Deficiency of Adipose Triglyceride Lipase Induces Metabolic Syndrome and Cardiomyopathy in Zebrafish
Abstract
:1. Introduction
2. Results
2.1. Generation of Atgl Multiple Depletions Lines in Zebrafish
2.1.1. Generation of Transgenic Global Cas9 Expression Lines in Zebrafish
2.1.2. Generation of 4X-gRNAatgl Transgenic Line in Zebrafish
2.1.3. Combination of Global Cas9 and 4X-gRNAatgl Compound Transgenic Line and Successfully Disrupted Atgl Locus in Zebrafish
2.2. Depletion of Atgl Lead a Metabolic Imbalance in Zebrafish Larvae
2.3. ALKO Adults Developed Metabolic Syndrome
2.4. Defective Atgl Enlarged the Ventricle Size in Zebrafish
2.5. Hypertrophic Heart in ALKO Adults due to Activated Immune Response
2.6. Atgl Ablation Led Myocardial Remodeling Contributed to Cardiac Dysfunction in Zebrafish
3. Discussion
4. Materials and Methods
4.1. Generation and Maintenance of Atgl Mutant Zebrafish
4.2. In Situ Hybridization
4.3. Whole-Mount Oil Red O Staining
4.4. Blood Analysis
4.5. Histology
4.6. RT-qPCR
4.7. Morphology Analysis of Heart Function
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
ATGL | Adipose triglyceride lipase |
ALKO | Atgl knockout |
CM | Cardiomyopathy |
gRNAs | guide RNAs |
PGC1 | peroxisome proliferator-activated receptor gamma cofactor 1 |
DCM | dilated cardiomyopathy |
TTNtv | titins |
Cmlc2 | cardiac myosin light chain 2 |
Indel | Insertion/deletion |
dpf | days post-fertilization |
hpf | h post-fertilization |
mpf | month post- fertilization |
ppar-γ | peroxisome proliferator-activated receptor gamma |
srebp | sterol regulatory element binding transcription factor |
fasn | fatty acid synthase |
acaca | acetyl-CoA carboxylase alpha |
chrebp | carbohydrate-responsive element-binding protein |
myh7l | myosin heavy chain 7-like |
actc1b | actin alpha cardiac muscle 1b |
mybpc3 | myosin binding protein C3 |
tnnt2a | troponin T type 2a |
il | interleukin |
tnf-α | tumor necrosis factor-alpha |
nf-kb | nuclear factor-kappa B |
tpm4b | tropomyosin 4-2 |
atp2a2b | ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2b |
EDD | end-diastolic diameter |
ESD | end-systolic diameter |
FS | fraction shortening |
H&E | hematoxylin and eosin |
ANOVA | analysis of variance |
References
- Poirier, P.; Alpert, M.A.; Fleisher, L.A.; Thompson, P.D.; Sugerman, H.J.; Burke, L.E.; Marceau, P.; Franklin, B.A.; American Heart Association Obesity Committee of Council on Nutrition, Physical Activity and Metabolism; Council on Cardiopulmonary Perioperative and Critical Care, Council on Cardiovascular Surgery and Anesthesia; et al. Cardiovascular evaluation and management of severely obese patients undergoing surgery: A science advisory from the American Heart Association. Circulation 2009, 120, 86–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lavie, C.J.; Sharma, A.; Alpert, M.A.; De Schutter, A.; Lopez-Jimenez, F.; Milani, R.V.; Ventura, H.O. Update on Obesity and Obesity Paradox in Heart Failure. Prog. Cardiovasc. Dis. 2016, 58, 393–400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caprio, S.; Santoro, N.; Weiss, R. Childhood obesity and the associated rise in cardiometabolic complications. Nat. Metab. 2020, 2, 223–232. [Google Scholar] [CrossRef] [PubMed]
- Lionetti, V.; Stanley, W.C.; Recchia, F.A. Modulating fatty acid oxidation in heart failure. Cardiovasc. Res. 2011, 90, 202–209. [Google Scholar] [CrossRef]
- Song, Y.; Song, F.; Wu, C.; Hong, Y.X.; Li, G. The roles of epicardial adipose tissue in heart failure. Heart Fail. Rev. 2022, 27, 369–377. [Google Scholar] [CrossRef]
- Stephens, J.M.; Lee, J.; Pilch, P.F. Tumor necrosis factor-alpha-induced insulin resistance in 3T3-L1 adipocytes is accompanied by a loss of insulin receptor substrate-1 and GLUT4 expression without a loss of insulin receptor-mediated signal transduction. J. Biol. Chem. 1997, 272, 971–976. [Google Scholar] [CrossRef] [Green Version]
- Baffy, G. Kupffer cells in non-alcoholic fatty liver disease: The emerging view. J. Hepatol. 2009, 51, 212–223. [Google Scholar] [CrossRef] [Green Version]
- Radovic, B.; Aflaki, E.; Kratky, D. Adipose triglyceride lipase in immune response, inflammation, and atherosclerosis. Biol. Chem. 2012, 393, 1005–1011. [Google Scholar] [CrossRef] [Green Version]
- Palomer, X.; Salvado, L.; Barroso, E.; Vazquez-Carrera, M. An overview of the crosstalk between inflammatory processes and metabolic dysregulation during diabetic cardiomyopathy. Int. J. Cardiol. 2013, 168, 3160–3172. [Google Scholar] [CrossRef]
- Nishida, K.; Otsu, K. Inflammation and metabolic cardiomyopathy. Cardiovasc. Res. 2017, 113, 389–398. [Google Scholar] [CrossRef]
- Zimmermann, R.; Strauss, J.G.; Haemmerle, G.; Schoiswohl, G.; Birner-Gruenberger, R.; Riederer, M.; Lass, A.; Neuberger, G.; Eisenhaber, F.; Hermetter, A.; et al. Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 2004, 306, 1383–1386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haemmerle, G.; Lass, A.; Zimmermann, R.; Gorkiewicz, G.; Meyer, C.; Rozman, J.; Heldmaier, G.; Maier, R.; Theussl, C.; Eder, S.; et al. Defective lipolysis and altered energy metabolism in mice lacking adipose triglyceride lipase. Science 2006, 312, 734–737. [Google Scholar] [CrossRef] [PubMed]
- Foryst-Ludwig, A.; Kreissl, M.C.; Benz, V.; Brix, S.; Smeir, E.; Ban, Z.; Januszewicz, E.; Salatzki, J.; Grune, J.; Schwanstecher, A.K.; et al. Adipose Tissue Lipolysis Promotes Exercise-induced Cardiac Hypertrophy Involving the Lipokine C16:1n7-Palmitoleate. J. Biol. Chem. 2015, 290, 23603–23615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schweiger, M.; Schoiswohl, G.; Lass, A.; Radner, F.P.; Haemmerle, G.; Malli, R.; Graier, W.; Cornaciu, I.; Oberer, M.; Salvayre, R.; et al. The C-terminal region of human adipose triglyceride lipase affects enzyme activity and lipid droplet binding. J. Biol. Chem. 2008, 283, 17211–17220. [Google Scholar] [CrossRef] [Green Version]
- Duncan, R.E.; Wang, Y.; Ahmadian, M.; Lu, J.; Sarkadi-Nagy, E.; Sul, H.S. Characterization of desnutrin functional domains: Critical residues for triacylglycerol hydrolysis in cultured cells. J. Lipid Res. 2010, 51, 309–317. [Google Scholar] [CrossRef] [Green Version]
- Haemmerle, G.; Moustafa, T.; Woelkart, G.; Buttner, S.; Schmidt, A.; van de Weijer, T.; Hesselink, M.; Jaeger, D.; Kienesberger, P.C.; Zierler, K.; et al. ATGL-mediated fat catabolism regulates cardiac mitochondrial function via PPAR-alpha and PGC-1. Nat. Med. 2011, 17, 1076–1085. [Google Scholar] [CrossRef] [Green Version]
- Diop, S.B.; Bisharat-Kernizan, J.; Birse, R.T.; Oldham, S.; Ocorr, K.; Bodmer, R. PGC-1/Spargel Counteracts High-Fat-Diet-Induced Obesity and Cardiac Lipotoxicity Downstream of TOR and Brummer ATGL Lipase. Cell Rep. 2015, 10, 1572–1584. [Google Scholar] [CrossRef] [Green Version]
- Kintscher, U.; Foryst-Ludwig, A.; Haemmerle, G.; Zechner, R. The Role of Adipose Triglyceride Lipase and Cytosolic Lipolysis in Cardiac Function and Heart Failure. Cell Rep. Med. 2020, 1, 100001. [Google Scholar] [CrossRef]
- Coassin, S.; Schweiger, M.; Kloss-Brandstatter, A.; Lamina, C.; Haun, M.; Erhart, G.; Paulweber, B.; Rahman, Y.; Olpin, S.; Wolinski, H.; et al. Investigation and functional characterization of rare genetic variants in the adipose triglyceride lipase in a large healthy working population. PLoS Genet. 2010, 6, e1001239. [Google Scholar] [CrossRef] [Green Version]
- Wolkart, G.; Schrammel, A.; Dorffel, K.; Haemmerle, G.; Zechner, R.; Mayer, B. Cardiac dysfunction in adipose triglyceride lipase deficiency: Treatment with a PPARalpha agonist. Br. J. Pharmacol. 2012, 165, 380–389. [Google Scholar] [CrossRef]
- Missaglia, S.; Maggi, L.; Mora, M.; Gibertini, S.; Blasevich, F.; Agostoni, P.; Moro, L.; Cassandrini, D.; Santorelli, F.M.; Gerevini, S.; et al. Late onset of neutral lipid storage disease due to novel PNPLA2 mutations causing total loss of lipase activity in a patient with myopathy and slight cardiac involvement. Neuromuscul. Disord. 2017, 27, 481–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, Y.; Sun, X.; Huang, W.; Hoage, T.; Redfield, M.; Kushwaha, S.; Sivasubbu, S.; Lin, X.; Ekker, S.; Xu, X. Haploinsufficiency of target of rapamycin attenuates cardiomyopathies in adult zebrafish. Circ. Res. 2011, 109, 658–669. [Google Scholar] [CrossRef] [PubMed]
- Kossack, M.; Hein, S.; Juergensen, L.; Siragusa, M.; Benz, A.; Katus, H.A.; Most, P.; Hassel, D. Induction of cardiac dysfunction in developing and adult zebrafish by chronic isoproterenol stimulation. J. Mol. Cell. Cardiol. 2017, 108, 95–105. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Ding, Y.; Wang, Y.; Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. J. Vis. Exp. 2018, 138, e57567. [Google Scholar] [CrossRef] [PubMed]
- Hassel, D.; Dahme, T.; Erdmann, J.; Meder, B.; Huge, A.; Stoll, M.; Just, S.; Hess, A.; Ehlermann, P.; Weichenhan, D.; et al. Nexilin mutations destabilize cardiac Z-disks and lead to dilated cardiomyopathy. Nat. Med. 2009, 15, 1281–1288. [Google Scholar] [CrossRef] [PubMed]
- Orr, N.; Arnaout, R.; Gula, L.J.; Spears, D.A.; Leong-Sit, P.; Li, Q.; Tarhuni, W.; Reischauer, S.; Chauhan, V.S.; Borkovich, M.; et al. A mutation in the atrial-specific myosin light chain gene (MYL4) causes familial atrial fibrillation. Nat. Commun. 2016, 7, 11303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamel, S.M.; Koopman, C.D.; Kruse, F.; Willekers, S.; Chocron, S.; Bakkers, J. A Heterozygous Mutation in Cardiac Troponin T Promotes Ca(2+) Dysregulation and Adult Cardiomyopathy in Zebrafish. J. Cardiovasc. Dev. Dis. 2021, 8, 46. [Google Scholar] [CrossRef]
- Gu, G.; Na, Y.; Chung, H.; Seok, S.H.; Lee, H.Y. Zebrafish Larvae Model of Dilated Cardiomyopathy Induced by Terfenadine. Korean Circ. J. 2017, 47, 960–969. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; He, X.; Yao, S.; Lin, T.; Zhang, L.; Chen, D.; Chen, C.; Yang, Q.; Li, F.; Zhu, Y.M.; et al. Ablation of Mto1 in zebrafish exhibited hypertrophic cardiomyopathy manifested by mitochondrion RNA maturation deficiency. Nucleic Acids Res. 2021, 49, 4689–4704. [Google Scholar] [CrossRef]
- Huttner, I.G.; Wang, L.W.; Santiago, C.F.; Horvat, C.; Johnson, R.; Cheng, D.; von Frieling-Salewsky, M.; Hillcoat, K.; Bemand, T.J.; Trivedi, G.; et al. A-Band Titin Truncation in Zebrafish Causes Dilated Cardiomyopathy and Hemodynamic Stress Intolerance. Circ. Genom. Precis. Med. 2018, 11, e002135. [Google Scholar] [CrossRef]
- Schlegel, A. Zebrafish Models for Dyslipidemia and Atherosclerosis Research. Front. Endocrinol. 2016, 7, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, B.; Zheng, Y.M.; Zhang, J.P. Comparative Study of Different Diets-Induced NAFLD Models of Zebrafish. Front. Endocrinol. 2018, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Meijer, A.H.; Schaaf, M.J.M. Modeling Inflammation in Zebrafish for the Development of Anti-inflammatory Drugs. Front. Cell Dev. Biol. 2020, 8, 620984. [Google Scholar] [CrossRef] [PubMed]
- Zanandrea, R.; Bonan, C.D.; Campos, M.M. Zebrafish as a model for inflammation and drug discovery. Drug Discov. Today 2020, 25, 2201–2211. [Google Scholar] [CrossRef]
- Carroll, K.J.; Makarewich, C.A.; McAnally, J.; Anderson, D.M.; Zentilin, L.; Liu, N.; Giacca, M.; Bassel-Duby, R.; Olson, E.N. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA 2016, 113, 338–343. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Li, Y.; Lu, J.W.; Huo, X.; Gong, Z. Liver-specific androgen receptor knockout attenuates early liver tumor development in zebrafish. Sci. Rep. 2019, 9, 10645. [Google Scholar] [CrossRef] [Green Version]
- Shu, X.; Cheng, K.; Patel, N.; Chen, F.; Joseph, E.; Tsai, H.J.; Chen, J.N. Na, K-ATPase is essential for embryonic heart development in the zebrafish. Development 2003, 130, 6165–6173. [Google Scholar] [CrossRef] [Green Version]
- Yu, C.; Zhang, Y.; Yao, S.; Wei, Y. A PCR based protocol for detecting indel mutations induced by TALENs and CRISPR/Cas9 in zebrafish. PLoS ONE 2014, 9, e98282. [Google Scholar] [CrossRef] [Green Version]
- Hoshijima, K.; Jurynec, M.J.; Klatt Shaw, D.; Jacobi, A.M.; Behlke, M.A.; Grunwald, D.J. Highly Efficient CRISPR-Cas9-Based Methods for Generating Deletion Mutations and F0 Embryos that Lack Gene Function in Zebrafish. Dev. Cell 2019, 51, 645–657 e644. [Google Scholar] [CrossRef]
- Yang, S.; Sun, J. LncRNA SRA deregulation contributes to the development of atherosclerosis by causing dysfunction of endothelial cells through repressing the expression of adipose triglyceride lipase. Mol. Med. Rep. 2018, 18, 5207–5214. [Google Scholar] [CrossRef]
- Lammers, B.; Chandak, P.G.; Aflaki, E.; Van Puijvelde, G.H.; Radovic, B.; Hildebrand, R.B.; Meurs, I.; Out, R.; Kuiper, J.; Van Berkel, T.J.; et al. Macrophage adipose triglyceride lipase deficiency attenuates atherosclerotic lesion development in low-density lipoprotein receptor knockout mice. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 67–73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goeritzer, M.; Schlager, S.; Radovic, B.; Madreiter, C.T.; Rainer, S.; Thomas, G.; Lord, C.C.; Sacks, J.; Brown, A.L.; Vujic, N.; et al. Deletion of CGI-58 or adipose triglyceride lipase differently affects macrophage function and atherosclerosis. J. Lipid Res. 2014, 55, 2562–2575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peyot, M.L.; Guay, C.; Latour, M.G.; Lamontagne, J.; Lussier, R.; Pineda, M.; Ruderman, N.B.; Haemmerle, G.; Zechner, R.; Joly, E.; et al. Adipose triglyceride lipase is implicated in fuel- and non-fuel-stimulated insulin secretion. J. Biol. Chem. 2009, 284, 16848–16859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trites, M.J.; Clugston, R.D. The role of adipose triglyceride lipase in lipid and glucose homeostasis: Lessons from transgenic mice. Lipids Health Dis. 2019, 18, 204. [Google Scholar] [CrossRef] [Green Version]
- Zhou, H.; Lei, X.; Yan, Y.; Lydic, T.; Li, J.; Weintraub, N.L.; Su, H.; Chen, W. Targeting ATGL to rescue BSCL2 lipodystrophy and its associated cardiomyopathy. JCI Insight 2019, 5, e129781. [Google Scholar] [CrossRef] [PubMed]
- Gregor, M.F.; Hotamisligil, G.S. Inflammatory mechanisms in obesity. Annu. Rev. Immunol. 2011, 29, 415–445. [Google Scholar] [CrossRef] [Green Version]
- Langin, D. Adipose tissue lipolysis as a metabolic pathway to define pharmacological strategies against obesity and the metabolic syndrome. Pharmacol. Res. 2006, 53, 482–491. [Google Scholar] [CrossRef]
- Rajani, P.; Robertus, J.L.; Wong, J.; Homfray, T.; Gil, F.R.; Shanmuganathan, M. ATGL Deficiency-Induced Triglyceride Deposit Cardiomyovasculopathy Requiring Heart Transplant: A 5-Year Follow-Up. JACC Case Rep. 2020, 2, 760–763. [Google Scholar] [CrossRef]
- Raje, V.; Ahern, K.W.; Martinez, B.A.; Howell, N.L.; Oenarto, V.; Granade, M.E.; Kim, J.W.; Tundup, S.; Bottermann, K.; Godecke, A.; et al. Adipocyte lipolysis drives acute stress-induced insulin resistance. Sci. Rep. 2020, 10, 18166. [Google Scholar] [CrossRef]
- Yang, A.; Mottillo, E.P. Adipocyte lipolysis: From molecular mechanisms of regulation to disease and therapeutics. Biochem. J. 2020, 477, 985–1008. [Google Scholar] [CrossRef]
- Chen, J.; Hong, D.; Wang, Z.; Yuan, Y. A novel PNPLA2 mutation causes neutral lipid storage disease with myopathy (NLSDM) presenting muscular dystrophic features with lipid storage and rimmed vacuoles. Clin. Neuropathol. 2010, 29, 351–356. [Google Scholar] [CrossRef]
- Kaneko, K.; Kuroda, H.; Izumi, R.; Tateyama, M.; Kato, M.; Sugimura, K.; Sakata, Y.; Ikeda, Y.; Hirano, K.; Aoki, M. A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: A case report and literature review. Neuromuscul. Disord. 2014, 24, 634–641. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, R.; Xie, H.; Schweiger, M. Of mice and men: The physiological role of adipose triglyceride lipase (ATGL). Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 880–899. [Google Scholar] [CrossRef] [PubMed]
- Kienesberger, P.C.; Pulinilkunnil, T.; Sung, M.M.; Nagendran, J.; Haemmerle, G.; Kershaw, E.E.; Young, M.E.; Light, P.E.; Oudit, G.Y.; Zechner, R.; et al. Myocardial ATGL overexpression decreases the reliance on fatty acid oxidation and protects against pressure overload-induced cardiac dysfunction. Mol. Cell. Biol. 2012, 32, 740–750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pulinilkunnil, T.; Kienesberger, P.C.; Nagendran, J.; Waller, T.J.; Young, M.E.; Kershaw, E.E.; Korbutt, G.; Haemmerle, G.; Zechner, R.; Dyck, J.R. Myocardial adipose triglyceride lipase overexpression protects diabetic mice from the development of lipotoxic cardiomyopathy. Diabetes 2013, 62, 1464–1477. [Google Scholar] [CrossRef] [Green Version]
- Pulinilkunnil, T.; Kienesberger, P.C.; Nagendran, J.; Sharma, N.; Young, M.E.; Dyck, J.R. Cardiac-specific adipose triglyceride lipase overexpression protects from cardiac steatosis and dilated cardiomyopathy following diet-induced obesity. Int. J. Obes. 2014, 38, 205–215. [Google Scholar] [CrossRef]
- Li, L.; Zhang, X.; Zhang, Q.; Jia, J.; Zhang, J.; Zhang, D.; Song, H.; Chen, B.; Hu, J.; Huang, Y. Myocardial Adipose Triglyceride Lipase Overexpression Protects against Burn-Induced Cardiac Lipid Accumulation and Injury. Oxid. Med. Cell Longev. 2019, 2019, 6428924. [Google Scholar] [CrossRef]
- Gierens, H.; Nauck, M.; Roth, M.; Schinker, R.; Schürmann, C.; Scharnagl, H.; Neuhaus, G.; Wieland, H.; März, W. Interleukin-6 stimulates LDL receptor gene expression via activation of sterol-responsive and Sp1 binding elements. Arterioscler. Thromb. Vasc. Biol. 2000, 20, 1777–1783. [Google Scholar] [CrossRef] [Green Version]
- Poupeau, A.; Postic, C. Cross-regulation of hepatic glucose metabolism via ChREBP and nuclear receptors. Biochim. Biophys. Acta 2011, 1812, 995–1006. [Google Scholar] [CrossRef] [Green Version]
- Cooper, L.T., Jr. Myocarditis. N. Engl. J. Med. 2009, 360, 1526–1538. [Google Scholar] [CrossRef]
- Baggio, C.; Gagno, G.; Porcari, A.; Paldino, A.; Artico, J.; Castrichini, M.; Dal Ferro, M.; Bussani, R.; Merlo, M. Myocarditis: Which Role for Genetics? Curr. Cardiol. Rep. 2021, 23, 58. [Google Scholar] [CrossRef] [PubMed]
- Martinez, M.D.; Trac, D.Q.; Brown, M.E.; Maher, K.O.; Davis, M.E. Identification of targeting peptides for the diagnosis of myocarditis. Nanomedicine 2018, 13, 787–801. [Google Scholar] [CrossRef] [PubMed]
- Dvornikov, A.V.; de Tombe, P.P.; Xu, X. Phenotyping cardiomyopathy in adult zebrafish. Prog. Biophys. Mol. Biol. 2018, 138, 116–125. [Google Scholar] [CrossRef] [PubMed]
- Thiele, A.; Luettges, K.; Ritter, D.; Beyhoff, N.; Smeir, E.; Grune, J.; Steinhoff, J.S.; Schupp, M.; Klopfleisch, R.; Rothe, M.; et al. Pharmacological inhibition of adipose tissue adipose triglyceride lipase by Atglistatin prevents catecholamine-induced myocardial damage. Cardiovasc. Res. 2022, 118, 2488–2505. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Zhang, Y.L.; Lin, Q.Y.; Li, H.H.; Guo, S.B. ATGL deficiency aggravates pressure overload-triggered myocardial hypertrophic remodeling associated with the proteasome-PTEN-mTOR-autophagy pathway. Cell Biol. Toxicol. 2022, 1–19. [Google Scholar] [CrossRef]
- Schweiger, M.; Romauch, M.; Schreiber, R.; Grabner, G.F.; Hutter, S.; Kotzbeck, P.; Benedikt, P.; Eichmann, T.O.; Yamada, S.; Knittelfelder, O.; et al. Pharmacological inhibition of adipose triglyceride lipase corrects high-fat diet-induced insulin resistance and hepatosteatosis in mice. Nat. Commun. 2017, 8, 14859. [Google Scholar] [CrossRef] [Green Version]
- Takahara, S.; Ferdaoussi, M.; Srnic, N.; Maayah, Z.H.; Soni, S.; Migglautsch, A.K.; Breinbauer, R.; Kershaw, E.E.; Dyck, J.R.B. Inhibition of ATGL in adipose tissue ameliorates isoproterenol-induced cardiac remodeling by reducing adipose tissue inflammation. Am. J. Physiol. Heart Circ. Physiol. 2021, 320, H432–H446. [Google Scholar] [CrossRef]
- Pasanisi, M.B.; Missaglia, S.; Cassandrini, D.; Salerno, F.; Farina, S.; Andreini, D.; Agostoni, P.; Morandi, L.; Mora, M.; Tavian, D. Severe cardiomyopathy in a young patient with complete deficiency of adipose triglyceride lipase due to a novel mutation in PNPLA2 gene. Int. J. Cardiol. 2016, 207, 165–167. [Google Scholar] [CrossRef] [Green Version]
- Thisse, B.; Thisse, C. In situ hybridization on whole-mount zebrafish embryos and young larvae. Methods Mol. Biol. 2014, 1211, 53–67. [Google Scholar] [CrossRef]
- Carnovali, M.; Luzi, L.; Terruzzi, I.; Banfi, G.; Mariotti, M. Metabolic and bone effects of high-fat diet in adult zebrafish. Endocrine 2018, 61, 317–326. [Google Scholar] [CrossRef]
- Lai, C.Y.; Lin, C.Y.; Hsu, C.C.; Yeh, K.Y.; Her, G.M. Liver-directed microRNA-7a depletion induces nonalcoholic fatty liver disease by stabilizing YY1-mediated lipogenic pathways in zebrafish. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 844–856. [Google Scholar] [CrossRef] [PubMed]
- Sampurna, B.; Audira, G.; Juniardi, S.; Lai, Y.-H.; Hsiao, C.-D. A Simple ImageJ-Based Method to Measure Cardiac Rhythm in Zebrafish Embryos. Inventions 2018, 3, 21. [Google Scholar] [CrossRef]
Gene | Accession | Forward Primer | Reverse Primer |
---|---|---|---|
atgl | XM_005174256 | CTGTTCCCACCTGATCCACT | TGACGTCCAGCATTGAAGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lai, H.-H.; Yeh, K.-Y.; Hsu, H.-M.; Her, G.M. Deficiency of Adipose Triglyceride Lipase Induces Metabolic Syndrome and Cardiomyopathy in Zebrafish. Int. J. Mol. Sci. 2023, 24, 117. https://doi.org/10.3390/ijms24010117
Lai H-H, Yeh K-Y, Hsu H-M, Her GM. Deficiency of Adipose Triglyceride Lipase Induces Metabolic Syndrome and Cardiomyopathy in Zebrafish. International Journal of Molecular Sciences. 2023; 24(1):117. https://doi.org/10.3390/ijms24010117
Chicago/Turabian StyleLai, Hsin-Hung, Kun-Yun Yeh, Hung-Ming Hsu, and Guor Mour Her. 2023. "Deficiency of Adipose Triglyceride Lipase Induces Metabolic Syndrome and Cardiomyopathy in Zebrafish" International Journal of Molecular Sciences 24, no. 1: 117. https://doi.org/10.3390/ijms24010117