Anti-Inflammatory and Neuroprotective Mechanisms of GTS-21, an α7 Nicotinic Acetylcholine Receptor Agonist, in Neuroinflammation and Parkinson’s Disease Mouse Models
Abstract
:1. Introduction
2. Results
2.1. GTS-21 Inhibited the Expression of iNOS, COX-2 and Pro-Inflammatory Cytokines While Increasing Anti-Inflammatory TGF-β in LPS-Stimulated Microglial Cells
2.2. GTS-21 Suppressed the Phosphorylation of Akt and NF-κB Activity, While It Increased AMPK Phosphorylation in LPS-Stimulated BV2 Microglial Cells
2.3. GTS-21 Reduced ROS Production by Modulating the NADPH Oxidase Subunit p47phox, While Increasing Antioxidant Enzyme Gene Expression via the Nrf2/ARE Signaling Pathway
2.4. GTS-21 Upregulated the CREB and PPAR-γ Signaling in LPS-Stimulated BV2 Cells
2.5. The α7 nAChR Antagonists, Methyllycaconitine and α-Bungarotoxin, Reversed the Effects of GTS-21 on Pro-/Anti-Inflammatory Signaling Molecules
2.6. GTS-21 Reduced Microglial Activation and Pro-Inflammatory Gene Expression in LPS-Injected Mouse Brains
2.7. GTS-21 Exerted Neuroprotective and Anti-Inflammatory Effects in the MPTP-Induced PD Mouse Model
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Culture of Microglial Cells
4.3. Measurement of Cytokines, Nitrite, and Intracellular ROS Levels
4.4. Mice
4.5. Drug Administration
4.6. Behavioral Test
4.7. Preparation of Brain Tissue
4.8. Immunohistochemistry and Immunofluorescence Analysis
4.9. Reverse-Transcription Polymerase Chain Reaction (RT-PCR)
4.10. Western Blot Analysis
4.11. Transient Transfection and Luciferase Assay
4.12. Electrophoretic Mobility Shift Assay (EMSA)
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chitnis, T.; Weiner, H.L. CNS inflammation and neurodegeneration. J. Clin. Investig. 2012, 127, 3577–3587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ransohoff, R.M. How neuroinflammation contributes to neurodegeneration. Science 2016, 353, 777–783. [Google Scholar] [CrossRef] [PubMed]
- Catalin, B.; Cupido, A.; Iancau, M.; Albu, C.V.; Kirchhoff, F. Microglia: First responders in the central nervous system. Rom. J. Morphol. Embryol. 2013, 54, 467–472. [Google Scholar] [PubMed]
- Hickman, S.; Izzy, S.; Sen, P.; Morsett, L.; Khoury, J.E. Microglia in neurodegeneration. Nat. Neurosci. 2018, 21, 1359–1369. [Google Scholar] [CrossRef] [PubMed]
- Cianciulli, A.; Porro, C.; Calvello, R.; Trotta, T.; Lofrumento, D.D.; Panaro, M.A. Microglia mediated neuroinflammation: Focus on PI3K modulation. Biomolecules 2020, 10, 137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwon, H.S.; Koh, S.H. Neuroinflammation in neurodegenerative disorders: The roles of microglia and astrocytes. Transl. Neurodegener. 2020, 9, 42. [Google Scholar] [CrossRef] [PubMed]
- Poewe, W.; Seppi, K.; Tanner, C.M.; Halliday, G.M.; Brundin, P.; Volkmann, L.; Schrag, A.E.; Lang, A.E. Parkinson disease. Nat. Rev. Dis. Primers 2017, 3, 17013. [Google Scholar] [CrossRef]
- Emamzadeh, F.N.; Surguchov, A. Parkinson’s disease: Biomarkers, treatment, and risk factors. Front. Neurosci. 2018, 12, 612. [Google Scholar] [CrossRef]
- Fujiwara, H.; Hasegawa, M.; Dohmae, N.; Kawashima, A.; Masliah, E.; Goldberg, M.S.; Shen, J.; Takio, K.; Iwatsubo, T. Alpha-synuclein is phosphorylated in synucleinopathy lesions. Nat. Cell Biol. 2002, 4, 160–164. [Google Scholar] [CrossRef]
- Ferreira, S.A.; Romero-Ramos, M. Microglia response during Parkinson’s disease: Alpha-synuclein intervention. Front. Cell. Neurosci. 2018, 12, 247. [Google Scholar] [CrossRef] [Green Version]
- Kawamata, J.; Suzuki, S.; Shimohama, S. α7 nicotinic acetylcholine receptor mediated neuroprotection in Parkinson’s disease. Curr. Drug Targets 2012, 13, 623–630. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Liu, Z.; Jiang, Y.Y.; Shen, W.X.; Peng, Y.P.; Qiu, Y.H. Acetylcholine suppresses microglial inflammatory response via α7nAChR to protect hippocampal neurons. J. Integr. Neurosci. 2019, 18, 51–56. [Google Scholar] [PubMed] [Green Version]
- John, D.; Shelukhina, I.; Yanagawa, Y.; Deuchars, J.; Henderson, Z. Functional alpha7 nicotinic receptors are expressed on immature granule cells of the postnatal dentate gyrus. Brain Res. 2015, 1601, 15–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallowitsch-Puerta, M.; Tracey, K.J. Immunologic role of the cholinergic anti-inflammatory pathway and the nicotinic acetylcholine alpha 7 receptor. Ann. N. Y. Acad. Sci. 2005, 1062, 209–219. [Google Scholar] [CrossRef] [PubMed]
- Borovikova, L.V.; Ivanova, S.; Zhang, M.; Yang, H.; Botchkina, G.I.; Watkins, L.R.; Wang, H.; Abumrad, N.; Eaton, J.W.; Tracey, K.J. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature 2000, 405, 458–462. [Google Scholar] [CrossRef] [PubMed]
- Shytle, R.D.; Mori, T.; Townsend, K.; Vendrame, M.; Sun, N.; Zeng, J.; Ehrhart, J.; Silver, A.A.; Sanberg, P.R.; Tan, J. Cholinergic modulation of microglial activation by alpha 7 nicotinic receptors. J. Neurochem. 2004, 89, 337–343. [Google Scholar] [CrossRef]
- Parrish, W.R.; Rosas-Ballina, M.; Gallowitsch-Puerta, M.; Ochani, M.; Ochani, K.; Yang, L.H.; Hudson, L.Q.; Lin, X.; Patel, N.; Johnson, S.M.; et al. Modulation of TNF release by choline requires alpha7 subunit nicotinic acetylcholine receptor-mediated signaling. Mol. Med. 2008, 14, 567–574. [Google Scholar] [CrossRef]
- Guan, Y.Z.; Jin, X.D.; Guan, L.X.; Yan, H.C.; Wang, P.; Gong, Z.; Li, S.J.; Cao, X.; Xing, Y.L.; Gao, T.M. Nicotine inhibits microglial proliferation and is neuroprotective in global ischemia rats. Mol. Neurobiol. 2015, 51, 1480–1488. [Google Scholar] [CrossRef]
- Liu, Y.; Hu, J.; Wu, J.; Zhu, C.; Hui, Y.; Han, Y.; Huang, Z.; Ellsworth, K.; Fan, W. α7 nicotinic acetylcholine receptor-mediated neuroprotection against dopaminergic neuron loss in an MPTP mouse model via inhibition of astrocyte activation. J. Neuroinflamm. 2012, 9, 98. [Google Scholar] [CrossRef] [Green Version]
- Gamage, R.; Wagnon, I.; Rossetti, I.; Childs, R.; Niedermayer, G.; Chesworth, R.; Gyengesi, E. Cholinergic modulation of glial function during aging and chronic neuroinflammation. Front. Cell. Neurosci. 2020, 14, 577912. [Google Scholar] [CrossRef]
- Reale, M.; Costantini, E. Cholinergic modulation of the immune system in neuroinflammatory diseases. Diseases 2021, 9, 29. [Google Scholar] [CrossRef] [PubMed]
- Kem, W.R.; Mahnir, V.M.; Prokai, L.; Papke, R.L.; Cao, X.; LeFrancois, S.; Wildeboer, K.; Prokai-Tatrai, K.; Porter-Papke, J.; Soti, F. Hydroxy metabolites of the Alzheimer’s drug candidate 3-[(2,4-dimethoxy)benzylidene]-anabaseine dihydrochloride (GTS-21): Their molecular properties, interactions with brain nicotinic receptors, and brain penetration. Mol. Pharmacol. 2004, 65, 56–67. [Google Scholar] [CrossRef] [PubMed]
- Kem, W.R. The brain alpha7 nicotinic receptor may be an important therapeutic target for the treatment of Alzheimer’s disease: Studies with DMXBA (GTS-21). Behav. Brain Res. 2000, 113, 169–181. [Google Scholar] [CrossRef]
- Kitagawa, H.; Takenouchi, T.; Azuma, R.; Wesnes, K.A.; Kramer, W.G.; Clody, D.E.; Burnett, A.L. Safety, pharmacokinetics, and effects on cognitive function of multiple doses of GTS-21 in healthy, male volunteers. Neuropsychopharmacology 2003, 28, 542–551. [Google Scholar] [CrossRef] [Green Version]
- Thomsen, M.S.; Mikkelsen, J.D. The α7 nicotinic acetylcholine receptor ligands methyllycaconitine, NS6740 and GTS-21 reduce lipopolysaccharide-induced TNF-α release from microglia. J. Neuroimmunol. 2012, 251, 65–72. [Google Scholar] [CrossRef]
- Patel, H.; Mclntire, J.; Ryan, S.; Dunah, A.; Loring, R. Anti-inflammatory effects of astroglial α7 nicotinic acetylcholine receptors are mediated by inhibition of the NF-κB pathway and activation of the Nrf2 pathway. J. Neuroinflamm. 2017, 14, 192. [Google Scholar] [CrossRef]
- Takata, K.; Amamiya, T.; Mizoguchi, H.; Kawanishi, S.; Kuroda, E.; Kitamura, R.; Ito, A.; Saito, Y.; Tawa, M.; Nagasawa, T.; et al. Alpha7 nicotinic acetylcholine receptor-specific agonist DMXBA (GTS-21) attenuates Aβ accumulation through suppression of neuronal γ-secretase activity and promotion of microglial amyloid-β phagocytosis and ameliorates cognitive impairment in a mouse model of Alzheimer’s disease. Neurobiol. Aging 2018, 62, 197–209. [Google Scholar]
- Peterson, L.J.; Flood, P.M. Oxidative stress and microglial cells in Parkinson’s disease. Mediat. Inflamm. 2012, 2012, 401264. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.Y.; Park, J.S.; Leem, Y.H.; Park, J.E.; Kim, D.Y.; Choi, Y.H.; Park, E.M.; Kang, J.L.; Kim, H.S. The phosphodiesterase 10 inhibitor papaverine exerts anti-inflammatory and neuroprotective effects via the PKA signaling pathway in neuroinflammation and Parkinson’s disease mouse models. J. Neuroinflamm. 2019, 16, 246. [Google Scholar] [CrossRef]
- Choi, M.J.; Lee, E.J.; Park, J.S.; Kim, S.N.; Park, E.M.; Kim, H.S. Anti-inflammatory mechanism of galangin in lipopolysaccharide-stimulated microglia: Critical role of PPAR-γ signaling pathway. Biochem. Pharmacol. 2017, 144, 120–131. [Google Scholar] [CrossRef]
- Egea, J.; Buendia, I.; Parada, E.; Navarro, E.; Leon, R.; Lopez, M.G. Anti-inflammatory role of microglial alpha7 nAChRs and its role in neuroprotection. Biochem. Pharmacol. 2015, 97, 463–472. [Google Scholar] [CrossRef] [PubMed]
- Nthenge-Ngumbau, D.N.; Mohanakumar, K.P. Can cyclic nucleotide phosphodiesterase inhibitors be drugs for Parkinson’s disease? Mol. Neurobiol. 2018, 55, 822–834. [Google Scholar] [CrossRef] [PubMed]
- Niture, S.K.; Jaiswal, A.K. Nrf2 protein up-regulates antiapoptotic protein Bcl-2 and prevents cellular apoptosis. J. Biol. Chem. 2012, 287, 9873–9886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashimoto, K. Essential role of Keap1-Nrf2 signaling in mood disorders: Overview and future perspective. Front. Pharmacol. 2018, 9, 1182. [Google Scholar] [CrossRef] [PubMed]
- Rosas-Ballina, M.; Goldstein, R.S.; Gallowitsch-Puerta, M.; Yang, L.; Valdés-Ferrer, S.I.; Patel, N.B.; Chavan, S.; Al-Abed, Y.; Yang, H.; Tracey, K.J. The selective alpha7 agonist GTS-21 attenuates cytokine production in human whole blood and human monocytes activated by ligands for TLR2, TLR3, TLR4, TLR9, and RAGE. Mol. Med. 2009, 15, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Koopman, F.A.; Schuurman, P.R.; Vervoordeldonk, M.J.; Tak, P.P. Vagus nerve stimulation: A new bioelectronics approach to treat rheumatoid arthritis? Best Pract. Res. Clin. Rheumatol. 2014, 28, 625–635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Zuo, X.; Li, Y.; Wang, Y.; Zhao, H.; Xiao, S. Nicotine inhibits tumor necrosis factor-α induced IL-6 and IL-8 secretion in fibroblast-like synoviocytes from patients with rheumatoid arthritis. Rheumatol. Int. 2012, 32, 97–104. [Google Scholar] [CrossRef]
- Van Westerloo, D.J.; Giebelen, I.A.; Florquin, S.; Bruno, M.J.; Larosa, G.J.; Ulloa, L.; Tracey, K.J.; van der Poll, T. The vagus nerve and nicotinic receptors modulate experimental pancreatitis severity in mice. Gastroenterology 2006, 130, 1822–1830. [Google Scholar] [CrossRef]
- Liu, X.; Mei, Z.; Qian, J.; Zeng, Y.; Wang, M. Puerarin partly counteracts the inflammatory response after cerebral ischemia/reperfusion via activating the cholinergic anti-inflammatory pathway. Neural Regen. Res. 2013, 8, 3203–3215. [Google Scholar]
- Park, J.E.; Park, J.S.; Leem, Y.H.; Kim, D.Y.; Kim, H.S. NQO1 mediates the anti-inflammatory effects of nootkatone in lipopolysaccharide-induced neuroinflammation by modulating the AMPK signaling pathway. Free Radic. Biol. Med. 2021, 164, 354–368. [Google Scholar] [CrossRef]
- Lee, Y.Y.; Park, J.S.; Lee, E.J.; Lee, S.Y.; Kim, D.H.; Kang, J.L.; Kim, H.S. Anti-inflammatory mechanism of ginseng saponin metabolite Rh3 in lipopolysaccharide-stimulated microglia: Critical role of 5′-adenosine monophosphate-activated protein kinase signaling pathway. J. Agric. Food Chem. 2015, 63, 3472–3480. [Google Scholar] [CrossRef] [PubMed]
- Bocchini, V.; Mazzolla, R.; Barluzzi, R.; Blasi, E.; Sick, P.; Kettenmann, H. An immortalized cell line expresses properties of activated microglial cells. J. Neurosci. Res. 1992, 31, 616–621. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.J.; Ko, H.M.; Jeong, Y.H.; Park, E.M.; Kim, H.S. β-Lapachone suppresses neuroinflammation by modulating the expression of cytokines and matrix metalloproteinases in activated microglia. J. Neuroinflamm. 2015, 12, 133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, J.S.; Lee, Y.Y.; Kim, J.; Seo, H.; Kim, H.S. β-Lapachone increases phase II antioxidant enzyme expression via NQO1-AMPK/PI3K-Nrf2/ARE signaling in rat primary astrocytes. Free Radic. Biol. Med. 2016, 97, 168–178. [Google Scholar] [CrossRef] [PubMed]
- Thelen, M.P.; Wirth, B.; Kye, M.J. Mitochondrial defects in the respiratory complex I contribute to impaired translational initiation via ROS and energy homeostasis in SMA motor neurons. Acta Neuropathol. Commun. 2020, 8, 223. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′−3′) | Reverse Primer (5′−3′) | Size |
---|---|---|---|
iNOS | CAAGAGTTTGACCAGAGGACC | TGGAACCACTCGTACTTGGGA | 450 bp |
TNF-α | CCTATGTCTCAGCCTCTTCT | CCTGGTATGAGATAGCAAAT | 354 bp |
IL-1β | GGCAACTGTTCCTGAACTCAACTG | CCATTGAGGTGGAGAGCTTTCAGC | 447 bp |
IL-6 | CCACTTCACAAGTCGGAGGCTT | CCAGCTTATCTGTTAGGAGA | 395 bp |
COX-2 | TTCAAAAGAAGTGCTGGAAAAGGT | GATCATCTCTACCTGAGTGTCTTT | 304 bp |
TGF-β | GCAGGAGCGCACAATCATGT | GCCCTGGATACCAACTATTG | 327 bp |
NQO1 | AGAGGCTCTGAAGAAGAGAGG | CACCCTGAAGAGAGTACATGG | 401 bp |
HO-1 | ATACCCGCTACCTGGGTGAC | TGTCACCCTGTGCTTGACCT | 209 bp |
Catalase | CCTGACATGGTCTGGGACTT | CAAGTTTTTGATGCCCTGGT | 245 bp |
PPARγ | CCGAAGAACCATCCGATT | CGGGAAGGACTTTATGTA | 271 bp |
p47phox | CGATGGATTGTCCTTTGTGC | ATCACCGGCTATTTCCCATC | 256 bp |
p67phox | CCCTTGGTGGAAGTCCAAAT | ATCCTGGATTCCCATCTCCA | 242 bp |
gp91phox | ACTGCGGAGAGTTTGGAAGA | GGTGATGACCACCTTTTGCT | 201 bp |
p22phox | AAAGAGGAAAAAGGGGTCCA | TAGGCTCAATGGGAGTCCAC | 239 bp |
GAPDH | ATGTACGTAGCCATCCAGGC | AGGAAGGAAGGCTGGAAGAG | 420 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.-E.; Leem, Y.-H.; Park, J.-S.; Kim, D.-Y.; Kang, J.L.; Kim, H.-S. Anti-Inflammatory and Neuroprotective Mechanisms of GTS-21, an α7 Nicotinic Acetylcholine Receptor Agonist, in Neuroinflammation and Parkinson’s Disease Mouse Models. Int. J. Mol. Sci. 2022, 23, 4420. https://doi.org/10.3390/ijms23084420
Park J-E, Leem Y-H, Park J-S, Kim D-Y, Kang JL, Kim H-S. Anti-Inflammatory and Neuroprotective Mechanisms of GTS-21, an α7 Nicotinic Acetylcholine Receptor Agonist, in Neuroinflammation and Parkinson’s Disease Mouse Models. International Journal of Molecular Sciences. 2022; 23(8):4420. https://doi.org/10.3390/ijms23084420
Chicago/Turabian StylePark, Jung-Eun, Yea-Hyun Leem, Jin-Sun Park, Do-Yeon Kim, Jihee Lee Kang, and Hee-Sun Kim. 2022. "Anti-Inflammatory and Neuroprotective Mechanisms of GTS-21, an α7 Nicotinic Acetylcholine Receptor Agonist, in Neuroinflammation and Parkinson’s Disease Mouse Models" International Journal of Molecular Sciences 23, no. 8: 4420. https://doi.org/10.3390/ijms23084420