-IP) Assay
4.15. Quantitative PCR (qPCR) Assay
4.16. Enzyme-Linked Immunosorbent Assay (ELISA)
4.17. Immunofluorescence (IF) Analysis
4.18. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tao, T.; Liu, M.; Chen, M.; Luo, Y.; Wang, C.; Xu, T.; Jiang, Y.; Guo, Y.; Zhang, J.H. Natural medicine in neuroprotection for ischemic stroke: Challenges and prospective. Pharmacol. Ther. 2020, 216, 107695. [Google Scholar] [CrossRef] [PubMed]
- Global, regional, and national burden of stroke and its risk factors, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet Neurol. 2021, 20, 795–820. [CrossRef]
- Iadecola, C.; Anrather, J. The immunology of stroke: From mechanisms to translation. Nat. Med. 2011, 17, 796–808. [Google Scholar] [CrossRef] [PubMed]
- Chamorro, Á.; Dirnagl, U.; Urra, X.; Planas, A.M. Neuroprotection in acute stroke: Targeting excitotoxicity, oxidative and nitrosative stress, and inflammation. Lancet Neurol. 2016, 15, 869–881. [Google Scholar] [CrossRef]
- Zindel, J.; Kubes, P. DAMPs, PAMPs, and LAMPs in Immunity and Sterile Inflammation. Annu. Rev. Pathol. 2020, 15, 493–518. [Google Scholar] [CrossRef] [Green Version]
- Przykaza, Ł. Understanding the Connection between Common Stroke Comorbidities, Their Associated Inflammation, and the Course of the Cerebral Ischemia/Reperfusion Cascade. Front. Immunol. 2021, 12, 782569. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Liu, P.; Inuzuka, H.; Wei, W. Roles of F-box proteins in cancer. Nat. Rev. Cancer 2014, 14, 233–247. [Google Scholar] [CrossRef] [Green Version]
- Luza, S.; Opazo, C.M.; Bousman, C.A.; Pantelis, C.; Bush, A.I.; Everall, I. The ubiquitin proteasome system and schizophrenia. Lancet Psychiatry 2020, 7, 528–537. [Google Scholar] [CrossRef]
- Saravanan, K.M.; Kannan, M.; Meera, P.; Bharathkumar, N.; Anand, T. E3 ligases: A potential multi-drug target for different types of cancers and neurological disorders. Future Med. Chem. 2022, 14, 187–201. [Google Scholar] [CrossRef]
- Di Fonzo, A.; Dekker, M.C.; Montagna, P.; Baruzzi, A.; Yonova, E.H.; Guedes, L.C.; Szczerbinska, A.; Zhao, T.; Dubbel-Hulsman, L.O.; Wouters, C.H.; et al. FBXO7 mutations cause autosomal recessive, early-onset parkinsonian-pyramidal syndrome. Neurology 2009, 72, 240–245. [Google Scholar] [CrossRef]
- Zhou, Z.D.; Lee, J.C.T.; Tan, E.K. Pathophysiological mechanisms linking F-box only protein 7 (FBXO7) and Parkinson’s disease (PD). Mutat. Res. Rev. Mutat. Res. 2018, 778, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Schneider, A.L.; Myers, C.T.; Muir, A.M.; Calvert, S.; Basinger, A.; Perry, M.S.; Rodan, L.; Helbig, K.L.; Chambers, C.; Gorman, K.M.; et al. FBXO28 causes developmental and epileptic encephalopathy with profound intellectual disability. Epilepsia 2021, 62, e13–e21. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.S.; Li, A.Y.; Rapuano, A.; Mantis, J.; Eid, T.; Seyfried, T.N.; de Lanerolle, N.C. Gene expression in the epileptic (EL) mouse hippocampus. Neurobiol. Dis. 2021, 147, 105152. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.B.; Coon, T.A.; Glasser, J.R.; McVerry, B.J.; Zhao, J.; Zhao, Y.; Zou, C.; Ellis, B.; Sciurba, F.C.; Zhang, Y.; et al. A combinatorial F box protein directed pathway controls TRAF adaptor stability to regulate inflammation. Nat. Immunol. 2013, 14, 470–479. [Google Scholar] [CrossRef] [PubMed]
- Mallampalli, R.K.; Coon, T.A.; Glasser, J.R.; McVerry, B.J.; Zhao, J.; Zhao, Y.; Zou, C.; Ellis, B.; Sciurba, F.C.; Zhang, Y.; et al. Targeting F box protein Fbxo3 to control cytokine-driven inflammation. J. Immunol. 2013, 191, 5247–5255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, S.; Lear, T.B.; Jerome, J.A.; Rajbhandari, S.; Snavely, C.A.; Gulick, D.L.; Gibson, K.F.; Zou, C.; Chen, B.B.; Mallampalli, R.K. Lipopolysaccharide Primes the NALP3 Inflammasome by Inhibiting Its Ubiquitination and Degradation Mediated by the SCFFBXL2 E3 Ligase. J. Biol. Chem. 2015, 290, 18124–18133. [Google Scholar] [CrossRef] [Green Version]
- Yang, F.; Wang, Z.; Wei, X.; Han, H.; Meng, X.; Zhang, Y.; Shi, W.; Li, F.; Xin, T.; Pang, Q.; et al. NLRP3 deficiency ameliorates neurovascular damage in experimental ischemic stroke. J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow Metab. 2014, 34, 660–667. [Google Scholar] [CrossRef] [Green Version]
- Franke, M.; Bieber, M.; Kraft, P.; Weber, A.N.; Stoll, G.; Schuhmann, M.K. The NLRP3 inflammasome drives inflammation in ischemia/reperfusion injury after transient middle cerebral artery occlusion in mice. Brain Behav. Immun. 2021, 92, 223–233. [Google Scholar] [CrossRef]
- Chandra, D.; Londino, J.; Alexander, S.; Bednash, J.S.; Zhang, Y.; Friedlander, R.M.; Daskivich, G.; Carlisle, D.L.; Lariviere, W.R.; Nakassa, A.C.I.; et al. The SCFFBXO3 ubiquitin E3 ligase regulates inflammation in atherosclerosis. J. Mol. Cell. Cardiol. 2019, 126, 50–59. [Google Scholar] [CrossRef]
- Hung, K.Y.; Liao, W.I.; Pao, H.P.; Wu, S.-Y.; Huang, K.-L.; Chu, S.-J. Targeting F-Box Protein Fbxo3 Attenuates Lung Injury Induced by Ischemia-Reperfusion in Rats. Front. Pharm. 2019, 10, 583. [Google Scholar] [CrossRef]
- Shima, Y.; Shima, T.; Chiba, T.; Irimura, T.; Pandolfi, P.P.; Kitabayashi, I. PML activates transcription by protecting HIPK2 and p300 from SCFFbx3-mediated degradation. Mol. Cell. Biol. 2008, 28, 7126–7138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Consortium, T.U. UniProt: The universal protein knowledgebase in 2021. Nucleic Acids Res. 2020, 49, D480–D489. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.H.; Choi, C.Y.; Lee, S.J.; Conti, M.A.; Kim, Y. Homeodomain-interacting protein kinases, a novel family of co-repressors for homeodomain transcription factors. J. Biol. Chem. 1998, 273, 25875–25879. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Nottke, A.; Goodman, R.H. Homeodomain-interacting protein kinase-2 mediates CtBP phosphorylation and degradation in UV-triggered apoptosis. Proc. Natl. Acad. Sci. USA 2005, 102, 2802–2807. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Qi, L.; Feng, Q.; Zhang, B.; Li, X.; Liu, C.; Li, W.; Liu, Q.; Yang, D.; Yin, Y.; et al. HIPK2 phosphorylates HDAC3 for NF-κB acetylation to ameliorate colitis-associated colorectal carcinoma and sepsis. Proc. Natl. Acad. Sci. USA 2021, 118, e2021798118. [Google Scholar] [CrossRef]
- Li, R.; Shang, J.; Zhou, W.; Jiang, L.; Xie, D.; Tu, G. Overexpression of HIPK2 attenuates spinal cord injury in rats by modulating apoptosis, oxidative stress, and inflammation. Biomed Pharm. 2018, 103, 127–134. [Google Scholar] [CrossRef]
- Dang, X.; Zhang, R.; Peng, Z.; Qin, Y.; Sun, J.; Niu, Z.; Pei, H. HIPK2 overexpression relieves hypoxia/reoxygenation-induced apoptosis and oxidative damage of cardiomyocytes through enhancement of the Nrf2/ARE signaling pathway. Chem. Biol. Interact. 2020, 316, 108922. [Google Scholar] [CrossRef]
- Torrente, L.; Sanchez, C.; Moreno, R.; Chowdhry, S.; Cabello, P.; Isono, K.; Koseki, H.; Honda, T.; Hayes, J.D.; Dinkova-Kostova, A.; et al. Crosstalk between NRF2 and HIPK2 shapes cytoprotective responses. Oncogene 2017, 36, 6204–6212. [Google Scholar] [CrossRef] [Green Version]
- Hou, Y.; Wang, Y.; He, Q.; Li, L.; Xie, H.; Zhao, Y.; Zhao, J. Nrf2 inhibits NLRP3 inflammasome activation through regulating Trx1/TXNIP complex in cerebral ischemia reperfusion injury. Behav. Brain Res. 2018, 336, 32–39. [Google Scholar] [CrossRef]
- Eriksson, P.S.; Perfilieva, E.; Björk-Eriksson, T.; Alborn, A.-M.; Nordborg, C.; Peterson, D.A.; Gage, F.H. Neurogenesis in the adult human hippocampus. Nat. Med. 1998, 4, 1313–1317. [Google Scholar] [CrossRef]
- Talbot, S.; Chahmi, E.; Dias, J.P.; Couture, R. Key role for spinal dorsal horn microglial kinin B1 receptor in early diabetic pain neuropathy. J. Neuroinflamm. 2010, 7, 36. [Google Scholar] [CrossRef] [Green Version]
- Middeldorp, J.; Hol, E.M. GFAP in health and disease. Prog. Neurobiol. 2011, 93, 421–443. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Chen, H.; Du, Q.; Shen, J. Targeting Myeloperoxidase (MPO) Mediated Oxidative Stress and Inflammation for Reducing Brain Ischemia Injury: Potential Application of Natural Compounds. Front. Physiol. 2020, 11, 433. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.J.; Wu, H.; Shen, X.Z. The ubiquitin-proteasome system and its potential application in hepatocellular carcinoma therapy. Cancer Lett. 2016, 379, 245–252. [Google Scholar] [CrossRef] [PubMed]
- Berndsen, C.E.; Wolberger, C. New insights into ubiquitin E3 ligase mechanism. Nat. Struct. Mol. Biol. 2014, 21, 301–307. [Google Scholar] [CrossRef] [PubMed]
- Bai, C.; Sen, P.; Hofmann, K.; Ma, L.; Goebl, M.; Harper, J.; Elledge, S.J. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 1996, 86, 263–274. [Google Scholar] [CrossRef] [Green Version]
- Deshmukh, R.S.; Sharma, S.; Das, S. Cyclin F-Dependent Degradation of RBPJ Inhibits IDH1R132H-Mediated Tumorigenesis. Cancer Res. 2018, 78, 6386–6398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suber, T.; Wei, J.; Jacko, A.M.; Nikolli, I.; Zhao, Y.; Zhao, J.; Mallampalli, R.K. SCFFBXO17 E3 ligase modulates inflammation by regulating proteasomal degradation of glycogen synthase kinase-3β in lung epithelia. J. Biol. Chem. 2017, 292, 7452–7461. [Google Scholar] [CrossRef] [Green Version]
- Niu, M.; He, Y.; Xu, J.; Ding, L.; He, T.; Yi, Y.; Fu, M.; Guo, R.; Li, F.; Chen, H.; et al. Noncanonical TGF-β signaling leads to FBXO3-mediated degradation of ΔNp63α promoting breast cancer metastasis and poor clinical prognosis. PLoS Biol. 2021, 19, e3001113. [Google Scholar] [CrossRef]
- Lin, T.B.; Hsieh, M.C.; Lai, C.Y.; Cheng, J.K.; Chau, Y.P.; Ruan, T.; Chen, G.D.; Peng, H.Y. Fbxo3-Dependent Fbxl2 Ubiquitination Mediates Neuropathic Allodynia through the TRAF2/TNIK/GluR1 Cascade. J. Neurosci. 2015, 35, 16545–16560. [Google Scholar] [CrossRef]
- Weathington, N.M.; Álvarez, D.; Sembrat, J.; Radder, J.; Cárdenes, N.; Noda, K.; Gong, Q.; Wong, H.; Kolls, J.; D’Cunha, J.; et al. Ex vivo lung perfusion as a human platform for preclinical small molecule testing. JCI Insight 2018, 3, e95515. [Google Scholar] [CrossRef] [PubMed]
- Choi, D.W.; Choi, C.Y. HIPK2 modification code for cell death and survival. Mol. Cell. Oncol. 2014, 1, e955999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, H.J.; Kato, M.; Deshpande, S.; Zhang, E.; Das, S.; Lanting, L.; Wang, M.; Natarajan, R. Inhibition of the processing of miR-25 by HIPK2-Phosphorylated-MeCP2 induces NOX4 in early diabetic nephropathy. Sci. Rep. 2016, 6, 38789. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Q.; Deng, J.; Yao, J.; Song, J.; Meng, D.; Zhu, Y.; Xu, M.; Liang, Y.; Xu, J.; Sluijter, J.P.; et al. Exercise downregulates HIPK2 and HIPK2 inhibition protects against myocardial infarction. eBioMedicine 2021, 74, 103713. [Google Scholar] [CrossRef]
- Li, L.; Xiao, L.; Hou, Y.; He, Q.; Zhu, J.; Li, Y.; Wu, J.; Zhao, J.; Yu, S.; Zhao, Y. Sestrin2 Silencing Exacerbates Cerebral Ischemia/Reperfusion Injury by Decreasing Mitochondrial Biogenesis through the AMPK/PGC-1α Pathway in Rats. Sci. Rep. 2016, 6, 30272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, Q.; Li, Z.; Meng, C.; Wu, J.; Zhao, Y.; Zhao, J. Parkin-Dependent Mitophagy is Required for the Inhibition of ATF4 on NLRP3 Inflammasome Activation in Cerebral Ischemia-Reperfusion Injury in Rats. Cells 2019, 8, 897. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Longa, E.Z.; Weinstein, P.R.; Carlson, S.; Cummins, R. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke 1989, 20, 84–91. [Google Scholar] [CrossRef]
Gene Name | Primer Sequences |
---|---|
GAPDH (rat) | Forward: AGTTCAACGGCACAGTCAAG Reverse: TACTCAGCACCAGCATCACC |
FBXO3 (rat) | Forward: GGACCTGGAGTAGTTGGTGAA Reverse: CATGTCTGCTGAGTCATCGT |
GAPDH (mouse) | Forward: GGTTGTCTCCTGCGACTTCA Reverse: TGGTCCAGGGTTTCTTACTCC |
FBXO3 (mouse) | Forward: GGTGTCTATAGCTCGATTGGAA Reverse: TCATCTGACTCATTCTCATCCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, Y.; Xiao, X.; Luo, J.; Wang, J.; Peng, Q.; Zhao, J.; Jiang, N.; Zhao, Y. E3 Ubiquitin Ligase FBXO3 Drives Neuroinflammation to Aggravate Cerebral Ischemia/Reperfusion Injury. Int. J. Mol. Sci. 2022, 23, 13648. https://doi.org/10.3390/ijms232113648
Gao Y, Xiao X, Luo J, Wang J, Peng Q, Zhao J, Jiang N, Zhao Y. E3 Ubiquitin Ligase FBXO3 Drives Neuroinflammation to Aggravate Cerebral Ischemia/Reperfusion Injury. International Journal of Molecular Sciences. 2022; 23(21):13648. https://doi.org/10.3390/ijms232113648
Chicago/Turabian StyleGao, Yu, Xinyu Xiao, Jing Luo, Jianwei Wang, Qiling Peng, Jing Zhao, Ning Jiang, and Yong Zhao. 2022. "E3 Ubiquitin Ligase FBXO3 Drives Neuroinflammation to Aggravate Cerebral Ischemia/Reperfusion Injury" International Journal of Molecular Sciences 23, no. 21: 13648. https://doi.org/10.3390/ijms232113648
APA StyleGao, Y., Xiao, X., Luo, J., Wang, J., Peng, Q., Zhao, J., Jiang, N., & Zhao, Y. (2022). E3 Ubiquitin Ligase FBXO3 Drives Neuroinflammation to Aggravate Cerebral Ischemia/Reperfusion Injury. International Journal of Molecular Sciences, 23(21), 13648. https://doi.org/10.3390/ijms232113648