A High Body Mass Index and the Vacuum Phenomenon Upregulate Pain-Related Molecules in Human Degenerated Intervertebral Discs
Abstract
:1. Introduction
2. Results
2.1. The Relationships among Radiographical Findings, Clinical Findings, and the Expression of Pain-Related Molecules
2.2. The Comparison of Clinical Findings and the Expression of Pain-Related Molecules between the Two Groups
2.3. Correlations among the Expressions of Various Pain-Related Molecules
3. Discussion
4. Materials and Methods
4.1. Subjects
4.2. RT-PCR
4.3. Clinical Findings
4.4. Radiographical Findings
4.5. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hoy, D.; Bain, C.; Williams, G.; March, L.; Brooks, P.; Blyth, F.; Woolf, A.; Vos, T.; Buchbinder, R. A systematic review of the global prevalence of low back pain. Arthritis Rheum. 2012, 64, 2028–2037. [Google Scholar] [CrossRef] [PubMed]
- Dagenais, S.; Caro, J.; Haldeman, S. A systematic review of low back pain cost of illness studies in the United States and internationally. Spine J. 2008, 8, 8–20. [Google Scholar] [CrossRef]
- Takura, T.; Ushida, T.; Kanchiku, T.; Ebata, N.; Fujii, K.; DiBonaventura, M.; Taguchi, T. The societal burden of chronic pain in Japan: An internet survey. J. Orthop. Sci. 2015, 20, 750–760. [Google Scholar] [CrossRef]
- Suzuki, H.; Kanchiku, T.; Imajo, Y.; Yoshida, Y.; Nishida, N.; Taguchi, T. Diagnosis and Characters of Non-Specific Low Back Pain in Japan: The Yamaguchi Low Back Pain Study. PLoS ONE 2016, 11, e0160454. [Google Scholar] [CrossRef]
- Burke, J.G.; Watson, R.W.; McCormack, D.; Dowling, F.E.; Walsh, M.G.; Fitzpatrick, J.M. Intervertebral discs which cause low back pain secrete high levels of proinflammatory mediators. J. Bone Jt. Surg. Br. 2002, 84, 196–201. [Google Scholar] [CrossRef]
- Kang, J.D.; Georgescu, H.I.; McIntyre-Larkin, L.; Stefanovic-Racic, M.; Donaldson, W.F., 3rd; Evans, C.H. Herniated lumbar intervertebral discs spontaneously produce matrix metalloproteinases, nitric oxide, interleukin-6, and prostaglandin E2. Spine 1996, 21, 271–277. [Google Scholar] [CrossRef]
- Miyagi, M.; Ishikawa, T.; Orita, S.; Eguchi, Y.; Kamoda, H.; Arai, G.; Suzuki, M.; Inoue, G.; Aoki, Y.; Toyone, T.; et al. Disk injury in rats produces persistent increases in pain-related neuropeptides in dorsal root ganglia and spinal cord glia but only transient increases in inflammatory mediators: Pathomechanism of chronic diskogenic low back pain. Spine 2011, 36, 2260–2266. [Google Scholar] [CrossRef] [PubMed]
- Ashina, H.; Newman, L.; Ashina, S. Calcitonin gene-related peptide antagonism and cluster headache: An emerging new treatment. Neurol. Sci. 2017, 38, 2089–2093. [Google Scholar] [CrossRef]
- Patel, M.K.; Kaye, A.D.; Urman, R.D. Tanezumab: Therapy targeting nerve growth factor in pain pathogenesis. J. Anaesthesiol. Clin. Pharmacol. 2018, 34, 111–116. [Google Scholar] [CrossRef] [PubMed]
- Miyagi, M.; Uchida, K.; Takano, S.; Nakawaki, M.; Sekiguchi, H.; Nakazawa, T.; Imura, T.; Saito, W.; Shirasawa, E.; Kawakubo, A.; et al. Role of CD14-positive cells in inflammatory cytokine and pain-related molecule expression in human degenerated intervertebral discs. J. Orthop. Res. 2021, 39, 1755–1762. [Google Scholar] [CrossRef] [PubMed]
- Panjabi, M.M. Clinical spinal instability and low back pain. J. Electromyogr. Kinesiol. 2003, 13, 371–379. [Google Scholar] [CrossRef]
- Martin, C.R.; Gruszczynski, A.T.; Braunsfurth, H.A.; Fallatah, S.M.; O’Neil, J.; Wai, E.K. The surgical management of degenerative lumbar spondylolisthesis: A systematic review. Spine 2007, 32, 1791–1798. [Google Scholar] [CrossRef]
- Miyagi, M.; Ishikawa, T.; Kamoda, H.; Suzuki, M.; Murakami, K.; Shibayama, M.; Orita, S.; Eguchi, Y.; Arai, G.; Sakuma, Y.; et al. ISSLS prize winner: Disc dynamic compression in rats produces long-lasting increases in inflammatory mediators in discs and induces long-lasting nerve injury and regeneration of the afferent fibers innervating discs: A pathomechanism for chronic discogenic low back pain. Spine 2012, 37, 1810–1818. [Google Scholar] [CrossRef]
- Webb, R.; Brammah, T.; Lunt, M.; Urwin, M.; Allison, T.; Symmons, D. Prevalence and predictors of intense, chronic, and disabling neck and back pain in the UK general population. Spine 2003, 28, 1195–1202. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, T.; Katsuhira, J.; Oka, H.; Fujii, T.; Matsudaira, K. Association of low back load with low back pain during static standing. PLoS ONE 2018, 13, e0208877. [Google Scholar] [CrossRef] [PubMed]
- Nachemson, A. Towards a better understanding of low-back pain: A review of the mechanics of the lumbar disc. Rheumatol. Rehabil. 1975, 14, 129–143. [Google Scholar] [CrossRef] [PubMed]
- Jakobsson, P.J.; Thorén, S.; Morgenstern, R.; Samuelsson, B. Identification of human prostaglandin E synthase: A microsomal, glutathione-dependent, inducible enzyme, constituting a potential novel drug target. Proc. Natl. Acad. Sci. USA 1999, 96, 7220–7225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trebino, C.E.; Stock, J.L.; Gibbons, C.P.; Naiman, B.M.; Wachtmann, T.S.; Umland, J.P.; Pandher, K.; Lapointe, J.M.; Saha, S.; Roach, M.L.; et al. Impaired inflammatory and pain responses in mice lacking an inducible prostaglandin E synthase. Proc. Natl. Acad. Sci. USA 2003, 100, 9044–9049. [Google Scholar] [CrossRef] [Green Version]
- Saxler, G.; Löer, F.; Skumavc, M.; Pförtner, J.; Hanesch, U. Localization of SP- and CGRP-immunopositive nerve fibers in the hip joint of patients with painful osteoarthritis and of patients with painless failed total hip arthroplasties. Eur. J. Pain 2007, 11, 67–74. [Google Scholar] [CrossRef]
- Aikawa, J.; Uchida, K.; Takano, S.; Inoue, G.; Iwase, D.; Miyagi, M.; Mukai, M.; Shoji, S.; Sekiguchi, H.; Takaso, M. Regulation of calcitonin gene-related peptide expression through the COX-2/mPGES-1/PGE2 pathway in the infrapatellar fat pad in knee osteoarthritis. Lipids Health Dis. 2018, 17, 215. [Google Scholar] [CrossRef] [Green Version]
- Minatani, A.; Uchida, K.; Inoue, G.; Takano, S.; Aikawa, J.; Miyagi, M.; Fujimaki, H.; Iwase, D.; Onuma, K.; Matsumoto, T.; et al. Activation of calcitonin gene-related peptide signaling through the prostaglandin E2-EP1/EP2/EP4 receptor pathway in synovium of knee osteoarthritis patients. J. Orthop. Surg. Res. 2016, 11, 117. [Google Scholar] [CrossRef] [Green Version]
- Baena-Beato, P.; Artero, E.G.; Arroyo-Morales, M.; Robles-Fuentes, A.; Gatto-Cardia, M.C.; Delgado-Fernández, M. Aquatic therapy improves pain, disability, quality of life, body composition and fitness in sedentary adults with chronic low back pain. A controlled clinical trial. Clin. Rehabil. 2014, 28, 350–360. [Google Scholar] [CrossRef]
- Wasser, J.G.; Vasilopoulos, T.; Zdziarski, L.A.; Vincent, H.K. Exercise Benefits for Chronic Low Back Pain in Overweight and Obese Individuals. Phys. Med. Rehabil. 2017, 9, 181–192. [Google Scholar] [CrossRef]
- Torlak, M.S.; Bagcaci, S.; Akpinar, E.; Okutan, O.; Nazli, M.S.; Kuccukturk, S. The effect of intermittent diet and/or physical therapy in patients with chronic low back pain: A single-blinded randomized controlled trial. Explore 2022, 18, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Lewandrowski, K.U.; Zhang, X.; Ramírez León, J.F.; de Carvalho, P.S.T.; Hellinger, S.; Yeung, A. Lumbar vacuum disc, vertical instability, standalone endoscopic interbody fusion, and other treatments: An opinion based survey among minimally invasive spinal surgeons. J. Spine Surg. 2020, 6, S165–S178. [Google Scholar] [CrossRef]
- Liao, J.C.; Lu, M.L.; Niu, C.C.; Chen, W.J.; Chen, L.H. Surgical outcomes of degenerative lumbar spondylolisthesis with anterior vacuum disc: Can the intervertebral cage overcome intradiscal vacuum phenomenon and enhance posterolateral fusion? J. Orthop. Sci. 2014, 19, 851–859. [Google Scholar] [CrossRef]
- Morishita, K.; Kasai, Y.; Uchida, A. Clinical symptoms of patients with intervertebral vacuum phenomenon. Neurologist 2008, 14, 37–39. [Google Scholar] [CrossRef]
- Leone, A.; Guglielmi, G.; Cassar-Pullicino, V.N.; Bonomo, L. Lumbar intervertebral instability: A review. Radiology 2007, 245, 62–77. [Google Scholar] [CrossRef]
- Kanemura, A.; Doita, M.; Kasahara, K.; Sumi, M.; Kurosaka, M.; Iguchi, T. The influence of sagittal instability factors on clinical lumbar spinal symptoms. J. Spinal Disord. Tech. 2009, 22, 479–485. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Wang, J.; Liu, X.; Tao, H.; Jin, W.; Shen, K. Degeneration of injured intervertebral discs affected by anterior longitudinal ligament injury in rabbits. Int. J. Clin. Exp. Pathol. 2018, 11, 595–603. [Google Scholar] [PubMed]
- Petersen, T.; Laslett, M.; Juhl, C. Clinical classification in low back pain: Best-evidence diagnostic rules based on systematic reviews. BMC Musculoskelet. Disord. 2017, 18, 188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, D.; Liu, P.; Cheng, J.; Ma, Z.; Liu, J.; Qin, T. Correlation between intervertebral disc degeneration, paraspinal muscle atrophy, and lumbar facet joints degeneration in patients with lumbar disc herniation. BMC Musculoskelet. Disord. 2017, 18, 167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujiwara, A.; Lim, T.H.; An, H.S.; Tanaka, N.; Jeon, C.H.; Andersson, G.B.; Haughton, V.M. The effect of disc degeneration and facet joint osteoarthritis on the segmental flexibility of the lumbar spine. Spine 2000, 25, 3036–3044. [Google Scholar] [CrossRef] [PubMed]
- Konno, S.I.; Sekiguchi, M. Association between brain and low back pain. J. Orthop. Sci. 2018, 23, 3–7. [Google Scholar] [CrossRef] [PubMed]
- Ohtori, S.; Inoue, G.; Miyagi, M.; Takahashi, K. Pathomechanisms of discogenic low back pain in humans and animal models. Spine J. 2015, 15, 1347–1355. [Google Scholar] [CrossRef] [PubMed]
- Freemont, A.J.; Peacock, T.E.; Goupille, P.; Hoyland, J.A.; O’Brien, J.; Jayson, M.I. Nerve ingrowth into diseased intervertebral disc in chronic back pain. Lancet 1997, 350, 178–181. [Google Scholar] [CrossRef]
- Miyagi, M.; Uchida, K.; Takano, S.; Fujimaki, H.; Aikawa, J.; Sekiguchi, H.; Nagura, N.; Ohtori, S.; Inoue, G.; Takaso, M. Macrophage-derived inflammatory cytokines regulate growth factors and pain-related molecules in mice with intervertebral disc injury. J. Orthop. Res. 2018, 36, 2274–2279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melrose, J.; Roberts, S.; Smith, S.; Menage, J.; Ghosh, P. Increased nerve and blood vessel ingrowth associated with proteoglycan depletion in an ovine anular lesion model of experimental disc degeneration. Spine 2002, 27, 1278–1285. [Google Scholar] [CrossRef] [PubMed]
- Risbud, M.V.; Shapiro, I.M. Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat. Rev. Rheumatol. 2014, 10, 44–56. [Google Scholar] [CrossRef]
- Singh, K.; Masuda, K.; Thonar, E.J.; An, H.S.; Cs-Szabo, G. Age-related changes in the extracellular matrix of nucleus pulposus and anulus fibrosus of human intervertebral disc. Spine 2009, 34, 10–16. [Google Scholar] [CrossRef] [Green Version]
- Taylor, T.K.; Melrose, J.; Burkhardt, D.; Ghosh, P.; Claes, L.E.; Kettler, A.; Wilke, H.J. Spinal biomechanics and aging are major determinants of the proteoglycan metabolism of intervertebral disc cells. Spine 2000, 25, 3014–3020. [Google Scholar] [CrossRef] [PubMed]
- Melrose, J.; Shu, C.; Young, C.; Ho, R.; Smith, M.M.; Young, A.A.; Smith, S.S.; Gooden, B.; Dart, A.; Podadera, J.; et al. Mechanical destabilization induced by controlled annular incision of the intervertebral disc dysregulates metalloproteinase expression and induces disc degeneration. Spine 2012, 37, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Guilak, F.; Hayes, A.J.; Melrose, J. Perlecan in Pericellular Mechanosensory Cell-Matrix Communication, Extracellular Matrix Stabilisation and Mechanoregulation of Load-Bearing Connective Tissues. Int. J. Mol. Sci. 2021, 22, 2716. [Google Scholar] [CrossRef] [PubMed]
- Shalom-Barak, T.; Quach, J.; Lotz, M. Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF-kappaB. J. Biol. Chem. 1998, 273, 27467–27473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakai, D.; Grad, S. Advancing the cellular and molecular therapy for intervertebral disc disease. Adv. Drug Deliv. Rev. 2015, 84, 159–171. [Google Scholar] [CrossRef] [PubMed]
- Abe, Y.; Akeda, K.; An, H.S.; Aoki, Y.; Pichika, R.; Muehleman, C.; Kimura, T.; Masuda, K. Proinflammatory cytokines stimulate the expression of nerve growth factor by human intervertebral disc cells. Spine 2007, 32, 635–642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tan, H.; Pan, P.; Zhang, L.; Cao, Z.; Liu, B.; Li, H.; Su, X. Nerve growth factor promotes expression of costimulatory molecules and release of cytokines in dendritic cells involved in Th2 response through LPS-induced p75NTR. J. Asthma 2016, 53, 989–998. [Google Scholar] [CrossRef] [PubMed]
- Hiyama, A.; Suyama, K.; Sakai, D.; Tanaka, M.; Watanabe, M. Correlational analysis of chemokine and inflammatory cytokine expression in the intervertebral disc and blood in patients with lumbar disc disease. J. Orthop. Res. 2021. [Google Scholar] [CrossRef] [PubMed]
- Fukushima, K.; Inoue, G.; Fujimaki, H.; Uchida, K.; Miyagi, M.; Nagura, N.; Uchiyama, K.; Takahira, N.; Takaso, M. The cytokine expression in synovial membrane and the relationship with pain and pathological findings at hip arthroscopy. J. Exp. Orthop. 2017, 4, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takano, S.; Uchida, K.; Inoue, G.; Minatani, A.; Miyagi, M.; Aikawa, J.; Iwase, D.; Onuma, K.; Mukai, M.; Takaso, M. Increase and regulation of synovial calcitonin gene-related peptide expression in patients with painful knee osteoarthritis. J. Pain Res. 2017, 10, 1099–1104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takano, S.; Uchida, K.; Inoue, G.; Miyagi, M.; Aikawa, J.; Iwase, D.; Iwabuchi, K.; Matsumoto, T.; Satoh, M.; Mukai, M.; et al. Nerve growth factor regulation and production by macrophages in osteoarthritic synovium. Clin. Exp. Immunol. 2017, 190, 235–243. [Google Scholar] [CrossRef] [Green Version]
- Kinoshita, T.; Ohki, I.; Roth, K.R.; Amano, K.; Moriya, H. Results of degenerative spondylolisthesis treated with posterior decompression alone via a new surgical approach. J. Neurosurg. 2001, 95, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Minamide, A.; Simpson, A.K.; Okada, M.; Enyo, Y.; Nakagawa, Y.; Iwasaki, H.; Tsutsui, S.; Takami, M.; Nagata, K.; Hashizume, H.; et al. Microendoscopic Decompression for Lumbar Spinal Stenosis With Degenerative Spondylolisthesis: The Influence of Spondylolisthesis Stage (Disc Height and Static and Dynamic Translation) on Clinical Outcomes. Clin. Spine Surg. 2019, 32, E20–E26. [Google Scholar] [CrossRef]
- Iguchi, T.; Kanemura, A.; Kasahara, K.; Sato, K.; Kurihara, A.; Yoshiya, S.; Nishida, K.; Miyamoto, H.; Doita, M. Lumbar instability and clinical symptoms: Which is the more critical factor for symptoms: Sagittal translation or segment angulation? J. Spinal Disord. Tech. 2004, 17, 284–290. [Google Scholar] [CrossRef]
LBPVAS | L/EPVAS | L/ENVAS | ODI | TNFA | IL6 | CGRP | NGF | mPGES1 | ||
---|---|---|---|---|---|---|---|---|---|---|
BMI | r | −0.081 | 0.253 | 0.102 | −0.390 | 0.328 | −0.104 | 0.383 | 0.28 | 0.383 |
p | 0.66 | 0.163 | 0.578 | 0.025 | 0.063 | 0.607 | 0.028 | 0.115 | 0.028 | |
%slip | r | 0.064 | 0.412 | 0.452 | −0.261 | −0.092 | −0.283 | −0.204 | −0.112 | −0.159 |
p | 0.726 | 0.019 | 0.009 | 0.143 | 0.612 | 0.152 | 0.254 | 0.536 | 0.376 | |
Translation | r | 0.109 | 0.243 | 0.078 | −0.19 | −0.124 | −0.011 | −0.18 | −0.107 | −0.053 |
p | 0.552 | 0.181 | 0.672 | 0.29 | 0.492 | 0.955 | 0.317 | 0.552 | 0.768 | |
Slip angle | r | −0.108 | 0.086 | −0.144 | 0.012 | 0.221 | 0.247 | 0.029 | 0.187 | −0.038 |
p | 0.556 | 0.641 | 0.433 | 0.945 | 0.216 | 0.215 | 0.873 | 0.298 | 0.832 |
Instability (−) N = 16 | Instability (+) N = 19 | p Value | |||
---|---|---|---|---|---|
Mean | SD | Mean | SD | ||
LBPVAS | 5.400 | 3.522 | 6.970 | 2.265 | 0.675 |
L/EPVAS | 6.720 | 3.425 | 7.320 | 2.190 | 0.009 |
L/ENVAS | 5.470 | 3.079 | 6.330 | 3.061 | 0.017 |
ODI | 57.587 | 16.994 | 50.830 | 12.645 | 0.011 |
TNF | 0.00140 | 0.00263 | 0.00080 | 0.00116 | 0.910 |
IL6 | 0.00010 | 0.00010 | 0.00010 | 0.00008 | 0.089 |
CGRP | 0.00080 | 0.00067 | 0.00150 | 0.00278 | 0.251 |
NGF | 0.03700 | 0.09173 | 0.02440 | 0.05327 | 0.858 |
mPGES1 | 0.01030 | 0.00687 | 0.03160 | 0.04043 | 0.418 |
VP (−) N = 15 | VP (+) N = 20 | p Value | |||
---|---|---|---|---|---|
Mean | SD | Mean | SD | ||
LBPVAS | 5.4 | 3.522 | 6.97 | 2.265 | 0.171 |
L/EPVAS | 6.72 | 3.425 | 7.32 | 2.19 | 0.548 |
L/ENVAS | 5.47 | 3.079 | 6.33 | 3.061 | 0.444 |
ODI | 57.5873 | 16.99379 | 50.8304 | 12.64459 | 0.199 |
TNF | 0.0014 | 0.00263 | 0.0008 | 0.00116 | 0.387 |
IL6 | 0.0001 | 0.0001 | 0.0001 | 0.00008 | 0.486 |
CGRP | 0.0008 | 0.00067 | 0.0015 | 0.00278 | 0.357 |
NGF | 0.037 | 0.09173 | 0.0244 | 0.05327 | 0.623 |
mPGES1 | 0.0103 | 0.00687 | 0.0316 | 0.04043 | 0.036 |
IL6 | CGRP | NGF | mPGES1 | ||
---|---|---|---|---|---|
TNFA | r | 0.105 | 0.065 | 0.883 | 0.202 |
p | 0.602 | 0.718 | 0.000 | 0.260 | |
IL6 | r | 0.113 | 0.424 | −0.021 | |
p | 0.573 | 0.028 | 0.916 | ||
CGRP | r | 0.024 | 0.560 | ||
p | 0.894 | 0.001 | |||
NGF | r | 0.391 | |||
p | 0.024 |
Gene | Direction | Primer Sequence (5′–3′) | Product Size (bp) |
---|---|---|---|
TNFA | F | CTTCTGCCTGCTGCACTTTG | 118 |
R | GTCACTCGGGGTTCGAGAAG | ||
IL6 | F | GAGGAGACTTGCCTGGTGAAA | 199 |
R | TGGCATTTGTGGTTGGGTCA | ||
CGRP | F | TCCAAAACCCAGAAGACGCA | 91 |
R | TTGTTCTTCACCACACCCCCTG | ||
NGF | F | CCCATCCCATCTTCCACAGG | 74 |
R | GGTGGTCTTATCCCCAACCC | ||
mPGES1 | F | GGAGACCATCTACCCCTTCCT | 81 |
R | AAGTGCATCCAGGCGACAAA | ||
GAPDH | F | TGTTGCCATCAATGACCCCTT | 202 |
R | CTCCACGACGTACTCAGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miyagi, M.; Uchida, K.; Inoue, S.; Takano, S.; Nakawaki, M.; Kawakubo, A.; Sekiguchi, H.; Nakazawa, T.; Imura, T.; Saito, W.; et al. A High Body Mass Index and the Vacuum Phenomenon Upregulate Pain-Related Molecules in Human Degenerated Intervertebral Discs. Int. J. Mol. Sci. 2022, 23, 2973. https://doi.org/10.3390/ijms23062973
Miyagi M, Uchida K, Inoue S, Takano S, Nakawaki M, Kawakubo A, Sekiguchi H, Nakazawa T, Imura T, Saito W, et al. A High Body Mass Index and the Vacuum Phenomenon Upregulate Pain-Related Molecules in Human Degenerated Intervertebral Discs. International Journal of Molecular Sciences. 2022; 23(6):2973. https://doi.org/10.3390/ijms23062973
Chicago/Turabian StyleMiyagi, Masayuki, Kentaro Uchida, Sho Inoue, Shotaro Takano, Mitsufumi Nakawaki, Ayumu Kawakubo, Hiroyuki Sekiguchi, Toshiyuki Nakazawa, Takayuki Imura, Wataru Saito, and et al. 2022. "A High Body Mass Index and the Vacuum Phenomenon Upregulate Pain-Related Molecules in Human Degenerated Intervertebral Discs" International Journal of Molecular Sciences 23, no. 6: 2973. https://doi.org/10.3390/ijms23062973