Hydrogen Sulfide Alleviates Manganese Stress in Arabidopsis
Abstract
:1. Introduction
2. Results
2.1. Effects of Mn Stress on H2S Content, AtLCD Enzyme Activity, and Gene Expression in Arabidopsis Seedlings
2.2. Effects of H2S on Phenotype and Growth of Arabidopsis under Mn Stress
2.3. Effects on the Phenotype of lcd and OELCD Lines under Mn Stress
2.4. Effects on Mn Transporter-Related Gene Expression in Roots of lcd and OELCD under Mn Stress
2.5. Effects on Reactive Oxygen Species Content of Arabidopsis Seedlings under Mn Stress
2.6. Effects on Antioxidant Enzyme Activity of lcd and OELCD under Mn Stress
3. Discussion
4. Materials and Methods
4.1. Experimental Materials
4.2. Material Constructs, Cultivation, and Treatment
4.3. Detection of the Growth Indicators
4.4. Determination of H2S-Related Indicators
4.5. Determination of Physiological Indicators
4.6. Hematoxylin Staining
4.7. Detection of Mn Content
4.8. RNA Extraction and qRT-PCR
4.9. Statistical Methodology
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviation
APX | Ascorbate peroxidase |
CAT | Catalase |
DAB | 3, 3′-diaminobenzidine |
H2S | Hydrogen sulfide |
L-cysteine desulfhydrase | LCD |
NaHS | Sodium hydrosulfide |
Mn | Manganese |
NBT | Nitrogen-blue tetrazolium |
POD | Peroxides |
ROS | Reactive oxygen species |
SOD | Super oxide dismutase |
References
- You, X.; Yang, L.T.; Lu, Y.B.; Li, H.; Zhang, S.Q.; Chen, L.S. Proteomic changes of Citrus roots in response to long-term manganese toxicity. Trees-Struct. Funct. 2014, 28, 1383–1399. [Google Scholar] [CrossRef]
- Pittman, J.K. Managing the manganese: Molecular mechanisms of manganese transport and homeostasis. New Phytol. 2005, 167, 733–742. [Google Scholar] [CrossRef] [PubMed]
- Niu, L.; Yang, F.; Xu, C.; Yang, H.; Liu, W. Status of metal accumulation in farmland soils across China: From distribution to risk assessment. Environ. Pollut. 2013, 176, 55–62. [Google Scholar] [CrossRef] [PubMed]
- Xue, S.; Zhu, F.; Kong, X.; Wu, C.; Huang, L.; Huang, N.; Hartley, W. A review of the characterization and revegetation of bauxite residues (Red mud). Environ. Sci. Pollut. R. 2016, 23, 1120–1132. [Google Scholar] [CrossRef]
- Weng, X.Y.; Zhao, L.L.; Zheng, C.J.; Zhu, J.W. Characteristics of the hyperaccumulator plant Phytolacca acinosa (Phytolaccaceae) in response to excess manganese. J. Plant Nutr. 2013, 36, 1355–1365. [Google Scholar] [CrossRef]
- Shi, Q.; Zhu, Z.; Xu, M.; Qian, Q.; Yu, J. Effect of excess manganese on the antioxidant system in Cucumis sativus L. under two light intensities. Environ. Exp. Bot. 2006, 58, 197–205. [Google Scholar] [CrossRef]
- Millaleo, R.; Reyes-Díaz, M.; Ivanov, A.G.; Mora, M.L.; Alberdi, M. Manganese as essential and toxic element for plants: Transport, accumulation and resistance mechanisms. J. Soil Sci. Plant Nutr. 2010, 10, 476–494. [Google Scholar] [CrossRef] [Green Version]
- Aroca, A.; Benito, J.M.; Gotor, C.; Romero, L.C. Persulfidation proteome reveals the regulation of protein function by hydrogen sulfide in diverse biological processes in Arabidopsis. J. Exp. Bot. 2017, 68, 4915–4927. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Jia, Y.; Dong, R.; Huang, R.; Liu, P.; Li, X.; Wang, Z.; Liu, G.; Chen, Z. Advances in the mechanisms of plant tolerance to manganese toxicity. Int. J. Mol. Sci. 2019, 20, 5096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilson, L.G.; Bressan, R.A.; Filner, P. Light-dependent emission of hydrogen sulfide from plants. Plant Physiol. 1978, 61, 184–189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rennenberg, H.; Arabatzis, N.; Grundel, I. Cysteine desulphydrase activity in higher plants: Evidence for the action of L- and D-cysteine specific enzymes. Phytochemistry 1987, 26, 1583–1589. [Google Scholar] [CrossRef]
- Jin, Z.; Pei, Y. Physiological implications of hydrogen sulfide in plants: Pleasant exploration behind its unpleasant odour. Oxid. Med. Cell Longev. 2015, 2015, 397502. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Wu, F.H.; Wang, W.H.; Zheng, C.J.; Lin, G.H.; Dong, X.J.; He, J.X.; Pei, Z.M.; Zheng, H.L. Hydrogen sulphide enhances photosynthesis through promoting chloroplast biogenesis, photosynthetic enzyme expression, and thiol redox modification in Spinacia oleracea seedlings. J. Exp. Bot. 2011, 62, 4481–4493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; Hu, S.L.; Zhang, Z.J.; Hu, L.Y.; Jiang, C.X.; Wei, Z.J.; Liu, J.; Wang, H.L.; Jiang, S.T. Hydrogen sulfide acts as a regulator of flower senescence in plants. Postharvest Biol. Tec. 2011, 60, 251–257. [Google Scholar] [CrossRef]
- Fang, H.; Jing, T.; Liu, Z.; Zhang, L.; Jin, Z.; Pei, Y. Hydrogen sulfide interacts with calcium signaling to enhance the chromium tolerance in Setaria italica. Cell Calcium 2014, 56, 472–481. [Google Scholar] [CrossRef]
- Fang, H.; Liu, Z.; Long, Y.; Liang, Y.; Jin, Z.; Zhang, L.; Liu, D.; Li, H.; Zhai, J.; Pei, Y. The Ca2+/calmodulin2-binding transcription factor TGA3 elevates LCD expression and H2S production to bolster Cr6+ tolerance in Arabidopsis. Plant J. 2017, 91, 1038–1050. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Fang, H.; Pei, Y.; Jin, Z.; Zhang, L.; Liu, D. WRKY transcription factors down-regulate the expression of H2S-generating genes, LCD and DES in Arabidopsis thaliana. Sci. Bull. 2015, 60, 995–1001. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Tan, Z.Q.; Hu, L.Y.; Wang, S.H.; Luo, J.P.; Jones, R.L. Hydrogen sulfide alleviates aluminum toxicity in germinating wheat seedlings. J. Integr. Plant Biol. 2010, 52, 556–567. [Google Scholar] [CrossRef]
- Dawood, M.; Cao, F.; Jahangir, M.M.; Zhang, G.; Wu, F. Alleviation of aluminum toxicity by hydrogen sulfide is related to elevated ATPase, and suppressed aluminum uptake and oxidative stress in barley. J. Hazard Mater. 2012, 209–210, 121–128. [Google Scholar] [CrossRef]
- Singh, V.P.; Singh, S.; Kumar, J.; Prasad, S.M. Hydrogen sulfide alleviates toxic effects of arsenate in pea seedlings through up-regulation of the ascorbate-glutathione cycle: Possible involvement of nitric oxide. J. Plant Physiol. 2015, 181, 20–29. [Google Scholar] [CrossRef]
- Fang, H.; Liu, Z.; Jin, Z.; Zhang, L.; Liu, D.; Pei, Y. An emphasis of hydrogen sulfide-cysteine cycle on enhancing the tolerance to chromium stress in Arabidopsis. Environ. Pollut. 2016, 213, 870–877. [Google Scholar] [CrossRef] [PubMed]
- Ownby, J.D. Mechanisms of reaction of hematoxylin with aluminium-treated wheat roots. Physiol. Plantarum. 1993, 87, 371–380. [Google Scholar] [CrossRef]
- Baldisserotto, C.; Ferroni, L.; Anfuso, E.; Pagnoni, A.; Fasulo, M.P.; Pancaldi, S. Responses of Trapa natans L. floating laminae to high concentrations of manganese. Protoplasma 2007, 231, 65–82. [Google Scholar] [CrossRef]
- Fang, T.; Cao, Z.; Li, J.; Shen, W.; Huang, L. Auxin-induced hydrogen sulfide generation is involved in lateral root formation in tomato. Plant Physiol. Biochem. 2014, 76, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Li, Z. Analysis of some enzymes activities of hydrogen sulfide metabolism in plants. Methods Enzymol. 2015, 555, 253–269. [Google Scholar]
- Yang, S.; Yi, K.; Chang, M.M.; Ling, G.Z.; Zhao, Z.K.; Li, X.F. Sequestration of Mn into the cell wall contributes to Mn tolerance in sugarcane (Saccharum officinarum L.). Plant Soil 2019, 436, 475–487. [Google Scholar] [CrossRef]
- Shao, J.F.; Yamaji, N.; Shen, R.F.; Ma, J.F. The key to Mn homeostasis in plants: Regulation of Mn transporters. Trends Plant Sci. 2017, 22, 215–224. [Google Scholar] [CrossRef]
- Hirschi, K.D.; Korenkov, V.D.; Wilganowski, N.L.; Wagner, G.J. Expression of Arabidopsis CAX2 in tobacco. Altered metal accumulation and increased manganese tolerance. Plant Physiol. 2000, 124, 125–133. [Google Scholar] [CrossRef] [Green Version]
- Wu, Z.; Liang, F.; Hong, B.; Young, J.C.; Sussman, M.R.; Harper, J.F.; Sze, H. An endoplasmic reticulum-bound Ca2+/Mn2+ pump, ECA1, supports plant growth and confers tolerance to Mn2+ Stress. Plant Physiol. 2002, 130, 128–137. [Google Scholar] [CrossRef] [Green Version]
- Montanini, B.; Blaudez, D.; Jeandroz, S.; Sanders, D.; Chalot, M. Phylogenetic and functional analysis of the Cation Diffusion Facilitator (CDF) family: Improved signature and prediction of substrate specificity. BMC Genom. 2007, 8, 107–116. [Google Scholar] [CrossRef] [Green Version]
- Delhaize, E.; Gruber, B.D.; Pittman, J.K.; White, R.G.; Leung, H.; Miao, Y.; Jiang, L.; Ryan, P.R.; Richardson, A.E. A role for the AtMTP11 gene of Arabidopsis in manganese transport and tolerance. Plant J 2007, 51, 198–210. [Google Scholar] [CrossRef] [PubMed]
- Emamverdian, A.; Ding, Y.; Mokhberdoran, F.; Xie, Y. Heavy metal stress and some mechanisms of plant defense response. Scientific World J. 2015, 2015, 756120. [Google Scholar] [CrossRef] [PubMed]
- He, H.; Li, Y.; He, L. The central role of hydrogen sulfide in plant responses to toxic metal stress. Ecotoxicol Environ. Saf. 2018, 157, 403–408. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Chen, M.; Jiang, M. Hydrogen sulfide alleviates mercury toxicity by sequestering it in roots or regulating reactive oxygen species productions in rice seedlings. Plant Physiol. Biochem. 2017, 111, 179–192. [Google Scholar] [CrossRef] [PubMed]
- Jia, H.; Wang, X.; Dou, Y.; Liu, D.; Si, W.; Fang, H.; Zhao, C.; Chen, S.; Xi, J.; Li, J. Hydrogen sulfide-cysteine cycle system enhances cadmium tolerance through alleviating cadmium-induced oxidative stress and ion toxicity in Arabidopsis roots. Sci. Rep. 2016, 6, 39702. [Google Scholar] [CrossRef]
- Jia, H.; Yang, J.; Liu, H.; Liu, K.; Ma, P.; Chen, S.; Shi, W.; Wei, T.; Ren, X.; Guo, J.; et al. Hydrogen sulfide—Cysteine cycle plays a positive role in Arabidopsis responses to copper oxide nanoparticles stress. Environ. Exp. Bot. 2018, 155, 195–205. [Google Scholar] [CrossRef]
- Ge, S.N.; Zhao, M.M.; Wu, D.D.; Chen, Y.; Wang, Y.; Zhu, J.H.; Cai, W.J.; Zhu, Y.Z.; Zhu, Y.C. Hydrogen sulfide targets EGFR Cys797/Cys798 residues to induce Na+/K+-ATPase endocytosis and inhibition in renal tubular epithelial cells and increase sodium excretion in chronic salt-loaded rats. Antioxid Redox Signal 2014, 21, 2061–2082. [Google Scholar] [CrossRef] [Green Version]
- Jia, H.; Chen, S.; Liu, D.; Liesche, J.; Shi, C.; Wang, J.; Ren, M.; Wang, X.; Yang, J.; Shi, W.; et al. Ethylene-induced hydrogen sulfide negatively regulates ethylene biosynthesis by persulfidation of ACO in tomato under osmotic stress. Front. Plant Sci. 2018, 871, 1517. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Jia, H.; Wang, X.; Shi, C.; Wang, X.; Ma, P.; Wang, J.; Ren, M.; Li, J. Hydrogen sulfide positively regulates abscisic acid signaling through persulfidation of SnRK2.6 in guard cells. Mol. Plant 2020, 13, 732–744. [Google Scholar] [CrossRef]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
- Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic Biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar]
- Li, Z.G. Quantification of hydrogen sulfide concentration using methylene blue and 5,5′-dithiobis(2-nitrobenzoic acid) methods in plants. Methods Enzymol. 2015, 554, 101–110. [Google Scholar] [PubMed]
- Riemenschneider, A.; Nikiforova, V.; Hoefgen, R.; De Kok, L.J.; Papenbrock, J. Impact of elevated H2S on metabolite levels, activity of enzymes and expression of genes involved in cysteine metabolism. Plant Physiol. Biochem. 2005, 43, 473–483. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Zhong, M.; He, L.; Wang, B.; Liu, Q.; Pan, Y.; Jiang, B.; Zhang, L. Overexpression of a chrysanthemum transcription factor gene DgNAC1 improves drought tolerance in chrysanthemum. Plant Cell Tiss. Org. 2018, 135, 119–132. [Google Scholar] [CrossRef]
- He, F.; Sheng, M.; Tang, M. Effects of rhizophagus irregularis on photosynthesis and antioxidative enzymatic system in robinia pseudoacacia L. under drought stress. Front. Plant Sci. 2017, 8, 183. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.; Qiu, Y.; Hu, Y.; Yu, D. Heterologous expression of at WRKY57 confers drought tolerance in oryza sativa. Front. Plant Sci. 2016, 7, 145. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Primers’ Sequences (5′-3′) |
---|---|
AtActin | FP: GGTAACATTGTGCTCAGTGG |
RP: CACGACCTTAATCTTCATGC | |
AtLCD | FP: TGTATGTGAGGAGGAGGC |
RP: GTTTCATACTGATGCTGCTC | |
AtNramp1 | FP: GCTGGACAATATGTAATGCAGG |
RP: CACCGATGAGAGCAACAATTAG | |
AtCAX2 | FP: GCCTCTTAAATGCTACATTCGG |
RP: TCCTTTGTCAAAGACTTGGTCT | |
AtECA1 | FP: GTACACACACAGTAGCTTCATG |
RP: GTTTGAGTCGAACGAGAAAGTC | |
AtMTP11 | FP: CAATACGGACATGGTCAATGAC |
RP: AATGAGAGCCAAATGTGTATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, L.; Wang, Z.; Gong, G.; Zhu, Y.; Ye, Q.; Lu, S.; Liu, X. Hydrogen Sulfide Alleviates Manganese Stress in Arabidopsis. Int. J. Mol. Sci. 2022, 23, 5046. https://doi.org/10.3390/ijms23095046
Hou L, Wang Z, Gong G, Zhu Y, Ye Q, Lu S, Liu X. Hydrogen Sulfide Alleviates Manganese Stress in Arabidopsis. International Journal of Molecular Sciences. 2022; 23(9):5046. https://doi.org/10.3390/ijms23095046
Chicago/Turabian StyleHou, Lixia, Zhaoxia Wang, Guangxia Gong, Ying Zhu, Qing Ye, Songchong Lu, and Xin Liu. 2022. "Hydrogen Sulfide Alleviates Manganese Stress in Arabidopsis" International Journal of Molecular Sciences 23, no. 9: 5046. https://doi.org/10.3390/ijms23095046