Regulatory Mechanism of Transcription Factor AhHsf Modulates AhHsp70 Transcriptional Expression Enhancing Heat Tolerance in Agasicles hygrophila (Coleoptera: Chrysomelidae)
Abstract
:1. Introduction
2. Results
2.1. Analysis of the AhHsp70p Sequence in A. hygrophila
2.2. Analysis of AhHsp70 Promoter Reporter Plasmid Activity
2.3. Characterization of the Interaction between Transcription Factor AhHsf and AhHsp70p
2.4. Expression Levels of AhHsp70 Following In Vitro Transfection
2.5. Transcription Factor AhHsf Upregulates the Expression of AhHsp70 In Vitro
2.6. A Simple Model for Regulation of Transcriptional Gene Expression Following Heat Shock
3. Discussion
4. Materials and Methods
4.1. Experimental Insects and Host Plants
4.2. Expression Vector and Cell Lines
4.3. Sample Collection and In Vitro Experiments
4.4. DNA or RNA Extraction and Reverse PCR
4.5. Relative Quantitative Real-Time PCR
4.6. AhHsp70p Sequence Analysis
4.7. Synthesis of AhHsp70p Insertion Fragments
4.8. Construction of Luciferase Reporter Plasmids and AhHsp70p Luciferase Activity Assays
4.9. Assays for the Interaction between Transcription Factor AhHsf and AhHsp70p
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bale, J.S.; Masters, G.J.; Hodkinson, I.D.; Awmack, C.; Bezemer, T.M.; Brown, V.K.; Butterfield, J.; Buse, A.; Coulson, J.C.; Farrar, J.; et al. Herbivory in global climate change research: Direct effects of rising temperature on insect herbivores. Glob. Chang. Biol. 2002, 8, 1–16. [Google Scholar] [CrossRef]
- Yu, H.; Wan, F.H.; Guo, J.Y. cDNA Cloning of Heat Shock Protein Genes and Their Expression in an Indigenous Cryptic Species of the Whitefly Bemisia tabaci Complex from China. J. Integr. Agric. 2012, 11, 293–302. [Google Scholar] [CrossRef]
- Bowler, K.; Terblanche, J.S. Insect thermal tolerance: What is the role of ontogeny, ageing and senescence? Biol. Rev. Camb. Philos. Soc. 2008, 83, 339–355. [Google Scholar] [CrossRef] [PubMed]
- Chevin, L.M.; Lande, R.; Mace, G.M. Adaptation, plasticity, and extinction in a changing environment: Towards a predictive theory. PLoS Biol. 2010, 8, e1000357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, A.A.; Sgro, C.M. Climate change and evolutionary adaptation. Nature 2011, 470, 479–485. [Google Scholar] [CrossRef] [PubMed]
- Wu, C. Heat shock transcription factors: Structure and regulation. Annu. Rev. Cell Dev. Biol. 1995, 11, 441–469. [Google Scholar] [CrossRef] [PubMed]
- Tatar, M.; Khazaeli, A.A.; Curtsinger, J.W. Chaperoning extended life. Nature 1997, 390, 30. [Google Scholar] [CrossRef]
- Feder, M.E.; Hofmann, G.E. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 1999, 61, 243–282. [Google Scholar] [CrossRef] [Green Version]
- Kristensen, T.N.; Rensen, J.G.S.; Loeschcke, V. Mild heat stress at a young age in Drosophila melanogaster leads to increased Hsp70 synthesis after stress exposure later in Life. J. Genet. 2003, 82, 89–94. [Google Scholar] [CrossRef]
- Sørensen, J.G.; Kristensen, T.N.; Loeschcke, V. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 2003, 6, 1025–1037. [Google Scholar] [CrossRef]
- Beckmann, R.P.; Mizzen, L.A.; Welch, W.J. Interaction of Hsp70 with newly synthesized proteins: Implications for protein folding and assembly. Science 1990, 248, 850–854. [Google Scholar] [CrossRef] [PubMed]
- Cotto, J.J.; Morimoto, R.I. Stress-induced activation of the heat-shock response: Cell and molecular biology of heat-shock factors. Biochem. Soc. Symp. 1999, 64, 105–118. [Google Scholar] [PubMed]
- Kimura, R.; Choudary, P.; Schmid, C. Silk worm Bm1 SINE RNA increases following cellular insults. Nucleic Acids Res. 1999, 27, 3380–3387. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uhlirova, M.; Asahina, M.; Riddiford, L.M.; Jindra, M. Heat-inducible transgenic expression in the silkmoth Bombyx mori. Dev. Genes Evol. 2002, 212, 145–151. [Google Scholar]
- Lindquist, A.S.; Craig, E.A. The heat shock proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef]
- Yu, A.; Li, P.; Tang, T.; Wang, J.; Chen, Y.; Liu, L. Roles of Hsp70s in stress responses of microorganisms, plants, and animals. Biomed Res. Int. 2015, 2015, 510319. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, M.; Heimberger, T.; Gruensfelder, P.; Schler, G.; Hoppe, F. Inducible promoters for gene therapy of head and neck cancer: An in vitro study. Eur. Arch. Otorhinolaryngol. 2004, 261, 208–215. [Google Scholar] [CrossRef]
- Zhang, L.; Zhao, J.; Zhai, Z.; Liang, L.; Liang, R.; Cui, S. Cellular microRNA, miR-1343-5p, modulates IFN-I responses to facilitate feline panleukopenia virus replication by directly targeting IRAK1 gene. Vet. Microbiol. 2020, 245, 108691. [Google Scholar] [CrossRef]
- Tang, S.M.; Yi, Y.Z.; Zhou, Y.J.; Zhang, Z.F.; Li, Y.R.; He, J.L. The homologous region 3 from Bombyx mori nucleopolyhedrovirus enhancing the transcriptional activity of Drosophila hsp70 promoter. Int. J. Ind. Entomol. 2004, 9, 235–239. [Google Scholar]
- Vallabhapurapu, S.; Karin, M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu. Rev. Immunol. 2009, 27, 693–733. [Google Scholar] [CrossRef]
- Smale, S.T. Transcriptional regulation in the innate immune system. Curr. Opin. Immunol. 2012, 24, 51–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, C.; Zhang, X.; Li, F.; Huan, P.; Xiang, J. Functional analysis of the promoter of the heat shock cognate 70 gene of the Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish. Immunol. 2013, 34, 397–401. [Google Scholar] [CrossRef] [PubMed]
- Baird, N.A.; Douglas, P.M.; Simic, M.S.; Grant, A.R.; Moresco, J.J.; Wolff, S.C.; Yates, J.R.; Manning, G.; Dillin, A. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science 2014, 346, 360–363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zimarino, V.; Wilson, S.; Wu, C. Antibody-mediated activation of Drosophila heat shock factor in vitro. Science 1990, 249, 546–549. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Chen, Q.; Gao, X.; Qi, B.; Chen, N.; Xu, S.; Chen, J.; Wang, X. AtHsfA2 modulates expression of stress responsive genes and enhances tolerance to heat and oxidative stress in Arabidopsis. Sci. China C. Life Sci. 2005, 48, 540–550. [Google Scholar] [CrossRef]
- Jensen, L.T.; Nielsen, M.M.; Loeschcke, V. New candidate genes for heat resistance in Drosophila melanogaster are regulated by HSF. Cell Stress Chaperones 2008, 13, 177–182. [Google Scholar] [CrossRef] [Green Version]
- Westerheide, S.D.; Anckar, J.; Stevens, S.J.; Sistonen, L.; Morimoto, R.I. Stress-inducible regulation of heat shock factor 1 by the deacetylase SIRT1. Science 2009, 323, 1063–1066. [Google Scholar] [CrossRef] [Green Version]
- Margulis, B.A.; Guzhova, I.V. Stress proteins in eukaryotic cells. Tsitologiia 2000, 42, 323–342. [Google Scholar]
- Nitika; Porter, C.M.; Truman, A.W.; Truttmann, M.C. Post-translational modifications of Hsp70 family proteins: Expanding the chaperone code. J. Biol. Chem. 2020, 295, 10689–10708. [Google Scholar] [CrossRef]
- Zeiger, C.F. Biological control of alligator weed with Agasicles n. sp. in Florida. Hyacinth Control J. 1967, 6, 31–34. [Google Scholar]
- Spencer, N.R.; Coulson, J.R. The biological control of alligator weed, Alternanthera philoxeroides, in the United States of America. Aquat. Bot. 1976, 2, 177–190. [Google Scholar] [CrossRef]
- Coulson, J.R. Biological control of alligator weed, 1959–1972. In A Review and Evaluation; Technical Bulletins, United States Department of Agriculture: Washington, DC, USA, 1977; pp. 95–98. [Google Scholar]
- Zhao, X. Thermal Adaptation of Agasicles Hygrophila (Coleoptera: Chrysomelidae) in Responses to Temperature Stress; Southwest University: Chongqing, China, 2009; pp. 10–19. [Google Scholar]
- Li, Y.N.; Fu, J.W.; Guo, J.Y. Effects of release density on the population dynamics of the biocontrol agent, Agasicles hygrophila (Coleoptera:Chrysomelidae). J. Biosaf. 2011, 20, 275–280. [Google Scholar]
- Zhao, M.T.; Wang, Y.; Zhou, Z.S.; Wang, R.; Guo, J.Y.; Wan, F.H. Effects of Periodically Repeated Heat Events on Reproduction and Ovary Development of Agasicles hygrophila (Coleoptera: Chrysomelidae). J. Econ. Entomol. 2016, 109, 1586–1594. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.T. Ecological Performance and Transcriptome Analyses of the Two Geographic Population of Agasicles Hygrophila in Response to Heat Stresses; Chinese Academy of Agricultural Sciences: Beijing, China, 2017; pp. 11–25. [Google Scholar]
- Jin, J.S.; Zhao, M.T.; Zhang, H.; Liu, Y.R.; Wan, F.H.; Zhou, Z.S.; Guo, J.Y. Impact of summer temperatures on Agasicles hygrophila, a key biocontrol agent of the invasive weed Alternanthera philoxeroides in Hunan province, China. Entomol. Gen. 2021, 41, 59–70. [Google Scholar] [CrossRef]
- Buckingham, G.R. Biological control of alligator weed, Alternanthera philoxeroides, the world’s first aquatic weed success story. Castanea 1996, 61, 232–243. [Google Scholar]
- Wang, B.R.; Li, W.G.; Wang, J.B. Genetic diversity of Alternanthera philoxeroides in China. Aquat. Bot. 2005, 81, 277–283. [Google Scholar] [CrossRef]
- Ye, W.H.; Li, J.; Cao, H.L.; Ge, X.J. Genetic uniformity of Alternanthera philoxeroides in South China. Weed Res. 2003, 43, 297–302. [Google Scholar] [CrossRef]
- State Environmental Protection Administration of China, and Chinese Academy of Sciences. The Announcement about the First List if Invasive Species in China; Chinese Academy of Sciences: Beijing, China, 2003. [Google Scholar]
- Jin, J.; Zhao, M.; Wang, Y.; Zhou, Z.; Wan, F.; Guo, J. Induced thermotolerance and expression of three key Hsp genes (Hsp70, Hsp21, and sHsp21) and their roles in the high temperature tolerance of Agasicles hygrophila. Front. Physiol. 2019, 10, 1593. [Google Scholar] [CrossRef] [Green Version]
- Jin, J.S.; Li, Y.Z.; Zhou, Z.S.; Zhang, H.; Guo, J.Y.; Wan, F.H. Heat shock factor is involved in regulating the transcriptional expression of twopotential Hsps (AhHsp70 and AhsHsp21) and its role in heat shock response of Agasicles hygrophila. Front. Physiol. 2020, 11, 562204. [Google Scholar] [CrossRef]
- Westwood, J.T.; Clos, J.; Wu, C. Stress-induced oligomerization and chromosomal relocalization of heat-shock factor. Nature 1991, 353, 822–827. [Google Scholar] [CrossRef]
- Peteranderl, R.; Nelson, H.C. Trimerization of the heat shock transcription factor by a triple-stranded alpha-helical coiled-coil. Biochemistry 1992, 31, 12272–12276. [Google Scholar] [CrossRef] [PubMed]
- Rabindran, S.K.; Haroun, R.I.; Clos, J.; Wisniewski, J.; Wu, C. Regulation of heat shock factor trimer formation: Role of a conserved leucine zipper. Science 1993, 259, 230–234. [Google Scholar] [CrossRef] [PubMed]
- Sarge, K.D.; Murphy, S.P.; Morimoto, R.I. Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress. Mol. Cell Biol. 1993, 13, 1392–1407. [Google Scholar] [PubMed] [Green Version]
- Erkine, A.M.; Magrogan, S.F.; Sekinger, E.A.; Gross, D.S. Cooperative binding of heat shock factor to the yeast HSP82 promoter in vivo and in vitro. Mol. Cell Biol. 1999, 19, 1627–1639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, Y.Z.; Kanagaratham, C.; Jancik, S.; Radzioch, D. Promoter deletion analysis using a dual-luciferase reporter system. Methods Mol. Biol. 2013, 977, 79–93. [Google Scholar] [PubMed]
- Liu, H.J. Clone of Bmall Gene Promoter in Mice and its Construction of Luciferase Reporter Gene Vector; Hebei Medical University: Shijiazhuang , China, 2014; pp. 7–21. [Google Scholar]
- Thomson, J.P.; Skene, P.J.; Selfridge, J.; Clouaire, T.; Guy, J.; Webb, S.; Kerr, A.R.; Deaton, A.; Andrews, R.; James, K.D.; et al. CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature 2010, 464, 1082–1086. [Google Scholar] [CrossRef] [Green Version]
- Deaton, A.M.; Bird, A. CpG islands and the regulation of transcription. Genes Dev. 2011, 25, 1010–1022. [Google Scholar] [CrossRef] [Green Version]
- Blackledge, N.P.; Klose, R. CpG island chromatin: A platform for gene regulation. Epigenetics 2011, 6, 147–152. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Chen, Y.; Wei, Y.; Tao, X.; Xu, H.; Liu, Y.; Zhu, L.; Tang, G.; Wen, A.; Lv, D.; et al. Activities analysis and polymorphisms identification of GPIHBP1 promoter region in porcine. Russ. J. Genet. 2018, 54, 680–686. [Google Scholar] [CrossRef]
- Jia, D.; Liu, Y.H.; Zhang, B.; Ji, Z.Y.; Wang, Y.X.; Gao, L.L.; Ma, R.Y. Induction of heat shock protein genes is the hallmark of egg heat tolerance in Agasicles hygrophila (Coleoptera: Chrysomelidae). J. Econ. Entomol. 2020, 113, 1972–1981. [Google Scholar] [CrossRef]
- Tungjitwitayakul, J.; Tatun, N.; Singtripop, T.; Sakurai, S. Characteristic expression of three heat shock-responsive genes during larval diapause in the bamboo borer Omphisa fuscidentalis. Zool. Sci. 2008, 25, 321–333. [Google Scholar] [CrossRef] [PubMed]
- Yao, G.Q.; Zhu, M.L.; Walker, J.; Insogna, K. Identification of a 22 bp DNA cis element that plays a critical role in colony stimulating factor 1-dependent transcriptional activation of the SPHK1 gene. Calcif. Tissue Int. 2020, 107, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.L.; Zhang, Z.H.; Li, B.X.; Cai, Z.; Zhou, Q.H. Bioinformatic and functional analysis of promoter region of human SLC25A13 gene. Gene 2019, 693, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Apriana, A.; Sisharmini, A.; Aswidinnoor, H.; Trijatmiko, K.R.; Sudarsono, S. Promoter deletion analysis reveals root-specific expression of the alkenal reductase gene (OsAER1) in Oryza sativa. Funct. Plant Biol. 2019, 46, 376–391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, G.; Hu, J.; Lian, J.; Zhang, Y.; Zhu, L.; Zeng, D.; Guo, L.; Yu, L.; Xu, G.; Qian, Q. Functional characterization of OsHAK1 promoter in response to osmotic/drought stress by deletion analysis in transgenic rice. Plant Growth Regul. 2019, 88, 241–251. [Google Scholar] [CrossRef]
- Sorensen, J.G.; Kristensen, T.N.; Kristensen, K.V.; Loeschcke, V. Sex specific effects of heat induced hormesis in Hsf-deficient Drosophila melanogaster. Exp. Gerontol. 2007, 42, 1123–1129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, J.Y.; Fu, J.; Xian, X.; Ma, M.; Wan, F. Performance of Agasicles hygrophila (Coleoptera: Chrysomelidae), a biological control agent of invasive alligator weed, at low non-freezing temperatures. Biol. Invasions 2012, 14, 1597–1608. [Google Scholar] [CrossRef]
- Bender, W.; Spierer, P.; Hogness, D.S. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila melanogaster. J. Mol. Biol. 1983, 168, 17–33. [Google Scholar] [CrossRef]
Primers Name | Sequence (5′-3′) | Application | Enzyme |
---|---|---|---|
1279F | CAGACATTTACAACATACGCAG | Inverse PCR | HindIII |
305R | TTTGGCTTACCACTCACG | Inverse PCR | |
51F | CGCAATCTAAGAACAAACC | Sequence verification | |
1106R | CAGCATCACCAAGAAGGC | Sequence verification | |
−944F | atttctctatcgataggtaccAAAGTCACAAATGAATGCAGTTATTTAT | Cloning | KpnI |
−944R | acttagatcgcagatctcgagTATTTTCCAAGTTTAATACTTCACAAATATATT | Cloning | XhoI |
−744R | acttagatcgcagatctcgagATTCTCGGCGTAAATCGAAAAG | Cloning | XhoI |
−544R | acttagatcgcagatctcgagAACTTCAAGAAAACAAATTGAATTTCC | Cloning | XhoI |
−344R | acttagatcgcagatctcgagGGCACCGATCAGATCATGTTTT | Cloning | XhoI |
−144R | acttagatcgcagatctcgagCTTTCATCCTGCTATCCAATATATCAT | Cloning | XhoI |
q-AhHsp70-F | GCCACAGCTGGTGACACACA TCT | RT-qPCR | |
q-AhHsp70-R | AGCTCTTTCGGCAGCAGTCC | RT-qPCR | |
Q-AhHsp70-F | GGTAGCAATGAATCCCAG | RT-qPCR | |
Q-AhHsp70-R | TTACCTTGGTCGTTGGCA | RT-qPCR | |
Q-Hsf-F | TGCCAACGACCAAGGTAA | RT-qPCR | |
Q-Hsf-R | ACACACCCACACAGGAATA | RT-qPCR | |
β-actin-F | GGAATGGAAGCCTGTGGTATC | RT-qPCR | |
β-actin-R | CATTCTGTCGGCAATACCTGG | RT-qPCR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, J.; Liu, Y.; Liang, X.; Pei, Y.; Wan, F.; Guo, J. Regulatory Mechanism of Transcription Factor AhHsf Modulates AhHsp70 Transcriptional Expression Enhancing Heat Tolerance in Agasicles hygrophila (Coleoptera: Chrysomelidae). Int. J. Mol. Sci. 2022, 23, 3210. https://doi.org/10.3390/ijms23063210
Jin J, Liu Y, Liang X, Pei Y, Wan F, Guo J. Regulatory Mechanism of Transcription Factor AhHsf Modulates AhHsp70 Transcriptional Expression Enhancing Heat Tolerance in Agasicles hygrophila (Coleoptera: Chrysomelidae). International Journal of Molecular Sciences. 2022; 23(6):3210. https://doi.org/10.3390/ijms23063210
Chicago/Turabian StyleJin, Jisu, Yiran Liu, Xiaocui Liang, Yiming Pei, Fanghao Wan, and Jianying Guo. 2022. "Regulatory Mechanism of Transcription Factor AhHsf Modulates AhHsp70 Transcriptional Expression Enhancing Heat Tolerance in Agasicles hygrophila (Coleoptera: Chrysomelidae)" International Journal of Molecular Sciences 23, no. 6: 3210. https://doi.org/10.3390/ijms23063210