Blockade of β2-Adrenergic Receptor Reduces Inflammation and Oxidative Stress in Clear Cell Renal Cell Carcinoma
Abstract
:1. Introduction
2. Results
2.1. β2-Blockers and Viability of ccRCC Cells
2.2. β-Blockers and ROS in ccRCC Cells
2.3. Inflammatory Markers Downregulation in ccRCC after Treatment with β-Blockers
2.4. In Vivo Xenografts of 786-O Cells in Untreated and β-Blockers Treated Mice
3. Discussion
Limitations of This Study
4. Materials and Methods
4.1. RRC Primary Cell Cultures Isolation and Subcultivation
4.2. RCC Commercial Cell Line
4.3. ADBR2-Antagonists Treatments
4.4. Real-Time RT-PCR (qPCR)
4.5. Cell Viability Assay
4.6. Molecular Biology Assay: Reactive Oxygen Species (ROS) Determination
4.7. Immunohistochemistry
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Du, W.; Zhang, L.; Brett-Morris, A.; Aguila, B.; Kerner, J.; Hoppel, C.L.; Puchowicz, M.; Serra, D.; Herrero, L.; Rini, B.I.; et al. HIF drives lipid deposition and cancer in ccRCC via repression of fatty acid metabolism. Nat. Commun. 2017, 8, 1769. [Google Scholar] [CrossRef] [PubMed]
- Albiñana, V.; Gallardo-Vara, E.; de Rojas-P, I.; Recio-Poveda, L.; Aguado, T.; Canto-Cano, A.; Aguirre, D.T.; Serra, M.M.; González-Peramato, P.; Martínez-Piñeiro, L.; et al. Targeting β2-Adrenergic Receptors Shows Therapeutical Benefits in Clear Cell Renal Cell Carcinoma from Von Hippel–Lindau Disease. J. Clin. Med. 2020, 9, 2740. [Google Scholar] [CrossRef] [PubMed]
- Krieg, M.; Haas, R.; Brauch, H.; Acker, T.; Flamme, I.; Plate, K.H. Up-regulation of hypoxia-inducible factors HIF-1α and HIF-2α under normoxic conditions in renal carcinoma cells by von Hippel-Lindau tumor suppressor gene loss of function. Oncogene 2000, 19, 5435–5443. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kassardjian, C.D.; Macdonald, R.L.; Munoz, D.G. Hemangioblastomas in the elderly: Epidemiology and clinical characteristics. J. Clin. Neurosci. 2014, 21, 1205–1208. [Google Scholar] [CrossRef] [PubMed]
- Neumann, H.P.H.; Bender, B.U.; Berger, D.P.; Laubenberger, J.; Schultze-Seemann, W.; Wetterauer, U.; Ferstl, F.J.; Herbst, E.W.; Schwarzkopf, G.; Hes, F.J.; et al. Prevalence, morphology and biology of renal cell carcinoma in von Hippel-Lindau disease compared to sporadic renal cell carcinoma. J. Urol. 1998, 160, 1248–1254. [Google Scholar] [CrossRef]
- Bausch, B.; Jilg, C.; Gläsker, S.; Vortmeyer, A.; Lützen, N.; Anton, A.; Eng, C.; Neumann, H.P.H. Renal cancer in von Hippel-Lindau disease and related syndromes. Nat. Rev. Nephrol. 2013, 9, 529–538. [Google Scholar] [CrossRef] [PubMed]
- Montani, M.; Heinimann, K.; Von Teichman, A.; Rudolph, T.; Perren, A.; Moch, H. VHL-gene deletion in single renal tubular epithelial cells and renal tubular cysts: Further evidence for a cyst-dependent progression pathway of clear cell renal carcinoma in von hippel-lindau disease. Am. J. Surg. Pathol. 2010, 34, 806–815. [Google Scholar] [CrossRef] [PubMed]
- Heidegger, I.; Pircher, A.; Pichler, R. Targeting the tumor microenvironment in renal cell cancer biology and therapy. Front. Oncol. 2019, 9, 490. [Google Scholar] [CrossRef] [Green Version]
- Jonasch, E.; Donskov, F.; Iliopoulos, O.; Rathmell, W.K.; Narayan, V.; Maughan, B.L.; Oudard, S.; Else, T.; Maranchie, J.K.; Welsh, S.J.; et al. Phase II study of the oral HIF-2α inhibitor MK-6482 for Von Hippel-Lindau disease–associated renal cell carcinoma. J. Clin. Oncol. 2020, 38, 5003. [Google Scholar] [CrossRef]
- Choueiri, T.K.; Bauer, T.M.; Papadopoulos, K.P.; Plimack, E.R.; Merchan, J.R.; McDermott, D.F.; Michaelson, M.D.; Appleman, L.J.; Thamake, S.; Perini, R.F.; et al. Inhibition of hypoxia-inducible factor-2α in renal cell carcinoma with belzutifan: A phase 1 trial and biomarker analysis. Nat. Med. 2021, 27, 802–805. [Google Scholar] [CrossRef]
- Léauté-Labrèze, C.; De La Roque, E.D.; Hubiche, T.; Boralevi, F.; Thambo, J.B.; Taïeb, A. Propranolol for severe hemangiomas of infancy. N. Engl. J. Med. 2008, 358, 2649–2651. [Google Scholar] [CrossRef] [PubMed]
- Albiñana, V.; Villar Gómez De Las Heras, K.; Serrano-Heras, G.; Segura, T.; Perona-Moratalla, A.B.; Mota-Pérez, M.; De Campos, J.M.; Botella, L.M. Propranolol reduces viability and induces apoptosis in hemangioblastoma cells from von Hippel-Lindau patients. Orphanet J. Rare Dis. 2015, 10, 118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albiñana, V.; Escribano, R.M.J.; Soler, I.; Padial, L.R.; Recio-Poveda, L.; Villar Gómez De Las Heras, K.; Botella, L.M. Repurposing propranolol as a drug for the treatment of retinal haemangioblastomas in von Hippel-Lindau disease. Orphanet J. Rare Dis. 2017, 12, 122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cuesta, A.M.; Albiñana, V.; Gallardo-Vara, E.; Recio-Poveda, L.; de Rojas-P, I.; de Las Heras, K.V.G.; Aguirre, D.T.; Botella, L.M. The β2-adrenergic receptor antagonist ICI-118,551 blocks the constitutively activated HIF signalling in hemangioblastomas from von Hippel-Lindau disease. Sci. Rep. 2019, 9, 10062. [Google Scholar] [CrossRef] [PubMed]
- Lai, Y.; Tang, F.; Huang, Y.; He, C.; Chen, C.; Zhao, J.; Wu, W.; He, Z. The tumour microenvironment and metabolism in renal cell carcinoma targeted or immune therapy. J. Cell Physiol. 2021, 236, 1616–1627. [Google Scholar] [CrossRef]
- de Rojas-P, I.; Albiñana, V.; Taranets, L.; Recio-Poveda, L.; Cuesta, A.M.; Popov, N.; Kronenberger, T.; Botella, L.M. The Endothelial Landscape and Its Role in Von Hippel–Lindau Disease. Cells 2021, 10, 2313. [Google Scholar] [CrossRef]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Jonasch, E.; Gao, J.; Rathmell, W.K. Renal cell carcinoma. BMJ 2014, 349, g4797. [Google Scholar] [CrossRef]
- Latif, F.; Tory, K.; Gnarra, J.; Yao, M.; Duh, F.M.; Orcutt, M.L.; Stackhouse, T.; Kuzmin, I.; Modi, W.; Geil, L.; et al. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 1993, 260, 1317–1320. [Google Scholar] [CrossRef]
- Lonser, R.R.; Glenn, G.M.; Walther, M.; Chew, E.Y.; Libutti, S.K.; Linehan, W.M.; Oldfield, E.H. Von Hippel-Lindau disease. Lancet 2003, 361, 2059–2067. [Google Scholar] [CrossRef]
- Ho, T.H.; Jonasch, E. Genetic kidney cancer syndromes. J. Natl. Compr. Cancer Netw. 2014, 12, 1347–1355. [Google Scholar] [CrossRef] [PubMed]
- Nickerson, M.L.; Jaeger, E.; Shi, Y.; Durocher, J.A.; Mahurkar, S.; Zaridze, D.; Matveev, V.; Janout, V.; Kollarova, H.; Bencko, V.; et al. Improved identification of von Hippel-Lindau gene alterations in clear cell renal tumors. Clin. Cancer Res. 2008, 14, 4726–4734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bader, H.L.; Hsu, T. Systemic VHL gene functions and the VHL disease. FEBS Lett. 2012, 586, 1562–1569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maxwell, P.H.; Wlesener, M.S.; Chang, G.W.; Clifford, S.C.; Vaux, E.C.; Cockman, M.E.; Wykoff, C.C.; Pugh, C.W.; Maher, E.R.; Ratcliffe, P.J. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1999, 399, 271–275. [Google Scholar] [CrossRef]
- Keith, B.; Johnson, R.S.; Simon, M.C. HIF1alpha and HIF2alpha: Sibling rivalry in hypoxic tumour growth and progression. Nat. Rev. Cancer 2011, 12, 9–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schödel, J.; Grampp, S.; Maher, E.R.; Moch, H.; Ratcliffe, P.J.; Russo, P.; Mole, D.R. Hypoxia, hypoxia-inducible transcription factors, and renal cancer. Eur. Urol. 2016, 69, 646–657. [Google Scholar] [CrossRef] [Green Version]
- Haake, S.M.; Li, J.; Bai, Y.; Kinose, F.; Fang, B.; Welsh, E.A.; Zent, R.; Dhillon, J.; Pow-Sang, J.M.; Chen, Y.A.; et al. Tyrosine kinase signaling in clear cell and papillary renal cell carcinoma revealed by mass spectrometry-based phosphotyrosine proteomics. Clin. Cancer Res. 2016, 22, 5605–5616. [Google Scholar] [CrossRef] [Green Version]
- Lai, Y.; Zhao, Z.; Zeng, T.; Liang, X.; Chen, D.; Duan, X.; Zeng, G.; Wu, W. Crosstalk between VEGFR and other receptor tyrosine kinases for TKI therapy of metastatic renal cell carcinoma. Cancer Cell Int. 2018, 18, 31. [Google Scholar] [CrossRef]
- Chen, W.; Hill, H.; Christie, A.; Kim, M.S.; Holloman, E.; Pavia-Jimenez, A.; Homayoun, F.; Ma, Y.; Patel, N.; Yell, P.; et al. Targeting renal cell carcinoma with a HIF-2 antagonist. Nature 2016, 539, 112–117. [Google Scholar] [CrossRef] [Green Version]
- Clark, D.J.; Dhanasekaran, S.M.; Petralia, F.; Pan, J.; Song, X.; Hu, Y.; da Veiga Leprevost, F.; Reva, B.; Lih, T.M.; Chang, H.Y.; et al. Clinical Proteomic Tumor Analysis Consortium. Integrated Proteogenomic Characterization of Clear Cell Renal Cell Carcinoma. Cell 2020, 180, 207, Erratum in Cell 2019, 179, 964–983. [Google Scholar] [CrossRef] [PubMed]
- Courtney, K.D.; Bezwada, D.; Mashimo, T.; Pichumani, K.; Vemireddy, V.; Funk, A.M.; Wimberly, J.; McNeil, S.S.; Kapur, P.; Lotan, Y.; et al. Isotope Tracing of Human Clear Cell Renal Cell Carcinomas Demonstrates Suppressed Glucose Oxidation In Vivo. Cell Metab. 2018, 28, 793–800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weiss, R.H. Metabolomics and Metabolic Reprogramming in Kidney Cancer. Semin. Nephrol. 2018, 38, 175–182. [Google Scholar] [CrossRef] [PubMed]
- Fulda, S.; Galluzzi, L.; Kroemer, G. Targeting mitochondria for cancer therapy. Nat. Rev. Drug Discov. 2010, 9, 447–464. [Google Scholar] [CrossRef]
- Lebelo, M.T.; Joubert, A.M.; Visagie, M.H. Warburg effect and its role in tumourigenesis. Arch. Pharmacal Res. 2019, 42, 833–847. [Google Scholar] [CrossRef]
- Delahunt, B.; Eble, J.N.; Egevad, L.; Samaratunga, H. Grading of renal cell carcinoma. Histopathology 2019, 74, 4–17. [Google Scholar] [CrossRef] [Green Version]
- Ursini, F.; Maiorino, M.; Valente, M.; Ferri, L.; Gregolin, C. Purification from pig liver of a protein which protects liposomes and biomembranes from peroxidative degradation and exhibits glutathione peroxidase activity on phosphatidylcholine hydroperoxides. Biochim. Biophys. Acta 1982, 710, 197–211. [Google Scholar] [CrossRef]
- Friedmann Angeli, J.P.; Schneider, M.; Proneth, B.; Tyurina, Y.Y.; Tyurin, V.A.; Hammond, V.J.; Herbach, N.; Aichler, M.; Walch, A.; Eggenhofer, E.; et al. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Nat. Cell Biol. 2014, 16, 1180–1191. [Google Scholar] [CrossRef] [Green Version]
- An, J.; Rettig, M.B. Mechanism of von Hippel-Lindau Protein-Mediated Suppression of Nuclear Factor kappa B Activity. Mol. Cell Biol. 2005, 25, 7546–7556. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Minamishima, Y.A.; Yan, Q.; Schlisio, S.; Ebert, B.L.; Zhang, X.; Zhang, L.; Kim, W.Y.; Olumi, A.F.; Kaelin, W.G. pVHL Acts as an Adaptor to Promote the Inhibitory Phosphorylation of the NF-κB Agonist Card9 by CK2. Mol. Cell 2007, 28, 15–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peri, S.; Devarajan, K.; Yang, D.H.; Knudson, A.G.; Balachandran, S. Meta-Analysis Identifies NF-κB as a Therapeutic Target in Renal Cancer. PLoS ONE 2013, 8, e76746. [Google Scholar]
Patient | Gender | Age | Age of Diagnosis | Location | c.DNA | Protein Change | Clinical Symptoms | Specific Treatment |
---|---|---|---|---|---|---|---|---|
ccRCC4 | male | 48 | 24 | exon 3 | c.501C>T | p.Arg167Trp | billateral ccRCC CNS-HB Pheochromocytoma | No |
ccRCC7 | male | 56 | 28 | exon 2 | c.406T>A | p.Leu135X | ccRCC | No |
ccRCC13 | male | 30 | 20 | exon 3 | c.486C>G | p.Cys162Trp | ccRCC brain trunk-and retinal-HBs | Propranolol (2 years before ccRCC surgery) |
ccRCC18 | female | 48 | 30 | exon 2 | c.452T>G | p.Ile151Ser | billateral ccRCC medula-and cerebellum-HBs | No |
Gene | Fwd 5′–3′ | Rev 5′–3′ |
---|---|---|
18S | CTCAACACGGGAAACCTCAC | CGCTCCACCAACTAAGAACG |
Glutathione peroxidase | TGGTGGVVTGTGTCTGTAGT | TCAGGATCTCCTCATTCTGACA |
SOD2 | AACACCTCCCTACGCCAAC | TCCCTCGTGCTTGGATTG |
Catalase | CTCCGGAACAACAGCCTTC | ATAGAATGCCCGCACCTG |
Nucleoredoxin | AGAAGCCTCGCCTTTTCCTA | CCTCCACCCTCACTCCATC |
IL-1β | CTGTCCTGCGTGTTGAAAGA | TTGGGTAATTTTTGGGATCTACA |
IL-6 | CAGGAGCCCAGCTATGAACT | GAAGGCAGCAGGCAACAC |
TNFAIP6 | GGCCATCTCGCAACTTACA | GCAGCACAGACATGAAATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Albiñana, V.; Recio-Poveda, L.; González-Peramato, P.; Martinez-Piñeiro, L.; Botella, L.M.; Cuesta, A.M. Blockade of β2-Adrenergic Receptor Reduces Inflammation and Oxidative Stress in Clear Cell Renal Cell Carcinoma. Int. J. Mol. Sci. 2022, 23, 1325. https://doi.org/10.3390/ijms23031325
Albiñana V, Recio-Poveda L, González-Peramato P, Martinez-Piñeiro L, Botella LM, Cuesta AM. Blockade of β2-Adrenergic Receptor Reduces Inflammation and Oxidative Stress in Clear Cell Renal Cell Carcinoma. International Journal of Molecular Sciences. 2022; 23(3):1325. https://doi.org/10.3390/ijms23031325
Chicago/Turabian StyleAlbiñana, Virginia, Lucía Recio-Poveda, Pilar González-Peramato, Luis Martinez-Piñeiro, Luisa María Botella, and Angel M. Cuesta. 2022. "Blockade of β2-Adrenergic Receptor Reduces Inflammation and Oxidative Stress in Clear Cell Renal Cell Carcinoma" International Journal of Molecular Sciences 23, no. 3: 1325. https://doi.org/10.3390/ijms23031325