Human Osteoblast-Conditioned Media Can Influence Staphylococcus aureus Biofilm Formation
Abstract
:1. Introduction
2. Results
2.1. Effect of Saos-2 Culture Supernatant, Stimulated or Not with TNF-α, on Planktonic Growth and Biofilm Formation
2.2. Effect of Saos-2 Culture Supernatant, Stimulated or Not with TNF-α, on Biofilm Structure
2.3. Effect of Saos-2 Culture Supernatant, Stimulated or Not with TNF-α, on Composition of Biofilm Matrix
2.4. Effect of Saos-2 Culture Supernatant, Stimulated or Not with TNF-α on Gene Expression Involved in Biofilm Formation
2.5. Effect of Primary Osteoblast Culture Supernatant on Biofilm Formation
3. Discussion
4. Materials and Methods
4.1. Osteoblast Culture and Supernatant Gathering
4.2. Bacterial Strains
4.3. S. aureus Incubation with Osteoblast Culture Supernatant
4.4. Crystal Violet Staining
4.5. Counting Method
4.6. Light Microscopy
4.7. Scanning Electron Microscopy
4.8. Confocal Laser Microscopy
4.9. RT-qPCR (RNA Purification and Reverse Transcription)
4.10. Graphical Representation of Data and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Josse, J.; Velard, F.; Gangloff, S.C. Staphylococcus aureus vs. Osteoblast: Relationship and Consequences in Osteomyelitis. Front. Cell. Infect. Microbiol. 2015, 5, 85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reffuveille, F.; Josse, J.; Velard, F.; Lamret, F.; Varin-Simon, J.; Dubus, M.; Haney, E.F.; Hancock, R.; Mongaret, C.; Gangloff, S.C. Bone Environment Influences Irreversible Adhesion of a Methicillin-Susceptible Staphylococcus aureus Strain. Front. Microbiol. 2018, 9, 2865. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mongaret, C.; Varin-Simon, J.; Lamret, F.; El-Mahdy, T.S.; Brasme, L.; Vernet-Garnier, V.; Gangloff, S.C.; Ohl, X.; Reffuveille, F. Cutibacterium acnes Biofilm Study during Bone Cells Interaction. Microorganisms 2020, 8, 1409. [Google Scholar] [CrossRef]
- Lamret, F.; Varin-Simon, J.; Velard, F.; Terryn, C.; Mongaret, C.; Colin, M.; Gangloff, S.C.; Reffuveille, F. Staphylococcus aureus Strain-Dependent Biofilm Formation in Bone-Like Environment. Front. Microbiol. 2021, 12, 714994. [Google Scholar] [CrossRef] [PubMed]
- Bjarnsholt, T.; Whiteley, M.; Rumbaugh, K.P.; Stewart, P.S.; Jensen, P.; Frimodt-Møller, N. The importance of understanding the infectious microenvironment. Lancet Infect. Dis. 2021, 22, e88–e92. [Google Scholar] [CrossRef]
- Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial Biofilms: A Common Cause of Persistent Infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Høiby, N.; Ciofu, O.; Johansen, H.K.; Song, Z.-J.; Moser, C.; Jensen, P.Ø.; Molin, S.; Givskov, M.; Tolker-Nielsen, T.; Bjarnsholt, T. The clinical impact of bacterial biofilms. Int. J. Oral Sci. 2011, 3, 55–65. [Google Scholar] [CrossRef] [Green Version]
- Zimmerli, W.; Sendi, P. Orthopaedic biofilm infections. Apmis 2017, 125, 353–364. [Google Scholar] [CrossRef] [Green Version]
- Beck-Broichsitter, B.E.; Smeets, R.; Heiland, M. Current concepts in pathogenesis of acute and chronic osteomyelitis. Curr. Opin. Infect. Dis. 2015, 28, 240–245. [Google Scholar] [CrossRef]
- Shoji, M.M.; Chen, A.F. Biofilms in Periprosthetic Joint Infections: A Review of Diagnostic Modalities, Current Treatments, and Future Directions. J. Knee Surg. 2020, 33, 119–131. [Google Scholar] [CrossRef]
- Butrico, C.E.; Cassat, J.E. Quorum Sensing and Toxin Production in Staphylococcus aureus Osteomyelitis: Pathogenesis and Paradox. Toxins 2020, 12, 516. [Google Scholar] [CrossRef] [PubMed]
- Cassat, J.E.; Hammer, N.D.; Campbell, J.P.; Benson, M.A.; Perrien, D.S.; Mrak, L.N.; Smeltzer, M.S.; Torres, V.J.; Skaar, E.P. A Secreted Bacterial Protease Tailors the Staphylococcus aureus Virulence Repertoire to Modulate Bone Remodeling during Osteomyelitis. Cell Host Microbe 2013, 13, 759–772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rasigade, J.-P.; Trouillet-Assant, S.; Ferry, T.; Diep, B.A.; Sapin, A.; Lhoste, Y.; Ranfaing, J.; Badiou, C.; Benito, Y.; Bes, M.; et al. PSMs of Hypervirulent Staphylococcus aureus Act as Intracellular Toxins That Kill Infected Osteoblasts. PLoS ONE 2013, 8, e63176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marriott, I. Osteoblast Responses to Bacterial Pathogens: A Previously Unappreciated Role for Bone-Forming Cells in Host Defense and Disease Progression. Immunol. Res. 2004, 30, 291–308. [Google Scholar] [CrossRef]
- Dapunt, U.; Giese, T.; Stegmaier, S.; Moghaddam, A.; Hänsch, G.M. The osteoblast as an inflammatory cell: Production of cytokines in response to bacteria and components of bacterial biofilms. BMC Musculoskelet. Disord. 2016, 17, 243. [Google Scholar] [CrossRef] [Green Version]
- Gibon, E.; Amanatullah, D.F.; Loi, F.; Pajarinen, J.; Nabeshima, A.; Yao, Z.; Hamadouche, M.; Goodman, S.B. The biological response to orthopaedic implants for joint replacement: Part I: Metals. J. Biomed. Mater. Res. Part B Appl. Biomater. 2017, 105, 2162–2173. [Google Scholar] [CrossRef] [Green Version]
- Gibon, E.; Córdova, L.A.; Lu, L.; Lin, T.-H.; Yao, Z.; Hamadouche, M.; Goodman, S.B. The biological response to orthopedic implants for joint replacement. II: Polyethylene, ceramics, PMMA, and the foreign body reaction. J. Biomed. Mater. Res. Part B Appl. Biomater. 2017, 105, 1685–1691. [Google Scholar] [CrossRef] [Green Version]
- De La Fuente-Núñez, C.; Reffuveille, F.; Haney, E.F.; Straus, S.K.; Hancock, R.E.W. Broad-Spectrum Anti-biofilm Peptide That Targets a Cellular Stress Response. PLoS Pathog. 2014, 10, e1004152. [Google Scholar] [CrossRef] [Green Version]
- Rice, K.C.; Mann, E.E.; Endres, J.L.; Weiss, E.C.; Cassat, J.E.; Smeltzer, M.S.; Bayles, K.W. The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 2007, 104, 8113–8118. [Google Scholar] [CrossRef] [Green Version]
- Buck, A.W.; Fowler, J.V.G.; Yongsunthon, R.; Liu, J.; DiBartola, A.C.; Que, Y.-A.; Moreillon, P.; Lower, S.K. Bonds between Fibronectin and Fibronectin-Binding Proteins on Staphylococcus aureus and Lactococcus lactis. Langmuir 2010, 26, 10764–10770. [Google Scholar] [CrossRef]
- Geiger, T.; Goerke, C.; Fritz, M.; Schäfer, T.; Ohlsen, K.; Liebeke, M.; Lalk, M.; Wolz, C. Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, in Stringent Response and Virulence of Staphylococcus aureus. Infect. Immun. 2010, 78, 1873–1883. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Archer, N.K.; Mazaitis, M.J.; Costerton, J.W.; Leid, J.G.; Powers, M.E.; Shirtliff, M.E. Staphylococcus aureus biofilms: Properties, Regulation, and Roles in Human Disease. Virulence 2011, 2, 445–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kiedrowski, M.R.; Kavanaugh, J.S.; Malone, C.L.; Mootz, J.M.; Voyich, J.M.; Smeltzer, M.S.; Bayles, K.W.; Horswill, A.R. Nuclease Modulates Biofilm Formation in Community-Associated Methicillin-Resistant Staphylococcus aureus. PLoS ONE 2011, 6, e26714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, H.T.; Nguyen, T.H.; Otto, M. The staphylococcal exopolysaccharide PIA—Biosynthesis and role in biofilm formation, colonization, and infection. Comput. Struct. Biotechnol. J. 2020, 18, 3324–3334. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Maltesen, R.G.; Larsen, L.H.; Schønheyder, H.C.; Le, V.Q.; Nielsen, J.L.; Nielsen, P.H.; Thomsen, T.R.; Nielsen, K.L. In vivo gene expression in a Staphylococcus aureus prosthetic joint infection characterized by RNA sequencing and metabolomics: A pilot study. BMC Microbiol. 2016, 16, 80. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bost, K.L.; Ramp, W.K.; Nicholson, N.C.; Bento, J.L.; Marriott, I.; Hudson, M.C. Staphylococcus aureus Infection of Mouse or Human Osteoblasts Induces High Levels of Interleukin-6 and Interleukin-12 Production. J. Infect. Dis. 1999, 180, 1912–1920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gasper, N.A.; Petty, C.C.; Schrum, L.W.; Marriott, I.; Bost, K.L. Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4. Infect. Immun. 2002, 70, 4075–4082. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Varoga, D.; Tohidnezhad, M.; Paulsen, F.; Wruck, C.J.; Brandenburg, L.; Mentlein, R.; Lippross, S.; Hassenpflug, J.; Besch, L.; Müller, M.; et al. The role of human β-defensin-2 in bone. J. Anat. 2008, 213, 749–757. [Google Scholar] [CrossRef] [PubMed]
- Meduri, G.U.; Kanangat, S.; Stefan, J.; Tolley, E.; Schaberg, D. Cytokines IL-1 β, IL-6, and TNF-α Enhance In Vitro Growth of Bacteria. Am. J. Respir. Crit. Care Med. 1999, 160, 961–967. [Google Scholar] [CrossRef]
- eMcCarthy, H.; Rudkin, J.; Black, N.; Egallagher, L.; O’Neill, E.; O’Gara, J.P. Methicillin resistance and the biofilm phenotype in Staphylococcus aureus. Front. Cell. Infect. Microbiol. 2015, 5, 1. [Google Scholar] [CrossRef]
- Arya, R.; Ravikumar, R.; Santhosh, R.S.; Princy, S.A. SarA based novel therapeutic candidate against Staphylococcus aureus associated with vascular graft infections. Front. Microbiol. 2015, 6, 416. [Google Scholar] [CrossRef] [Green Version]
- O’Neill, E.; Pozzi, C.; Houston, P.; Smyth, D.; Humphreys, H.; Robinson, D.A.; O’Gara, J.P. Association between Methicillin Susceptibility and Biofilm Regulation in Staphylococcus aureus Isolates from Device-Related Infections. J. Clin. Microbiol. 2007, 45, 1379–1388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horváth, A.; Dobay, O.; Sahin-Tóth, J.; Juhász, E.; Pongrácz, J.; Iván, M.; Fazakas, E.; Kristóf, K. Characterisation of antibiotic resistance, virulence, clonality and mortality in MRSA and MSSA bloodstream infections at a tertiary-level hospital in Hungary: A 6-year retrospective study. Ann. Clin. Microbiol. Antimicrob. 2020, 19, 17. [Google Scholar] [CrossRef] [PubMed]
- Midorikawa, K.; Ouhara, K.; Komatsuzawa, H.; Kawai, T.; Yamada, S.; Fujiwara, T.; Yamazaki, K.; Sayama, K.; Taubman, M.A.; Kurihara, H.; et al. Staphylococcus aureus Susceptibility to Innate Antimicrobial Peptides, β-Defensins and CAP18, Expressed by Human Keratinocytes. Infect. Immun. 2003, 71, 3730–3739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Delion, M.; Braux, J.; Jourdain, M.-L.; Guillaume, C.; Bour, C.; Gangloff, S.; Le Pimpec-Barthes, F.; Sermet-Gaudelus, I.; Jacquot, J.; Velard, F. Overexpression of RANKL in osteoblasts: A possible mechanism of susceptibility to bone disease in cystic fibrosis. J. Pathol. 2016, 240, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Horsburgh, M.J.; Aish, J.L.; White, I.J.; Shaw, L.; Lithgow, J.K.; Foster, S.J. σB Modulates Virulence Determinant Expression and Stress Resistance: Characterization of a Functional rsbU Strain Derived from Staphylococcus aureus 8325-4. J. Bacteriol. 2002, 184, 5457–5467. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Forward Primer (5′ → 3′) | Reverse Primer (3′ → 5′) | Efficiency |
---|---|---|---|
rho | AACGTGGGGATAAAGTAACTGG | TTCACTTCTTCTGCGTTATGGT | 1.9 |
icaC | TCGTATATTTACGTGCCATTATATGTG | AAGCAAGGTGTACCAAAAATGAC | 1.9 |
sarA | TTTCTCTTTGTTTTCGCTGATGT | TGTTATCAATGGTCACTTATGCTG | 2 |
rsh | CGAAACCTAATAACGTATCAAATGC | TGTATGTAGATCGAAAACCATCACT | 2 |
cidA | GATTGTACCGCTAACTTGGGT | GCGTAATTTCGGAAGCAACAT | 1.8 |
nuc | TCGAGTTTGACAAAGGCCAA | AAGCAACTTTAGCCAAGCCT | 1.9 |
fnbpB | AATTAAATCAGAGCCGCCAGT | AATGGTACCTTCTGCATGACC | 2.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lamret, F.; Varin-Simon, J.; Six, M.; Thoraval, L.; Chevrier, J.; Adam, C.; Guillaume, C.; Velard, F.; Gangloff, S.C.; Reffuveille, F. Human Osteoblast-Conditioned Media Can Influence Staphylococcus aureus Biofilm Formation. Int. J. Mol. Sci. 2022, 23, 14393. https://doi.org/10.3390/ijms232214393
Lamret F, Varin-Simon J, Six M, Thoraval L, Chevrier J, Adam C, Guillaume C, Velard F, Gangloff SC, Reffuveille F. Human Osteoblast-Conditioned Media Can Influence Staphylococcus aureus Biofilm Formation. International Journal of Molecular Sciences. 2022; 23(22):14393. https://doi.org/10.3390/ijms232214393
Chicago/Turabian StyleLamret, Fabien, Jennifer Varin-Simon, Mélodie Six, Léa Thoraval, Julie Chevrier, Cloé Adam, Christine Guillaume, Frédéric Velard, Sophie C. Gangloff, and Fany Reffuveille. 2022. "Human Osteoblast-Conditioned Media Can Influence Staphylococcus aureus Biofilm Formation" International Journal of Molecular Sciences 23, no. 22: 14393. https://doi.org/10.3390/ijms232214393