Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Generation of Mstn-KO Mice by CRISPR/Cas9 System
2.2. Growth Performance and Phenotypic Traits
2.3. Effect of Mstn Knockout on Basal Metabolic Rate and Body Temperature
2.4. Mstn Knockout Reduced Mitochondria Activity
2.5. Mstn Knockout Inhibited the TCA Cycle
2.6. Mstn Knockout Inhibited AMPK/SIRT1/PGC1alpha Pathway
2.7. Expression of pAMPK and SIRT1 following Treatment with AICAR and Compound C
3. Discussion
4. Materials and Methods
4.1. Mstn-KO Mouse Production and Validation
4.2. Body Temperature Measurements
4.3. Metabolic Measurements
4.4. Characterization and Analysis of Organs
4.5. Western Blot
4.6. Real-Time PCR
4.7. Biochemical Detection
4.8. Co-Immunoprecipitation
4.9. Cell Culture and Treatment
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef]
- Chen, J.L.; Colgan, T.D.; Walton, K.L.; Gregorevic, P.; Harrison, C.A. The TGF-β signalling network in muscle development, adaptation and disease. Adv. Exp. Med. Biol. 2016, 900, 97–131. [Google Scholar] [CrossRef]
- Stinckens, A.; Georges, M.; Buys, N. Mutations in the myostatin gene leading to hypermuscularity in mammals: Indications for a similar mechanism in fish? Anim. Genet. 2011, 42, 229–234. [Google Scholar] [CrossRef]
- Wang, K.; Ouyang, H.; Xie, Z.; Yao, C.; Guo, N.; Li, M.; Jiao, H.; Pang, D. Efficient generation of Myostatin mutations in pigs using the CRISPR/Cas9 system. Sci. Rep. 2015, 5, 16623. [Google Scholar] [CrossRef] [Green Version]
- Wang, K.; Tang, X.; Xie, Z.; Zou, X.; Li, M.; Yuan, H.; Guo, N.; Ouyang, H.; Jiao, H.; Pang, D. CRISPR/Cas9-mediated knockout of myostatin in Chinese indigenous Erhualian pigs. Transgenic Res. 2017, 26, 799–805. [Google Scholar] [CrossRef]
- Zou, Q.; Wang, X.; Liu, Y.; Ouyang, Z.; Long, H.; Wei, S.; Xin, J.; Zhao, B.; Lai, S.; Shen, J.; et al. Generation of gene-target dogs using CRISPR/Cas9 system. J. Mol. Cell Biol. 2015, 7, 580–583. [Google Scholar] [CrossRef] [Green Version]
- Lv, Q.; Yuan, L.; Deng, J.; Chen, M.; Wang, Y.; Zeng, J.; Li, Z.; Lai, L. Efficient generation of Myostatin gene mutated rabbit by CRISPR/Cas9. Sci. Rep. 2016, 6, 25029. [Google Scholar] [CrossRef] [Green Version]
- He, Z.; Zhang, T.; Jiang, L.; Zhou, M.; Wu, D.; Mei, J.; Cheng, Y. Use of CRISPR/Cas9 technology efficiently targetted goat myostatin through zygotes microinjection resulting in double-muscled phenotype in goats. Biosci. Rep. 2018, 38, BSR20180742. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Yu, H.; Lei, A.; Zhou, J.; Zeng, W.; Zhu, H.; Dong, Z.; Niu, Y.; Shi, B.; Cai, B.; et al. Generation of gene-modified goats targeting MSTN and FGF5 via zygote injection of CRISPR/Cas9 system. Sci. Rep. 2015, 5, 13878. [Google Scholar] [CrossRef] [Green Version]
- Crispo, M.; Mulet, A.P.; Tesson, L.; Barrera, N.; Cuadro, F.; dos Santos-Neto, P.C.; Nguyen, T.H.; Crénéguy, A.; Brusselle, L.; Anegón, I.; et al. Efficient generation of myostatin knock-out Sheep using CRISPR/Cas9 technology and microinjection into zygotes. PLoS ONE 2015, 10, e0136690. [Google Scholar] [CrossRef]
- Proudfoot, C.; Carlson, D.F.; Huddart, R.; Long, C.R.; Pryor, J.H.; King, T.J.; Lillico, S.G.; Mileham, A.J.; McLaren, D.G.; Whitelaw, C.B.; et al. Genome edited sheep and cattle. Transgenic Res. 2015, 24, 147–153. [Google Scholar] [CrossRef] [Green Version]
- Giannesini, B.; Vilmen, C.; Amthor, H.; Bernard, M.; Bendahan, D. Lack of myostatin impairs mechanical performance and ATP cost of contraction in exercising mouse gastrocnemius muscle in vivo. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E33–E40. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Yang, C.; Huang, L.; Zeng, K.; Cao, X.; Gao, J. Inefficient ATP synthesis by inhibiting mitochondrial respiration causes lipids to decrease in MSTN-lacking muscles of loach Misgurnus anguillicaudatus. Funct. Integr. Genom. 2019, 19, 889–900. [Google Scholar] [CrossRef]
- Cogliati, S.; Lorenzi, I.; Rigoni, G.; Caicci, F.; Soriano, M.E. Regulation of mitochondrial electron transport chain assembly. J. Mol. Biol. 2018, 430, 4849–4873. [Google Scholar] [CrossRef]
- Schapira, A.H. Mitochondrial disease. Lancet 2006, 368, 70–82. [Google Scholar] [CrossRef]
- Rustin, P.; Chretien, D.; Bourgeron, T.; Gérard, B.; Rötig, A.; Saudubray, J.M.; Munnich, A. Biochemical and molecular investigations in respiratory chain deficiencies. Clin. Chim. Acta 1994, 228, 35–51. [Google Scholar] [CrossRef]
- Kadenbach, B.; Ramzan, R.; Moosdorf, R.; Vogt, S. The role of mitochondrial membrane potential in ischemic heart failure. Mitochondrion 2011, 11, 700–706. [Google Scholar] [CrossRef]
- Ploquin, C.; Chabi, B.; Fouret, G.; Vernus, B.; Feillet-Coudray, C.; Coudray, C.; Bonnieu, A.; Ramonatxo, C. Lack of myostatin alters intermyofibrillar mitochondria activity, unbalances redox status, and impairs tolerance to chronic repetitive contractions in muscle. Am. J. Physiol. Endocrinol. Metab. 2012, 302, E1000–E1008. [Google Scholar] [CrossRef]
- Baati, N.; Feillet-Coudray, C.; Fouret, G.; Vernus, B.; Goustard, B.; Coudray, C.; Lecomte, J.; Blanquet, V.; Magnol, L.; Bonnieu, A.; et al. Myostatin deficiency is associated with lipidomic abnormalities in skeletal muscles. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 1044–1055. [Google Scholar] [CrossRef] [Green Version]
- Jeon, S.M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef] [Green Version]
- Horio, Y.; Hayashi, T.; Kuno, A.; Kunimoto, R. Cellular and molecular effects of sirtuins in health and disease. Clin. Sci. 2011, 121, 191–203. [Google Scholar] [CrossRef] [Green Version]
- Bost, F.; Kaminski, L. The metabolic modulator PGC-1α in cancer. Am. J. Cancer Res. 2019, 9, 198–211. [Google Scholar]
- Cantó, C.; Gerhart-Hines, Z.; Feige, J.N.; Lagouge, M.; Noriega, L.; Milne, J.C.; Elliott, P.J.; Puigserver, P.; Auwerx, J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 2009, 458, 1056–1060. [Google Scholar] [CrossRef] [Green Version]
- Rodgers, J.T.; Lerin, C.; Haas, W.; Gygi, S.P.; Spiegelman, B.M.; Puigserver, P. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 2005, 434, 113–118. [Google Scholar] [CrossRef]
- Feige, J.N.; Auwerx, J. Transcriptional coregulators in the control of energy homeostasis. Trends Cell Biol. 2007, 17, 292–301. [Google Scholar] [CrossRef]
- Yang, X.; Liu, Q.; Li, Y.; Tang, Q.; Wu, T.; Chen, L.; Pu, S.; Zhao, Y.; Zhang, G.; Huang, C.; et al. The diabetes medication canagliflozin promotes mitochondrial remodelling of adipocyte via the AMPK-Sirt1-Pgc-1α signalling pathway. Adipocyte 2020, 9, 484–494. [Google Scholar] [CrossRef]
- Hou, B.Y.; Zhao, Y.R.; Ma, P.; Xu, C.Y.; He, P.; Yang, X.Y.; Zhang, L.; Qiang, G.F.; Du, G.H. Hypoglycemic activity of puerarin through modulation of oxidative stress and mitochondrial function via AMPK. Chin. J. Nat. Med. 2020, 18, 818–826. [Google Scholar] [CrossRef]
- Lin, X.; Tang, M.; Tao, Y.; Li, L.; Liu, S.; Guo, L.; Li, Z.; Ma, X.; Xu, J.; Cao, Y. Epstein-Barr virus-encoded LMP1 triggers regulation of the ERK-mediated Op18/stathmin signaling pathway in association with cell cycle. Cancer Sci. 2012, 103, 993–999. [Google Scholar] [CrossRef]
- Deshpande, D.; Agarwal, N.; Fleming, T.; Gaveriaux-Ruff, C.; Klose, C.S.N.; Tappe-Theodor, A.; Kuner, R.; Nawroth, P. Loss of POMC-mediated antinociception contributes to painful diabetic neuropathy. Nat. Commun. 2021, 12, 426. [Google Scholar] [CrossRef]
- Višnjić, D.; Lalić, H.; Dembitz, V.; Tomić, B.; Smoljo, T. AICAr, a Widely Used AMPK Activator with Important AMPK-Independent Effects: A Systematic Review. Cells 2021, 10, 1095. [Google Scholar] [CrossRef]
- Handa, N.; Takagi, T.; Saijo, S.; Kishishita, S.; Takaya, D.; Toyama, M.; Terada, T.; Shirouzu, M.; Suzuki, A.; Lee, S.; et al. Structural basis for compound C inhibition of the human AMP-activated protein kinase α2 subunit kinase domain. Acta Crystallogr. D Biol. Crystallogr. 2011, 67, 480–487. [Google Scholar] [CrossRef]
- Lee, S.J. Extracellular regulation of myostatin: A molecular rheostat for muscle mass. Immunol. Endocr. Metab. Agents Med. Chem. 2010, 10, 183–194. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Wang, Y.; Yulin, B.; Tang, B.; Wang, M.; Zhang, C.; Zhang, W.; Jin, J.; Li, T.; Zhao, R.; et al. CRISPR/Cas9-mediated sheep MSTN gene knockout and promote sSMSCs differentiation. J. Cell Biochem. 2018, 120, 1794–1806. [Google Scholar] [CrossRef]
- Gu, H.; Cao, Y.; Qiu, B.; Zhou, Z.; Deng, R.; Chen, Z.; Li, R.; Li, X.; Wei, Q.; Xia, X.; et al. Establishment and phenotypic analysis of an Mstn knockout rat. Biochem. Biophys. Res. Commun. 2016, 477, 115–122. [Google Scholar] [CrossRef] [Green Version]
- Xu, K.; Han, C.X.; Zhou, H.; Ding, J.M.; Xu, Z.; Yang, L.Y.; He, C.; Akinyemi, F.; Zheng, Y.M.; Qin, C.; et al. Effective MSTN gene knockout by AdV-delivered CRISPR/Cas9 in postnatal chick leg muscle. Int. J. Mol. Sci. 2020, 21, 2584. [Google Scholar] [CrossRef] [Green Version]
- Zhu, X.X.; Zhan, Q.M.; Wei, Y.Y.; Yan, A.F.; Feng, J.; Liu, L.; Lu, S.S.; Tang, D.S. CRISPR/Cas9-mediated MSTN disruption accelerates the growth of Chinese Bama pigs. Reprod. Domest. Anim. 2020, 55, 1314–1327. [Google Scholar] [CrossRef]
- Wang, X.; Niu, Y.; Zhou, J.; Zhu, H.; Ma, B.; Yu, H.; Yan, H.; Hua, J.; Huang, X.; Qu, L.; et al. CRISPR/Cas9-mediated MSTN disruption and heritable mutagenesis in goats causes increased body mass. Anim. Genet. 2018, 49, 43–51. [Google Scholar] [CrossRef]
- Whittemore, L.A.; Song, K.; Li, X.; Aghajanian, J.; Davies, M.; Girgenrath, S.; Hill, J.J.; Jalenak, M.; Kelley, P.; Knight, A.; et al. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem. Biophys. Res. Commun. 2003, 300, 965–971. [Google Scholar] [CrossRef]
- Fiems, L.O. Double muscling in cattle: Genes, husbandry, carcasses and meat. Animals 2012, 2, 472–506. [Google Scholar] [CrossRef]
- Lin, J.; Arnold, H.B.; Della-Fera, M.A.; Azain, M.J.; Hartzell, D.L.; Baile, C.A. Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochem. Biophys. Res. Commun. 2002, 291, 701–706. [Google Scholar] [CrossRef]
- Luo, Z.B.; Luo, Q.R.; Xuan, M.F.; Han, S.Z.; Wang, J.X.; Guo, Q.; Choe, Y.G.; Jin, S.S.; Kang, J.D.; Yin, X.J. Comparison of internal organs between myostatin mutant and wild-type piglets. J. Sci. Food Agric. 2019, 99, 6788–6795. [Google Scholar] [CrossRef]
- Allen, D.L.; Hittel, D.S.; McPherron, A.C. Expression and function of myostatin in obesity, diabetes, and exercise adaptation. Med. Sci. Sports Exerc. 2011, 43, 1828–1835. [Google Scholar] [CrossRef] [Green Version]
- Choi, S.J.; Yablonka-Reuveni, Z.; Kaiyala, K.J.; Ogimoto, K.; Schwartz, M.W.; Wisse, B.E. Increased energy expenditure and leptin sensitivity account for low fat mass in myostatin-deficient mice. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E1031–E1037. [Google Scholar] [CrossRef]
- Amthor, H.; Macharia, R.; Navarrete, R.; Schuelke, M.; Brown, S.C.; Otto, A.; Voit, T.; Muntoni, F.; Vrbóva, G.; Partridge, T.; et al. Lack of myostatin results in excessive muscle growth but impaired force generation. Proc. Natl. Acad. Sci. USA 2007, 104, 1835–1840. [Google Scholar] [CrossRef] [Green Version]
- Ljubicic, V.; Joseph, A.M.; Saleem, A.; Uguccioni, G.; Collu-Marchese, M.; Lai, R.Y.; Nguyen, L.M.; Hood, D.A. Transcriptional and post-transcriptional regulation of mitochondrial biogenesis in skeletal muscle: Effects of exercise and aging. Biochim. Biophys. Acta 2010, 1800, 223–234. [Google Scholar] [CrossRef]
- Hubbard, B.P.; Gomes, A.P.; Dai, H.; Li, J.; Case, A.W.; Considine, T.; Riera, T.V.; Lee, J.E.; E, S.Y.; Lamming, D.W.; et al. Evidence for a common mechanism of SIRT1 regulation by allosteric activators. Science 2013, 339, 1216–1219. [Google Scholar] [CrossRef] [Green Version]
- Nemoto, S.; Fergusson, M.M.; Finkel, T. SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC-1{alpha}. J. Biol. Chem. 2005, 280, 16456–16460. [Google Scholar] [CrossRef] [Green Version]
- Ding, M.; Feng, N.; Tang, D.; Feng, J.; Li, Z.; Jia, M.; Liu, Z.; Gu, X.; Wang, Y.; Fu, F.; et al. Melatonin prevents Drp1-mediated mitochondrial fission in diabetic hearts through SIRT1-PGC1α pathway. J. Pineal. Res. 2018, 65, e12491. [Google Scholar] [CrossRef] [Green Version]
- Xue, H.; Li, P.; Luo, Y.; Wu, C.; Liu, Y.; Qin, X.; Huang, X.; Sun, C. Salidroside stimulates the Sirt1/PGC-1α axis and ameliorates diabetic nephropathy in mice. Phytomedicine 2019, 54, 240–247. [Google Scholar] [CrossRef]
- Fulco, M.; Cen, Y.; Zhao, P.; Hoffman, E.P.; McBurney, M.W.; Sauve, A.A.; Sartorelli, V. Glucose restriction inhibits skeletal myoblast differentiation by activating SIRT1 through AMPK-mediated regulation of Nampt. Dev. Cell 2008, 14, 661–673. [Google Scholar] [CrossRef] [Green Version]
- Wu, D.; Gu, M.; Wei, Z.; Bai, C.; Su, G.; Liu, X.; Zhao, Y.; Yang, L.; Li, G. Myostatin knockout regulates bile acid metabolism by promoting bile acid synthesis in cattle. Animals 2022, 12, 205. [Google Scholar] [CrossRef]
- Gao, L.; Yang, M.; Wei, Z.; Gu, M.; Yang, L.; Bai, C.; Wu, Y.; Li, G. MSTN mutant promotes myogenic differentiation by increasing demethylase TET1 expression via the SMAD2/SMAD3 pathway. Int. J. Biol. Sci. 2020, 16, 1324–1334. [Google Scholar] [CrossRef]
Heart | Liver | Spleen | Lung | Kidney | Thyroid | Pancreas | Brain | Testis | Ovary | |
---|---|---|---|---|---|---|---|---|---|---|
KO (g) | 0.20 ± 0.03 | 1.71 ± 0.45 | 0.07 ± 0.01 | 0.20 ± 0.01 | 0.48 ± 0.00 | 0.21 ± 0.01 | 0.26 ± 0.04 | 0.39 ± 0.01 | 0.17 ± 0.01 | 0.02 ± 0.00 |
WT (g) | 0.14 ± 0.00 | 1.47 ± 0.22 | 0.09 ± 0.01 | 0.19 ± 0.01 | 0.40 ± 0.00 | 0.18 ± 0.01 | 0.26 ± 0.01 | 0.44 ± 0.01 | 0.21 ± 0.01 | 0.02 ± 0.00 |
% | 22.13 | −0.55 | −33.51 | −10.01 | 2.59 | −0.26 | −14.51 | −24.23 | −30.79 | −14.51 |
O2 | CO2 | RQ | Weight/g | BMR | |
---|---|---|---|---|---|
KO | 2.40 ± 0.47 | 1.65 ± 0.34 | 0.69 ± 0.02 | 27.23 ± 0.58 | 1.36 |
WT | 2.57 ± 0.25 | 1.95 ± 0.26 | 0.76 ± 0.14 | 22.15 ± 0.84 | 1.69 |
Gene Name | Sense (5′ to 3′) | Anti-Sense (5′ to 3′) |
---|---|---|
Tfam | TGAAGCTTGTAAATGAGGCTTGGA | CGGATCGTTTCACACTTCGAC |
Nrf | TTTGGCGCAGCACCTTTG | GAGGCGGCAGCTCTGAATTAAC |
CIpp | CACACCAAGCAGAGCCTACA | TCCAAGATGCCAAACTCTTG |
GAPDH | AAATGGTGAAGGTCGGTGTGAAC | CAACAATCTCCACTTTGCCACTG |
Mstn-2ex | CAACAAAGTAGTAAAAGCCCAA | ACTTTGTCTGGCTTATGAGCAT |
Mstn-3ex | AGTCAAGGTGACAGACACACCC | GTGCTTGAATTCACAGTTTCGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, M.; Wei, Z.; Wang, X.; Gao, Y.; Wang, D.; Liu, X.; Bai, C.; Su, G.; Yang, L.; Li, G. Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle. Int. J. Mol. Sci. 2022, 23, 13703. https://doi.org/10.3390/ijms232213703
Gu M, Wei Z, Wang X, Gao Y, Wang D, Liu X, Bai C, Su G, Yang L, Li G. Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle. International Journal of Molecular Sciences. 2022; 23(22):13703. https://doi.org/10.3390/ijms232213703
Chicago/Turabian StyleGu, Mingjuan, Zhuying Wei, Xueqiao Wang, Yang Gao, Dong Wang, Xuefei Liu, Chunling Bai, Guanghua Su, Lei Yang, and Guangpeng Li. 2022. "Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle" International Journal of Molecular Sciences 23, no. 22: 13703. https://doi.org/10.3390/ijms232213703