RNA-Seq, Bioinformatic Identification of Potential MicroRNA-like Small RNAs in the Edible Mushroom Agaricus bisporus and Experimental Approach for Their Validation
Abstract
:1. Introduction
2. Results
2.1. Analysis of Small RNA Library
2.2. Homology Search among Known miRNAs
2.3. Prediction of De Novo milRNAs
2.4. Experimental Verification by RT-qPCR
2.5. Homology with Other Fungal Species
2.6. Target Gene Prediction and Functional Analysis for A. bisporus milRNAs
3. Discussion
4. Materials and Methods
4.1. Biological Material
4.2. Small RNA Deep Sequencing
4.3. Data Analysis of Small RNA and miRNA Prediction
4.4. miRNA Target Prediction
4.5. RT-qPCR Assay of miRNAs
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Green Version]
- Aravin, A.; Tuschl, T. Identification and characterization of small RNAs involved in RNA silencing. FEBS Lett. 2005, 579, 5830–5840. [Google Scholar] [CrossRef] [Green Version]
- Anand, R. RNA interference: Trends in small regulatory rnas and gene silencing. Int. J. Pharma. Bio. Sci. 2017, 8, 326–333. [Google Scholar] [CrossRef]
- Ha, M.; Kim, V.N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 2014, 15, 509–524. [Google Scholar] [CrossRef]
- Shukla, G.C.; Singh, J.; Barik, S. MicroRNAs: Processing, Maturation, Target Recognition and Regulatory Functions. Mol. Cell Pharmacol. 2011, 3, 83–92. [Google Scholar] [PubMed]
- Torres-Martínez, S.; Ruiz-Vázquez, R.M. The RNAi Universe in Fungi: A Varied Landscape of Small RNAs and Biological Functions. Annu. Rev. Microbiol. 2017, 71, 371–391. [Google Scholar] [CrossRef]
- Borges, F.; Martienssen, R.A. The expanding world of small RNAs in plants. Nat. Rev. Mol. Cell Biol. 2015, 16, 727–741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Treiber, T.; Treiber, N.; Meister, G. Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat. Rev. Mol. Cell Biol. 2019, 20, 5–20. [Google Scholar] [CrossRef] [PubMed]
- Okamura, K. Diversity of animal small RNA pathways and their biological utility. Wiley Interdiscip Rev. RNA 2012, 3, 351–368. [Google Scholar] [CrossRef]
- Romano, N.; Macino, G. Quelling: Transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol. Microbiol. 1992, 6, 3343–3353. [Google Scholar] [CrossRef]
- Lee, H.C.; Li, L.; Gu, W.; Xue, Z.; Crosthwaite, S.K.; Pertsemlidis, A.; Lewis, Z.A.; Freitag, M.; Selker, E.U.; Mello, C.C.; et al. Diverse pathways generate microRNA-like RNAs and Dicer-independent small interfering RNAs in fungi. Mol. Cell 2010, 38, 803–814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, J.; Fu, Y.; Xie, J.; Li, B.; Jiang, D.; Li, G.; Cheng, J. Identification of microRNA-like RNAs in a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing. Mol. Genet. Genom. 2012, 287, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; Yang, Y.; Janbon, G.; Pan, J.; Zhu, X. Identification and functional demonstration of miRNAs in the fungus Cryptococcus neoformans. PLoS ONE 2012, 7, e52734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, K.; Zhong, J.; Jiang, L.; Liu, G.; Gou, C.Y.; Wu, Q.; Wang, Y.; Luo, J.; Gou, D. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing. PLoS ONE 2013, 8, e76288. [Google Scholar] [CrossRef]
- Lau, S.K.; Chow, W.N.; Wong, A.Y.; Yeung, J.M.; Bao, J.; Zhang, N.; Lok, S.; Woo, P.C.; Yuen, K.Y. Identification of microRNA-like RNAs in mycelial and yeast phases of the thermal dimorphic fungus Penicillium marneffei. PLoS Negl. Trop. Dis. 2013, 7, e2398. [Google Scholar] [CrossRef] [Green Version]
- Chen, R.; Jiang, N.; Jiang, Q.; Sun, X.; Wang, Y.; Zhang, H.; Hu, Z. Exploring microRNA-like small RNAs in the filamentous fungus Fusarium oxysporum. PLoS ONE 2014, 9, e104956. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Li, X.; Ma, L.; Urrehman, U.; Bao, X.; Zhang, Y.; Zhang, C.Y.; Hou, D.; Zhou, Z. Identification of microRNA-like RNAs in Ophiocordyceps sinensis. Sci. China Life Sci. 2019, 62, 349–356. [Google Scholar] [CrossRef]
- Wang, G.; Li, M.; Zhang, C.; Zhan, N.; Cheng, H.; Gao, Y.; Sun, C.; Deng, W.; Li, T. Identification of microRNA-like RNAs in Cordyceps guangdongensis and their expression profile under differential developmental stages. Fungal Genet. Biol. 2021, 147, 103505. [Google Scholar] [CrossRef]
- Li, B.; Cheng, X.; Zhang, T.; Liu, L.; Nie, Z.; Sheng, Q. The identification of microRNAs in Ganoderma lingzhi sporocarp. Mycoscience 2016, 57, 271–278. [Google Scholar] [CrossRef]
- Mu, D.S.; Li, C.; Shi, L.; Zhang, X.; Ren, A.; Zhao, M.W. Bioinformatic Identification of Potential MicroRNAs and Their Targets in the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes). Int. J. Med. Mushrooms 2015, 17, 783–797. [Google Scholar] [CrossRef]
- Lin, Y.L.; Ma, L.T.; Lee, Y.R.; Lin, S.S.; Wang, S.Y.; Chang, T.T.; Shaw, J.F.; Li, W.H.; Chu, F.H. MicroRNA-like small RNAs prediction in the development of Antrodia cinnamomea. PLoS ONE 2015, 10, e0123245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Q.; Li, L.; Xue, Z.; Ye, Q.; Zhang, L.; Li, S.; Liu, Y. Transcription of the major neurospora crassa microRNA-like small RNAs relies on RNA polymerase III. PLoS Genet. 2013, 9, e1003227. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.H.; Zhang, T.; Liu, Q.Y.; Guo, H.S. Trans-kingdom RNAs and their fates in recipient cells: Advances, utilization, and perspectives. Plant Commun. 2021, 2, 100167. [Google Scholar] [CrossRef] [PubMed]
- Chung, S.H.; Feng, H.; Jander, G. Engineering pest tolerance through plant-mediated RNA interference. Curr. Opin. Plant. Biol. 2021, 60, 102029. [Google Scholar] [CrossRef]
- Jia, M.; He, J.; Bai, W.; Lin, Q.; Deng, J.; Li, W.; Bai, J.; Fu, D.; Ma, Y.; Ren, J.; et al. Cross-kingdom regulation by dietary plant miRNAs: An evidence-based review with recent updates. Food Funct. 2021, 12, 9549–9562. [Google Scholar] [CrossRef]
- Morin, E.; Kohler, A.; Baker, A.R.; Foulongne-Oriol, M.; Lombard, V.; Nagy, L.G.; Ohm, R.A.; Patyshakuliyeva, A.; Brun, A.; Aerts, A.L.; et al. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche. Proc. Natl. Acad. Sci. USA 2012, 109, 17501–17506. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Férandon, C.; Xu, J.; Barroso, G. The 135 kbp mitochondrial genome of Agaricus bisporus is the largest known eukaryotic reservoir of group I introns and plasmid-related sequences. Fungal Genet. Biol. 2013, 55, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Griffiths-Jones, S.; Grocock, R.J.; van Dongen, S.; Bateman, A.; Enright, A.J. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006, 34, D140–D144. [Google Scholar] [CrossRef]
- Desvignes, T.; Batzel, P.; Berezikov, E.; Eilbeck, K.; Eppig, J.T.; McAndrews, M.S.; Singer, A.; Postlethwait, J.H. miRNA Nomenclature: A View Incorporating Genetic Origins, Biosynthetic Pathways, and Sequence Variants. Trends Genet. 2015, 31, 613–626. [Google Scholar] [CrossRef] [Green Version]
- Betel, D.; Koppal, A.; Agius, P.; Sander, C.; Leslie, C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 2010, 11, R90. [Google Scholar] [CrossRef] [Green Version]
- John, B.; Enright, A.J.; Aravin, A.; Tuschl, T.; Sander, C.; Marks, D.S. Human MicroRNA targets. PLoS Biol. 2004, 2, e363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Kanehisa, M.; Sato, Y. KEGG Mapper for inferring cellular functions from protein sequences. Protein Sci. 2020, 29, 28–35. [Google Scholar] [CrossRef] [Green Version]
- Royse, D.; Baars, J.J.P.; Tan, Q. Current Overview of Mushroom Production in the World: Technology and Applications; John Wiley & Sons: Chichester, UK, 2017; pp. 5–13. [Google Scholar]
- Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef] [Green Version]
- Foulongne-Oriol, M.; Murat, C.; Castanera, R.; Ramírez, L.; Sonnenberg, A.S. Genome-wide survey of repetitive DNA elements in the button mushroom Agaricus bisporus. Fungal Genet. Biol. 2013, 55, 6–21. [Google Scholar] [CrossRef] [PubMed]
- Friedländer, M.R.; Mackowiak, S.D.; Li, N.; Chen, W.; Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2012, 40, 37–52. [Google Scholar] [CrossRef]
- An, J.; Lai, J.; Sajjanhar, A.; Lehman, M.L.; Nelson, C.C. miRPlant: An integrated tool for identification of plant miRNA from RNA sequencing data. BMC Bioinform. 2014, 15, 275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wainright, P.O.; Hinkle, G.; Sogin, M.L.; Stickel, S.K. Monophyletic origins of the metazoa: An evolutionary link with fungi. Science 1993, 260, 340–342. [Google Scholar] [CrossRef] [PubMed]
- Devers, E.A.; Branscheid, A.; May, P.; Krajinski, F. Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis. Plant. Physiol. 2011, 156, 1990–2010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Müller, L.M.; Harrison, M.J. Phytohormones, miRNAs, and peptide signals integrate plant phosphorus status with arbuscular mycorrhizal symbiosis. Curr. Opin. Plant. Biol. 2019, 50, 132–139. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.H.; Guo, H.S. Trans-kingdom RNA interactions drive the evolutionary arms race between hosts and pathogens. Curr. Opin. Genet. Dev. 2019, 58–59, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Middleton, H.; Yergeau, É.; Monard, C.; Combier, J.P.; El Amrani, A. Rhizospheric Plant-Microbe Interactions: miRNAs as a Key Mediator. Trends Plant. Sci. 2021, 26, 132–141. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Hou, D.; Chen, X.; Li, D.; Zhu, L.; Zhang, Y.; Li, J.; Bian, Z.; Liang, X.; Cai, X.; et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: Evidence of cross-kingdom regulation by microRNA. Cell Res. 2012, 22, 107–126. [Google Scholar] [CrossRef]
- Baier, S.R.; Nguyen, C.; Xie, F.; Wood, J.R.; Zempleni, J. MicroRNAs are absorbed in biologically meaningful amounts from nutritionally relevant doses of cow milk and affect gene expression in peripheral blood mononuclear cells, HEK-293 kidney cell cultures, and mouse livers. J. Nutr. 2014, 144, 1495–1500. [Google Scholar] [CrossRef]
- Chin, A.R.; Fong, M.Y.; Somlo, G.; Wu, J.; Swiderski, P.; Wu, X.; Wang, S.E. Cross-kingdom inhibition of breast cancer growth by plant miR159. Cell Res. 2016, 26, 217–228. [Google Scholar] [CrossRef] [Green Version]
- Zhou, G.; Zhou, Y.; Chen, X. New Insight into Inter-kingdom Communication: Horizontal Transfer of Mobile Small RNAs. Front. Microbiol. 2017, 8, 768. [Google Scholar] [CrossRef] [PubMed]
- Dávalos, A.; Pinilla, L.; López de Las Hazas, M.C.; Pinto-Hernández, P.; Barbé, F.; Iglesias-Gutiérrez, E.; de Gonzalo-Calvo, D. Dietary microRNAs and cancer: A new therapeutic approach? Semin. Cancer Biol. 2021, 73, 19–29. [Google Scholar] [CrossRef] [PubMed]
- Del Pozo-Acebo, L.; López de Las Hazas, M.C.; Margollés, A.; Dávalos, A.; García-Ruiz, A. Eating microRNAs: Pharmacological opportunities for cross-kingdom regulation and implications in host gene and gut microbiota modulation. Br. J. Pharmacol. 2021, 178, 2218–2245. [Google Scholar] [CrossRef]
- López de Las Hazas, M.C.; Del Pozo-Acebo, L.; Hansen, M.S.; Gil-Zamorano, J.; Mantilla-Escalante, D.C.; Gómez-Coronado, D.; Marín, F.; Garcia-Ruiz, A.; Rasmussen, J.T.; Dávalos, A. Dietary bovine milk miRNAs transported in extracellular vesicles are partially stable during GI digestion, are bioavailable and reach target tissues but need a minimum dose to impact on gene expression. Eur. J. Nutr. 2022, 61, 1043–1056. [Google Scholar] [CrossRef]
- Li, I.C.; Chang, H.H.; Lin, C.H.; Chen, W.P.; Lu, T.H.; Lee, L.Y.; Chen, Y.W.; Chen, Y.P.; Chen, C.C.; Lin, D.P. Prevention of Early Alzheimer’s Disease by Erinacine A-Enriched Hericium erinaceus Mycelia Pilot Double-Blind Placebo-Controlled Study. Front. Aging Neurosci. 2020, 12, 155. [Google Scholar] [CrossRef]
- Torkelson, C.J.; Sweet, E.; Martzen, M.R.; Sasagawa, M.; Wenner, C.A.; Gay, J.; Putiri, A.; Standish, L.J. Phase 1 Clinical Trial of Trametes versicolor in Women with Breast Cancer. ISRN Oncol. 2012, 2012, 251632. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Ha, D.; Mori, H.; Chen, S. White button mushroom (Agaricus bisporus) disrupts androgen receptor signaling in human prostate cancer cells and patient-derived xenograft. J. Nutr. Biochem. 2021, 89, 108580. [Google Scholar] [CrossRef]
- Hammond, J.B.W.; Nichols, R. Changes in respiration and soluble carbohydrates during the post-harvest storage of mushrooms (Agaricus bisporus). J. Sci. Food Agric. 1975, 26, 835–842. [Google Scholar] [CrossRef]
- Ramírez Anguiano, A.; Santoyo, S.; Reglero, G.; Soler Rivas, C. Radical scavenging activities, endogenous oxidative enzymes and total phenols in edible mushrooms commonly consumed in Europe. J. Sci. Food Agric. 2007, 87, 2272–2278. [Google Scholar] [CrossRef]
- Andrés-León, E.; Núñez-Torres, R.; Rojas, A.M. miARma-Seq: A comprehensive tool for miRNA, mRNA and circRNA analysis. Sci. Rep. 2016, 6, 25749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andrews, S. A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 10 February 2018).
- Martin, M. CUTADAPT removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17. [Google Scholar] [CrossRef]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kersey, P.J.; Allen, J.E.; Allot, A.; Barba, M.; Boddu, S.; Bolt, B.J.; Carvalho-Silva, D.; Christensen, M.; Davis, P.; Grabmueller, C.; et al. Ensembl Genomes 2018: An integrated omics infrastructure for non-vertebrate species. Nucleic Acids Res. 2018, 46, D802–D808. [Google Scholar] [CrossRef]
- Glöckner, F.O.; Yilmaz, P.; Quast, C.; Gerken, J.; Beccati, A.; Ciuprina, A.; Bruns, G.; Yarza, P.; Peplies, J.; Westram, R.; et al. 25 years of serving the community with ribosomal RNA gene reference databases and tools. J. Biotechnol. 2017, 261, 169–176. [Google Scholar] [CrossRef]
- Chan, P.P.; Lowe, T.M. GtRNAdb 2.0: An expanded database of transfer RNA genes identified in complete and draft genomes. Nucleic Acids Res. 2016, 44, D184–D189. [Google Scholar] [CrossRef] [Green Version]
- Kalvari, I.; Argasinska, J.; Quinones-Olvera, N.; Nawrocki, E.P.; Rivas, E.; Eddy, S.R.; Bateman, A.; Finn, R.D.; Petrov, A.I. Rfam 13.0: Shifting to a genome-centric resource for non-coding RNA families. Nucleic Acids Res. 2018, 46, D335–D342. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neph, S.; Kuehn, M.S.; Reynolds, A.P.; Haugen, E.; Thurman, R.E.; Johnson, A.K.; Rynes, E.; Maurano, M.T.; Vierstra, J.; Thomas, S.; et al. BEDOPS: High-performance genomic feature operations. Bioinformatics 2012, 28, 1919–1920. [Google Scholar] [CrossRef] [Green Version]
- Quinlan, A.R.; Hall, I.M. BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef] [Green Version]
- Aho, A.; Kernighan, B.; Weinberger, P. The AWK Programming Language, 1st ed.; Addison-Wesley Longman Publishing Co.: Dallas, TX, USA, 1988. [Google Scholar]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, D68–D73. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef]
- Griffiths-Jones, S.; Saini, H.K.; van Dongen, S.; Enright, A.J. miRBase: Tools for microRNA genomics. Nucleic Acids Res. 2008, 36, D154–D158. [Google Scholar] [CrossRef] [Green Version]
- Wheeler, D.; Bhagwat, M. BLAST QuickStart: Example-driven web-based BLAST tutorial. In Comparative Genomics; Bergman NH: Totowa, NJ, USA, 2007; Volume 395. [Google Scholar]
- Hofacker, I.L. Vienna RNA secondary structure server. Nucleic Acids Res. 2003, 31, 3429–3431. [Google Scholar] [CrossRef] [Green Version]
- Yao, Y.; Zhang, H.; Deng, H. milRNApredictor: Genome-free prediction of fungi milRNAs by incorporating k-mer scheme and distance-dependent pair potential. Genomics 2020, 112, 2233–2240. [Google Scholar] [CrossRef] [PubMed]
- Notredame, C.; Higgins, D.G.; Heringa, J. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 2000, 302, 205–217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Cowley, A.; Uludag, M.; Gur, T.; McWilliam, H.; Squizzato, S.; Park, Y.M.; Buso, N.; Lopez, R. The EMBL-EBI bioinformatics web and programmatic tools framework. Nucleic Acids Res. 2015, 43, W580–W584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wheeler, T.J.; Clements, J.; Finn, R.D. Skylign: A tool for creating informative, interactive logos representing sequence alignments and profile hidden Markov models. BMC Bioinform. 2014, 15, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Total Reads | Unique Reads | |||
---|---|---|---|---|
Number | % | Number | % | |
Raw reads | 2,027,870 | - | 414,881 | - |
Trimmed reads (18–50 nt) | 1,421,021 | - | 291,880 | - |
Mapped reads | 1,015,249 | 100.00 | 117,838 | 100.00 |
rRNA | 94,076 | 9.26 | 1786 | 1.52 |
tRNA | 267,465 | 26.45 | 3472 | 2.95 |
snRNA | 26,952 | 2.65 | 1823 | 1.55 |
snoRNA | 179 | 0.02 | 80 | 0.07 |
Unknown reads | 626,577 | 61.72 | 110,677 | 93.92 |
miRDeep2 | ||||
Name | Sequence 5′→3′ | Reads | L | Pre-miRNA Position |
abi_milRNA_1a_1 | GUGGGCUGGGCUGCUGCAGCG | 38,803 | 21 | Scaffold_10: 1624834...1624880: + |
abi_milRNA_1a_2 | GUGGGCUGGGCUGCUGCAGCG | 38,803 | 21 | Scaffold_10: 1633264...1633310: + |
abi_milRNA_1a_3 | GUGGGCUGGGCUGCUGCAGCG | 38,803 | 21 | Scaffold_10: 1586743...1586789: + |
abi_milRNA_1a_4 | GUGGGCUGGGCUGCUGCAGCG | 38,803 | 21 | Scaffold_10: 1615990...1616035: + |
abi_milRNA_2a | UCUAAUCAUGGACGUGCU | 1835 | 18 | Scaffold_19: 127065...127112: − |
abi_milRNA_3a | UCAGCUCGCAAUGUAGAUAUU | 1186 | 21 | Scaffold_9: 984246...984325: − |
abi_milRNA_4a | AGGCUGCGGAACGUUGGCACGGGU | 34 | 24 | Scaffold_8: 1573143...1573195: − |
abi_milRNA_5a | UGACUUAGGACGACCCGCCA | 10 | 20 | Scaffold_5: 515832...515871: + |
abi_milRNA_6a | GGCGAGAUGGCCGAGUGGUCU | 48 | 21 | Scaffold_7: 612160...612226: − |
miRPlant | ||||
Name | Sequence 5′→3′ | Reads | L | Pre-miRNA Position |
abi_milRNA_7a | GGUUGCGUCGGGGAACCAGGACU | 62,926 | 23 | Ch9(+): 1609844...1610066 |
abi_milRNA_8a_1 | GGCCGACUAGCUCAGUUGGU | 9443 | 20 | Ch8(−): 1458375...1458557 |
abi_milRNA_8a_2 | GGCCGACUAGCUCAGUUGGU | 9429 | 20 | Ch12(+): 1449317...1449402 |
abi_milRNA_9a | UCUCUGUUAGUAUAUCGGU | 7428 | 19 | Ch13(−): 409450...409650 |
abi_milRNA_9b | UCUCUGUUAGUAUAUCGGUUAGU | 1580 | 24 | Ch1(+): 595123...595304 |
abi_milRNA_10a | UUUUCCUGUGAAGCAUGUUCU | 3570 | 21 | Ch7(−): 2126076...2126293 |
abi_milRNA_11a | UCGACUGUUGUAUCCUUUGCA | 1784 | 21 | Ch7(−): 577587...577706 |
abi_milRNA_12a_1 | CCGACCUUAGCUCAGUUGGAAGA | 1301 | 23 | Ch5(+): 1529471...1529665 |
abi_milRNA_12a_2 | CCGACCUUAGCUCAGUUGGAAGA | 314 | 23 | Ch9(+): 1638595...1638793 |
abi_milRNA_12a_3 | CCGACCUUAGCUCAGUUGGAAGA | 1782 | 23 | Ch5(+): 1529623...1529826 |
abi_milRNA_12a_4 | CCGACCUUAGCUCAGUUGGAAGA | 1781 | 23 | Ch12(−): 118842...118950 |
abi_milRNA_12a_5 | CCGACCUUAGCUCAGUUGGAAGA | 1781 | 23 | Ch7(+): 1669558...1669699 |
abi_milRNA_13a_1 | CUAGUGGUUAUGAUUUCUGUCU | 1073 | 22 | Ch10(+): 317766...317943 |
abi_milRNA_13a_2 | CUAGUGGUUAUGAUUUCUGUCU | 832 | 22 | Ch10(+): 206312...206533 |
abi_milRNA_13a_3 | CUAGUGGUUAUGAUUUCUGUCU | 832 | 22 | Ch10(−): 208566..208671 |
abi_milRNA_13a_4 | CUAGUGGUUAUGAUUUCUGUCU | 1040 | 22 | Ch10(+): 206312...206533 |
abi_milRNA_14a | UUAGUGGUUAGAUCAUCUCGUU | 1001 | 22 | Ch12(−): 153917...154009 |
abi_milRNA_15a | GUGUAGUGGUUAUCACUCGGGAUU | 593 | 24 | Ch7(−): 874207...874386 |
abi_milRNA_16a | UAAGCCCUUGUUCUAUAGAUUUGU | 627 | 24 | Ch9(+): 1685049...1685150 |
abi_milRNA_17a | GGGUAGUGGUAACCUGGGUCGUUG | 431 | 24 | Ch12(−): 301528...301656 |
abi_milRNA_18a_1 | UCGGAACCCGCUAAGGAGUGUG | 335 | 22 | Ch9(+): 1655122...1655321 |
abi_milRNA_18a_2 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1604213...1604411 |
abi_milRNA_18a_3 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1612977..1613175 |
abi_milRNA_18a_4 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1621357...1621555 |
abi_milRNA_18a_5 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1630532...1630730 |
abi_milRNA_18a_6 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1638595...1638793 |
abi_milRNA_18a_7 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1665017...1665215 |
abi_milRNA_18a_8 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1672337...1672535 |
abi_milRNA_18a_9 | UCGGAACCCGCUAAGGAGUGUG | 314 | 22 | Ch9(+): 1682088...1682286 |
abi_milRNA_19a | ACACUGACAGAGCCAGCGAGUUUU | 191 | 24 | Ch9(+): 1628437..1628530 |
abi_milRNA_20a_1 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1668929...1669062 |
abi_milRNA_20a_2 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1617899...1168030 |
abi_milRNA_20a_3 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1627076...1627207 |
abi_milRNA_20a_4 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1650974...1651105 |
abi_milRNA_20a_5 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1659680...1659791 |
abi_milRNA_20a_6 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1661558...1661689 |
abi_milRNA_20a_7 | UAUAGUUUAUUUGAUGAUACCU | 186 | 22 | Ch9(+): 1678625...1678756 |
abi_milRNA_21a | GUGUAGCGGUAACAUUGGGUCUU | 80 | 23 | Ch5(+): 727119...727291 |
abi_milRNA_22a | UUGCCCGACCAUGUAGCCUU | 74 | 20 | Ch2(−): 427069...427198 |
abi_milRNA_23a | GUCACUUUGCCGGAGUGGUUAAC | 70 | 23 | Ch3(+): 2279394...2279576 |
abi_milRNA_24a | CACCACGGACGGUCUGUAGCUCCU | 68 | 24 | Ch13(+): 1171206...1171324 |
abi_milRNA_25a | GCUGGGACUGCUGUGGUU | 30 | 18 | Ch1(−): 3410229...3410399 |
abi_milRNA_26a | UGUGAUCUGGAUUGGAACAUUC | 27 | 22 | Ch1(+): 2058804...2058899 |
abi_milRNA_27a | GGACCCCUAGCUCAGUGG | 20 | 18 | Ch2(−): 9192...9296 |
abi_milRNA_27b | GGACCCCUAGCUCAGUGGUAGA | 13 | 22 | Ch2(−): 9255...9354 |
abi_milRNA_28a | UGUGGUCAUCUUAGAGCUCACU | 20 | 22 | Ch2(+): 2696324...2696545 |
abi_milRNA_29a_1 | UUACGUGGCUCAAGGGUUAAG | 15 | 21 | Ch2(+): 347744...347918 |
abi_milRNA_29a_2 | UUACGUGGCUCAAGGGUUAAG | 11 | 21 | Ch2(+): 347878...347959 |
abi_milRNA_30a | AGUGGACUUGGCAUGCGAGAGGUU | 15 | 24 | Ch12(+): 530586...530694 |
abi_milRNA_31a | UGCCUUCAUUGGAUCGUGCU | 15 | 20 | Ch3(−): 1354888...1354997 |
abi_milRNA_32a | GCUGUACUCAUUUCUGUAU | 12 | 19 | Ch2(−): 2797465...2797543 |
abi_milRNA_33a_1 | CCAAACGAUCUAAUCCAGAACU | 11 | 22 | Ch4(−): 63633...63729 |
abi_milRNA_33a_2 | CCAAACGAUCUAAUCCAGAACU | 10 | 22 | Ch4(−): 63688...63909 |
abi_milRNA_34a | UAUAGUACUAAGAGCUUGAGAGU | 10 | 23 | Ch9(+): 1090217...1090326 |
abi_milRNA_35a | UAUCGACGUACACUUAUUGGU | 10 | 21 | Ch10(+): 127320...127540 |
abi_milRNA_36a | CGAUCGGCGAUAUCGAGACUA | 9 | 21 | Ch7(−): 69025...69107 |
abi_milRNA_37a | GCUAGCGUGCUUACUACUGUA | 7 | 21 | Ch4(+): 1307833...1307940 |
miRNA Source | miRNAs with Experimental Evidence | miRNAs Sharing an Ancestor | Reference |
---|---|---|---|
Agaricus bisporus | abi_milRNA_2a | abi_milRNA_31a | Present work |
Agaricus bisporus | abi_milRNA_1a | abi_milRNA_25a, pos_milRNA_6a | Present work |
Fusarium oxysporum | fox_milRNA_2a | abi_milRNA_6a abi_milRNA_17a | [16] |
Fusarium oxysporum | fox_milRNA_5 | pos_milRNA_5a | [16] |
Penicillium marneffei | PM_milR_M1 | abi_milRNA_22a | [15] |
Penicillium marneffei | PM_milR_M2 | abi_milRNA_26a | [15] |
Agaricus bisporus | Homo sapiens | ||||
---|---|---|---|---|---|
Regulated Pathway | Genes | KEGG Code | Regulated Pathway | Genes | KEGG Code |
Metabolic pathways | 304 | abv01100 | Metabolic pathways | 91 | hsa01100 |
Biosynthesis of secondary metabolites | 124 | abv01110 | Pathways in cancer | 51 | hsa05200 |
Biosynthesis of cofactors | 50 | abv01240 | Herpes simplex virus 1 infection | 39 | hsa05168 |
Cell cycle | 40 | abv04111 | Pathways of neurodegeneration—multiple diseases | 38 | hsa05022 |
Carbon metabolism | 35 | abv01200 | Human papillomavirus infection | 31 | hsa05165 |
Autophagy | 33 | abv04138 | MAPK signaling pathway | 30 | hsa04010 |
MAPK signaling pathway | 32 | abv04011 | PI3K–Akt signaling pathway | 25 | hsa04151 |
Protein processing in endoplasmic reticulum | 32 | abv04141 | Endocytosis | 25 | hsa04144 |
Nucleocytoplasmic transport | 31 | abv03013 | Salmonella infection | 25 | hsa05132 |
Spliceosome | 31 | abv03040 | Shigellosis | 24 | hsa05132 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marin, F.R.; Dávalos, A.; Kiltschewskij, D.; Crespo, M.C.; Cairns, M.; Andrés-León, E.; Soler-Rivas, C. RNA-Seq, Bioinformatic Identification of Potential MicroRNA-like Small RNAs in the Edible Mushroom Agaricus bisporus and Experimental Approach for Their Validation. Int. J. Mol. Sci. 2022, 23, 4923. https://doi.org/10.3390/ijms23094923
Marin FR, Dávalos A, Kiltschewskij D, Crespo MC, Cairns M, Andrés-León E, Soler-Rivas C. RNA-Seq, Bioinformatic Identification of Potential MicroRNA-like Small RNAs in the Edible Mushroom Agaricus bisporus and Experimental Approach for Their Validation. International Journal of Molecular Sciences. 2022; 23(9):4923. https://doi.org/10.3390/ijms23094923
Chicago/Turabian StyleMarin, Francisco R., Alberto Dávalos, Dylan Kiltschewskij, Maria C. Crespo, Murray Cairns, Eduardo Andrés-León, and Cristina Soler-Rivas. 2022. "RNA-Seq, Bioinformatic Identification of Potential MicroRNA-like Small RNAs in the Edible Mushroom Agaricus bisporus and Experimental Approach for Their Validation" International Journal of Molecular Sciences 23, no. 9: 4923. https://doi.org/10.3390/ijms23094923