MiR-29a Curbs Hepatocellular Carcinoma Incidence via Targeting of HIF-1α and ANGPT2
Abstract
:1. Introduction
2. Results
2.1. MIR-29a Is a Significant Suppressor of HIF1A and ANGPT2 in HCC
2.2. Western Diet (WD) Combine Carbon Tetrachloride (CCl4) Treated Promote Chronic Liver Disease and Cancer Formation
2.3. WD/CCl4 Treated Intervention miR-29a Expression and Promoted Tumorigenesis Signaling in Liver Tissue
2.4. miR-29a Targeted the 3′-UTR of HIF-1a and ANGPT2
3. Discussion
4. Materials and Methods
4.1. miR-29a Interacted Cancer Gene Sets Platform Interpretation and Genes Differential Expression in HCC Patients Outcome Correlation
4.2. The HCC Mice Model Generative
4.3. Liver Tissue Section and Staining
4.4. Cell Culture and Transfection
4.5. Quantitative RT-PCR
4.6. Western Blotting
4.7. Luciferase Reporter Activity Assay
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- European Association for the Study of the Liver. ASL Clinical Practice Guidelines: Management of hepatocellular carcinoma. J. Hepatol. 2018, 69, 182–236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thilakarathna, W.; Rupasinghe, H.P.V.; Ridgway, N.D. Mechanisms by which probiotic bacteria attenuate the risk of hepatocellular carcinoma. Int. J. Mol. Sci. 2021, 22, 2606. [Google Scholar] [CrossRef] [PubMed]
- Caines, A.; Selim, R.; Salgia, R. The changing global epidemiology of hepatocellular carcinoma. Clin. Liver Dis. 2020, 24, 535–547. [Google Scholar] [CrossRef] [PubMed]
- Solimando, A.G.; Summa, S.; Vacca, A.; Ribatti, D. Cancer-associated angiogenesis: The endothelial cell as a checkpoint for immunological patrolling. Cancers 2020, 12, 3380. [Google Scholar] [CrossRef]
- Morse, M.A.; Sun, W.; Kim, R.; He, A.R.; Abada, P.B.; Mynderse, M.; Finn, R.S. The role of angiogenesis in hepatocellular carcinoma. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2019, 25, 912–920. [Google Scholar] [CrossRef] [Green Version]
- Lou, W.; Liu, J.; Gao, Y.; Zhong, G.; Ding, B.; Xu, L.; Fan, W. MicroRNA regulation of liver cancer stem cells. Am. J. Cancer Res. 2018, 8, 1126–1141. [Google Scholar]
- Huang, Y.H.; Yang, Y.L.; Wang, F.S. The role of miR-29a in the regulation, function, and signaling of liver fibrosis. Int. J. Mol. Sci. 2018, 19, 1889. [Google Scholar] [CrossRef] [Green Version]
- Lin, Y.C.; Wang, F.S.; Yang, Y.L.; Chuang, Y.T.; Huang, Y.H. MicroRNA-29a mitigation of toll-like receptor 2 and 4 signaling and alleviation of obstructive jaundice-induced fibrosis in mice. Biochem. Biophys. Res. Commun. 2018, 496, 880–886. [Google Scholar] [CrossRef]
- Huang, Y.H.; Kuo, H.C.; Yang, Y.L.; Wang, F.S. MicroRNA-29a is a key regulon that regulates BRD4 and mitigates liver fibrosis in mice by inhibiting hepatic stellate cell activation. Int. J. Med. Sci. 2019, 16, 212–220. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.H.; Yu-Hsieh, H.; Huang, C.C.; Shin-Mu, V.T.; Tai, M.H.; Chen, C.L.; Chuang, J.H. Liver hepcidin and stainable iron expression in biliary atresia. Pediatr. Res. 2006, 59, 662–666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, H.Y.; Wang, F.S.; Yang, Y.L.; Huang, Y.H. MicroRNA-29a suppresses CD36 to ameliorate high fat diet-induced steatohepatitis and liver fibrosis in mice. Cells 2019, 8, 1298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, H.Y.; Yang, Y.L.; Wang, P.W.; Wang, F.S.; Huang, Y.H. The emerging role of MicroRNAs in Nafld: Highlight of MicroRNA-29a in modulating oxidative stress, inflammation, and beyond. Cells 2020, 9, 1041. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.L.; Kuo, H.C.; Wang, F.S.; Huang, Y.H. MicroRNA-29a disrupts DNMT3b to ameliorate diet-induced non-alcoholic steatohepatitis in mice. Int. J. Mol. Sci. 2019, 20, 1499. [Google Scholar] [CrossRef] [Green Version]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef]
- Yang, Y.L.; Tsai, M.C.; Chang, Y.H.; Wang, C.C.; Chu, P.Y.; Lin, H.Y.; Huang, Y.H. MIR29A impedes metastatic behaviors in hepatocellular carcinoma via targeting LOX, LOXL2, and VEGFA. Int. J. Mol. Sci. 2021, 22, 6001. [Google Scholar] [CrossRef]
- Choi, G.H.; Jang, E.S.; Kim, J.W.; Jeong, S.H. Prognostic role of plasma level of angiopoietin-1, angiopoietin-2, and vascular endothelial growth factor in hepatocellular carcinoma. World J. Gastroenterol. 2021, 27, 4453–4467. [Google Scholar] [CrossRef]
- Borsi, E.; Terragna, C.; Brioli, A.; Tacchetti, P.; Martello, M.; Cavo, M. Therapeutic targeting of hypoxia and hypoxia-inducible factor 1 alpha in multiple myeloma. Transl. Res. 2015, 165, 641–650. [Google Scholar] [CrossRef]
- de Heer, E.C.; Jalving, M.; Harris, A.L. HIFs, angiogenesis, and metabolism: Elusive enemies in breast cancer. J. Clin. Invest. 2020, 130, 5074–5087. [Google Scholar] [CrossRef]
- Choudhry, H.; Harris, A.L. Advances in hypoxia-inducible factor biology. Cell Metab. 2018, 27, 281–298. [Google Scholar] [CrossRef]
- Jiang, X.; Wang, J.; Deng, X.; Xiong, F.; Zhang, S.; Gong, Z.; Li, X.; Cao, K.; Deng, H.; He, Y.; et al. The role of microenvironment in tumor angiogenesis. J. Exp. Clin. Cancer Res. 2020, 39, 204. [Google Scholar] [CrossRef] [PubMed]
- Bao, M.H.; Wong, C.C. Hypoxia, metabolic reprogramming, and drug resistance in liver cancer. Cells 2021, 10, 1715. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.H.; Jiang, J.R.; Ma, X.K.; Chen, J.; Li, H.P.; Li, X.; Wu, X.Y.; Huang, M.S.; Lin, Q. Prognostic value of serum HIF-1alpha change following transarterial chemoembolization in hepatocellular carcinoma. Clin. Exp. Med. 2021, 21, 109–120. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Zhao, L.; Ren, R.; Ji, F.; Xue, S.; Zhang, J.; Liu, Z.; Ma, Z.; Wang, X.W.; Wong, L.; et al. MiR-125b loss activated HIF1alpha/pAKT loop, leading to transarterial chemoembolization resistance in hepatocellular carcinoma. Hepatology 2021, 73, 1381–1398. [Google Scholar] [CrossRef] [PubMed]
- Tsuchida, T.; Lee, Y.A.; Fujiwara, N.; Ybanez, M.; Allen, B.; Martins, S.; Fiel, M.I.; Goossens, N.; Chou, H.I.; Hoshida, Y.; et al. A simple diet- and chemical-induced murine NASH model with rapid progression of steatohepatitis, fibrosis and liver cancer. J. Hepatol. 2018, 69, 385–395. [Google Scholar] [CrossRef]
- Yang, Y.L.; Chang, Y.H.; Li, C.J.; Huang, Y.H.; Tsai, M.C.; Chu, P.Y.; Lin, H.Y. New insights into the role of miR-29a in hepatocellular carcinoma: Implications in mechanisms and theragnostics. J. Pers. Med. 2021, 11, 219. [Google Scholar] [CrossRef]
- Ringelhan, M.; McKeating, J.A.; Protzer, U. Viral hepatitis and liver cancer. Philos. Trans. R. Soc. B Biol. Sci. 2017, 372, 20160274. [Google Scholar] [CrossRef] [Green Version]
- Kanda, T.; Goto, T.; Hirotsu, Y.; Moriyama, M.; Omata, M. Molecular mechanisms driving progression of liver cirrhosis towards hepatocellular carcinoma in chronic hepatitis b and c infections: A review. Int. J. Mol. Sci. 2019, 20, 1358. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; He, Y.; Luo, N.; Patel, S.J.; Han, Y.; Gao, R.; Modak, M.; Carotta, S.; Haslinger, C.; Kind, D.; et al. Landscape and dynamics of single immune cells in hepatocellular carcinoma. Cell 2019, 179, 829–845.e20. [Google Scholar] [CrossRef]
- Leone, V.; Ali, A.; Weber, A.; Tschaharganeh, D.F.; Heikenwalder, M. Liver inflammation and hepatobiliary cancers. Trends Cancer 2021, 7, 606–623. [Google Scholar] [CrossRef]
- Ziogas, I.A.; Sioutas, G.; Mylonas, K.S.; Tsoulfas, G. Role of microRNA in the diagnosis and management of hepatocellular carcinoma. Microrna 2020, 9, 25–40. [Google Scholar] [CrossRef] [PubMed]
- Parizadeh, S.M.; Jafarzadeh-Esfehani, R.; Ghandehari, M.; Goldani, F.; Parizadeh, S.M.R.; Hassanian, S.M.; Ghayour-Mobarhan, M.; Ferns, G.A.; Avan, A. MicroRNAs as potential diagnostic and prognostic biomarkers in hepatocellular carcinoma. Curr. Drug Targets 2019, 20, 1129–1140. [Google Scholar] [CrossRef] [PubMed]
- Jampoka, K.; Muangpaisarn, P.; Khongnomnan, K.; Treeprasertsuk, S.; Tangkijvanich, P.; Payungporn, S. Serum miR-29a and miR-122 as potential biomarkers for non-alcoholic fatty liver disease (NAFLD). Microrna 2018, 7, 215–222. [Google Scholar] [CrossRef] [PubMed]
- Ko, J.Y.; Lian, W.S.; Tsai, T.C.; Chen, Y.S.; Hsieh, C.K.; Kuo, C.W.; Wang, F.S. MicroRNA-29a mitigates subacromial bursa fibrosis in rotator cuff lesion with shoulder stiffness. Int. J. Mol. Sci. 2019, 20, 5742. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.L.; Wang, P.W.; Wang, F.S.; Lin, H.Y.; Huang, Y.H. miR-29a modulates GSK3β/SIRT1-linked mitochondrial proteostatic stress to ameliorate mouse non-alcoholic steatohepatitis. Int. J. Mol. Sci. 2020, 21, 6884. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.L.; Wang, F.S.; Lin, H.Y.; Huang, Y.H. Exogenous therapeutics of microrna-29a attenuates development of hepatic fibrosis in cholestatic animal model through regulation of phosphoinositide 3-kinase p85 alpha. Int. J. Mol. Sci. 2020, 21, 3636. [Google Scholar] [CrossRef]
- Song, S.; Sun, K.; Dong, J.; Zhao, Y.; Liu, F.; Liu, H.; Sha, Z.; Mao, J.; Ding, G.; Guo, W.; et al. microRNA-29a regulates liver tumor-initiating cells expansion via Bcl-2 pathway. Exp. Cell Res. 2020, 387, 111781. [Google Scholar] [CrossRef]
- Dai, X.; Pi, G.; Yang, S.L.; Chen, G.G.; Liu, L.P.; Dong, H.H. Association of PD-L1 and HIF-1α coexpression with poor prognosis in hepatocellular carcinoma. Transl. Oncol. 2018, 11, 559–566. [Google Scholar] [CrossRef]
- Zhang, J.G.; Zhou, H.M.; Zhang, X.; Mu, W.; Hu, J.N.; Liu, G.L.; Li, Q. Hypoxic induction of vasculogenic mimicry in hepatocellular carcinoma: Role of HIF-1 α, RhoA/ROCK and Rac1/PAK signaling. BMC Cancer 2020, 20, 32. [Google Scholar] [CrossRef]
- Kung-Chun Chiu, D.; Pui-Wah Tse, A.; Law, C.T.; Ming-Jing Xu, I.; Lee, D.; Chen, M.; Kit-Ho Lai, R.; Wai-Hin Yuen, V.; Wing-Sum Cheu, J.; Wai-Hung Ho, D.; et al. Hypoxia regulates the mitochondrial activity of hepatocellular carcinoma cells through HIF/HEY1/PINK1 pathway. Cell Death Dis. 2019, 10, 934. [Google Scholar] [CrossRef]
- Faillaci, F.; Marzi, L.; Critelli, R.; Milosa, F.; Schepis, F.; Turola, E.; Andreani, S.; Vandelli, G.; Bernabucci, V.; Lei, B.; et al. Liver angiopoietin-2 is a key predictor of de novo or recurrent hepatocellular cancer after hepatitis C virus direct-acting antivirals. Hepatology 2018, 68, 1010–1024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, J.Y.; Wei, J.X.; Lv, L.H.; Han, Q.F.; Yang, W.B.; Li, G.L.; Wang, P.X.; Wu, S.B.; Duan, J.X.; Zhuo, W.F.; et al. Angiopoietin-2 induces angiogenesis via exosomes in human hepatocellular carcinoma. Cell Commun. Signal. CCS 2020, 18, 46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atanasov, G.; Dino, K.; Schierle, K.; Dietel, C.; Aust, G.; Pratschke, J.; Seehofer, D.; Schmelzle, M.; Hau, H.M. Angiogenic inflammation and formation of necrosis in the tumor microenvironment influence patient survival after radical surgery for de novo hepatocellular carcinoma in non-cirrhosis. World J. Surg. Oncol. 2019, 17, 217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asati, V.; Mahapatra, D.K.; Bharti, S.K. PI3K/Akt/mTOR and Ras/Raf/MEK/ERK signaling pathways inhibitors as anticancer agents: Structural and pharmacological perspectives. Eur. J. Med. Chem. 2016, 109, 314–341. [Google Scholar] [CrossRef]
- Gnoni, A.; Licchetta, A.; Memeo, R.; Argentiero, A.; Solimando, A.G.; Longo, V.; Delcuratolo, S.; Brunetti, O. Role of BRAF in hepatocellular carcinoma: A rationale for future targeted cancer therapies. Medicina 2019, 55, 754. [Google Scholar] [CrossRef] [Green Version]
- Cui, S.X.; Shi, W.N.; Song, Z.Y.; Wang, S.Q.; Yu, X.F.; Gao, Z.H.; Qu, X.J. Des-gamma-carboxy prothrombin antagonizes the effects of Sorafenib on human hepatocellular carcinoma through activation of the Raf/MEK/ERK and PI3K/Akt/mTOR signaling pathways. Oncotarget 2016, 7, 36767–36782. [Google Scholar] [CrossRef] [Green Version]
- Zhao, B.; Zhou, B.; Shi, K.; Zhang, R.; Dong, C.; Xie, D.; Tang, L.; Tian, Y.; Qian, Z.; Yang, L. Sustained and targeted delivery of siRNA/DP7-C nanoparticles from injectable thermosensitive hydrogel for hepatocellular carcinoma therapy. Cancer Sci. 2021, 112, 2481–2492. [Google Scholar] [CrossRef]
- Akula, S.M.; Abrams, S.L.; Steelman, L.S.; Emma, M.R.; Augello, G.; Cusimano, A.; Azzolina, A.; Montalto, G.; Cervello, M.; McCubrey, J.A. RAS/RAF/MEK/ERK, PI3K/PTEN/AKT/mTORC1 and TP53 pathways and regulatory miRs as therapeutic targets in hepatocellular carcinoma. Expert Opin. Ther. Targets 2019, 23, 915–929. [Google Scholar] [CrossRef]
- Cai, L.Y.; Chen, S.J.; Xiao, S.H.; Sun, Q.J.; Ding, C.H.; Zheng, B.N.; Zhu, X.Y.; Liu, S.Q.; Yang, F.; Yang, Y.X.; et al. Targeting p300/CBP attenuates hepatocellular carcinoma progression through epigenetic regulation of metabolism. Cancer Res. 2021, 81, 860–872. [Google Scholar] [CrossRef]
- Kojiro, M.; Sugihara, S.; Kakizoe, S.; Nakashima, O.; Kiyomatsu, K. Hepatocellular carcinoma with sarcomatous change: A special reference to the relationship with anticancer therapy. Cancer Chemother Pharm. 1989, 23, S4–S8. [Google Scholar] [CrossRef]
- Zen, C.; Zen, Y.; Mitry, R.R.; Corbeil, D.; Karbanová, J.; O’Grady, J.; Karani, J.; Kane, P.; Heaton, N.; Portmann, B.C.; et al. Mixed phenotype hepatocellular carcinoma after transarterial chemoembolization and liver transplantation. Liver Transpl. 2011, 17, 943–954. [Google Scholar] [CrossRef] [PubMed]
- Sergio, A.; Cristofori, C.; Cardin, R.; Pivetta, G.; Ragazzi, R.; Baldan, A.; Girardi, L.; Cillo, U.; Burra, P.; Giacomin, A.; et al. Transcatheter arterial chemoembolization (TACE) in hepatocellular carcinoma (HCC): The role of angiogenesis and invasiveness. Am. J. Gastroenterol. 2008, 103, 914–921. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Xu, H.; Gao, Z.Q.; Ning, H.F.; Sun, Y.Q.; Cao, G.W. Increased expression of vascular endothelial growth factor in hepatocellular carcinoma after transcatheter arterial chemoembolization. Acta Radiol. 2008, 49, 523–529. [Google Scholar] [CrossRef]
- Coxon, A.; Bready, J.; Min, H.; Kaufman, S.; Leal, J.; Yu, D.; Lee, T.A.; Sun, J.R.; Estrada, J.; Bolon, B.; et al. Context-dependent role of angiopoietin-1 inhibition in the suppression of angiogenesis and tumor growth: Implications for AMG 386, an angiopoietin-1/2-neutralizing peptibody. Mol. Cancer Ther. 2010, 9, 2641–2651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herbst, R.S.; Hong, D.; Chap, L.; Kurzrock, R.; Jackson, E.; Silverman, J.M.; Rasmussen, E.; Sun, Y.N.; Zhong, D.; Hwang, Y.C.; et al. Safety, pharmacokinetics, and antitumor activity of AMG 386, a selective angiopoietin inhibitor, in adult patients with advanced solid tumors. J. Clin. Oncol. 2009, 27, 3557–3565. [Google Scholar] [CrossRef]
- Umezaki, N.; Nakagawa, S.; Yamashita, Y.I.; Kitano, Y.; Arima, K.; Miyata, T.; Hiyoshi, Y.; Okabe, H.; Nitta, H.; Hayashi, H.; et al. Lysyl oxidase induces epithelial-mesenchymal transition and predicts intrahepatic metastasis of hepatocellular carcinoma. Cancer Sci. 2019, 110, 2033–2043. [Google Scholar] [CrossRef]
- Wang, M.; Zhao, X.; Zhu, D.; Liu, T.; Liang, X.; Liu, F.; Zhang, Y.; Dong, X.; Sun, B. HIF-1α promoted vasculogenic mimicry formation in hepatocellular carcinoma through LOXL2 up-regulation in hypoxic tumor microenvironment. J. Exp. Clin. Cancer Res. 2017, 36, 60. [Google Scholar] [CrossRef] [Green Version]
- Wong, C.C.; Gilkes, D.M.; Zhang, H.; Chen, J.; Wei, H.; Chaturvedi, P.; Fraley, S.I.; Wong, C.M.; Khoo, U.S.; Ng, I.O.; et al. Hypoxia-inducible factor 1 is a master regulator of breast cancer metastatic niche formation. Proc. Natl. Acad. Sci. USA 2011, 108, 16369–16374. [Google Scholar] [CrossRef] [Green Version]
- Ye, M.; Song, Y.; Pan, S.; Chu, M.; Wang, Z.W.; Zhu, X. Evolving roles of lysyl oxidase family in tumorigenesis and cancer therapy. Pharmacol. Ther. 2020, 215, 107633. [Google Scholar] [CrossRef]
- Zhao, W.; Yang, A.; Chen, W.; Wang, P.; Liu, T.; Cong, M.; Xu, A.; Yan, X.; Jia, J.; You, H. Inhibition of lysyl oxidase-like 1 (LOXL1) expression arrests liver fibrosis progression in cirrhosis by reducing elastin crosslinking. Biochim. Biophys Acta Mol. Basis Dis. 2018, 1864, 1129–1137. [Google Scholar] [CrossRef]
- Wang, T.H.; Hsia, S.M.; Shieh, T.M. Lysyl oxidase and the tumor microenvironment. Int. J. Mol. Sci. 2016, 18, 62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Z.; Zheng, W.; Li, H.; Wu, W.; Liu, X.; Sun, Z.; Hu, H.; Du, L.; Jia, Q.; Liu, Q. LOXL2 upregulates hypoxia-inducible factor-1α signaling through Snail-FBP1 axis in hepatocellular carcinoma cells. Oncol. Rep. 2020, 43, 1641–1649. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Wang, Y.; Zhang, X.; Feng, M.; Ma, J.; Li, J.; Yang, X.; Fang, F.; Xia, Q.; Zhang, Z.; et al. Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis. Mol. Cancer 2019, 18, 18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, M.; Liu, J.; Wang, F.; Tian, Z.; Ma, B.; Li, Z.; Wang, B.; Zhao, W. Lysyl oxidase assists tumor-initiating cells to enhance angiogenesis in hepatocellular carcinoma. Int. J. Oncol. 2019, 54, 1398–1408. [Google Scholar] [CrossRef] [PubMed]
- Yuen, V.W.; Wong, C.C. Hypoxia-inducible factors and innate immunity in liver cancer. J. Clin. Investig. 2020, 130, 5052–5062. [Google Scholar] [CrossRef]
- Pinyol, R.; Torrecilla, S.; Wang, H.; Montironi, C.; Pique-Gili, M.; Torres-Martin, M.; Wei-Qiang, L.; Willoughby, C.E.; Ramadori, P.; Andreu-Oller, C.; et al. Molecular characterisation of hepatocellular carcinoma in patients with non-alcoholic steatohepatitis. J. Hepatol. 2021, 75, 865–878. [Google Scholar] [CrossRef]
- Ko, J.Y.; Lee, M.S.; Lian, W.S.; Weng, W.T.; Sun, Y.C.; Chen, Y.S.; Wang, F.S. MicroRNA-29a counteracts synovitis in knee osteoarthritis pathogenesis by targeting VEGF. Sci. Rep. 2017, 7, 3584. [Google Scholar] [CrossRef]
Gene Name | Forward Primers (5′➞3′) | Reverse Primers (5′➞3′) |
---|---|---|
Col3a1 | ACGTAAGCACTGGTGGACAG | CAGGAGGGCCATAGCTGAAC |
Hif1a | CGGAAACTCCAAAGCCACTT | GCTGGCTGATCTTGAATCTG G |
Angpt2 | CCGCGGGCAAAATAAGTAGC | CACATGCGTCAAACCACCAG |
Lox | GACCACAGGGTACTGCTACG | TGGCTGAATTCGTCCATGCT |
Loxl2 | CTGACTTCCGCCCCAAGAAT | GTTGAGGCTCAGCAGGTCAT |
Vegfa | CCCACGTCAGAGAGCAACAT | TGCGCTTTCGTTTTTGACCC |
Gapdh | GCACAGTCAAGGCCGAGAAT | GCCTTCTCCATGGTGGTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, Y.-H.; Lian, W.-S.; Wang, F.-S.; Wang, P.-W.; Lin, H.-Y.; Tsai, M.-C.; Yang, Y.-L. MiR-29a Curbs Hepatocellular Carcinoma Incidence via Targeting of HIF-1α and ANGPT2. Int. J. Mol. Sci. 2022, 23, 1636. https://doi.org/10.3390/ijms23031636
Huang Y-H, Lian W-S, Wang F-S, Wang P-W, Lin H-Y, Tsai M-C, Yang Y-L. MiR-29a Curbs Hepatocellular Carcinoma Incidence via Targeting of HIF-1α and ANGPT2. International Journal of Molecular Sciences. 2022; 23(3):1636. https://doi.org/10.3390/ijms23031636
Chicago/Turabian StyleHuang, Ying-Hsien, Wei-Shiung Lian, Feng-Sheng Wang, Pei-Wen Wang, Hung-Yu Lin, Ming-Chao Tsai, and Ya-Ling Yang. 2022. "MiR-29a Curbs Hepatocellular Carcinoma Incidence via Targeting of HIF-1α and ANGPT2" International Journal of Molecular Sciences 23, no. 3: 1636. https://doi.org/10.3390/ijms23031636