Central Stimulatory Effect of Kynurenic Acid on BDNF-TrkB Signaling and BER Enzymatic Activity in the Hippocampal CA1 Field in Sheep
Abstract
:1. Introduction
2. Results
2.1. BDNF mRNA Expression, Tissue Concentration, and TrkB Receptor Expression
2.2. mRNA Expression and Activity of DNA Glycosylases
3. Discussion
4. Materials and Methods
4.1. Animal Management
4.2. Third Ventricle (IIIv) Cannulation
4.3. Experimental Design and Tissue Collection
4.4. Analysis of Relative mRNA Abundance
4.5. Tissue BDNF Concentration Analysis
4.6. Enzyme Repair Activity
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pini, L.; Pievani, M.; Bocchetta, M.; Altomare, D.; Bosco, P.; Cavedo, E.; Galluzzi, S.; Marizzoni, M.; Frisoni, G.B. Brain atrophy in Alzheimer’s Disease and aging. Ageing. Res. Rev. 2016, 30, 25–48. [Google Scholar] [CrossRef] [PubMed]
- Sicotte, N.; Kern, K.C.; Giesser, B.S. Regional hippocampal atrophy in multiple sclerosis. Brain 2008, 131, 1134–1141. [Google Scholar] [CrossRef] [Green Version]
- Schonheit, B.; Zarski, R.; Ohm, T.G. Spatial and temporal relationships between plaques and tangles in Alzheimer-pathology. Neurobiol. Aging 2004, 25, 697–711. [Google Scholar] [CrossRef]
- De Flores, R.; La Joie, R.; Chételat, G. Structural imaging of hippocampal subfields in healthy aging and Alzheimer’s disease. Neuroscience 2015, 309, 29–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ho, N.F.; Holt, D.J.; Cheung, M.; Iglesias, J.E.; Goh, A.; Wang, M. Progressive decline in hippocampal CA1 volume in individuals at ultra-high-risk for psychosis who do not remit: Findings from the longitudinal youth at risk study. Neuropsychopharmacology 2017, 42, 1361–1370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sasabayashi, D.; Yoshimura, R.; Takahashi, T.; Takayanagi, Y.; Nashiyama, S.; Higuchi, Y.; Mizukami, Y.; Furuichi, A.; Kido, M.; Nakamura, M.; et al. Reduced hippocampal subfield volume in schizophrenia and clinical high-risk state for psychosis. Front. Psychiatry 2021, 12, 642048. [Google Scholar] [CrossRef]
- Ziehn, M.O.; Avedisian, A.A.; Tiwari-Woodruff, S.; Voskuhl, R.R. Hippocampal CA1 atrophy and synaptic loss during experimental autoimmune encephalomyelitis, EAE. Lab. Invest 2010, 90, 774–786. [Google Scholar] [CrossRef] [Green Version]
- Centonze, D.; Muzio, L.; Rossi, S.; Cavasinni, F.; De Chiara, V.; Bergami, A.; Musella, A.; D’Amelio, M.; Cavallucci, V.; Martorana, A.; et al. Inflammation triggers synaptic alteration and degeneration in experimental autoimmune encephalomyelitis. J. Neurosci. 2009, 29, 3442–3452. [Google Scholar] [CrossRef] [Green Version]
- Small, S.A.; Schobel, S.A.; Buxton, R.B.; Witter, M.P.; Barnes, C.A. A pathophysiological framework of hippocampal dysfunction in ageing and disease. Nat. Rev. Neurosci. 2011, 12, 585–601. [Google Scholar] [CrossRef] [Green Version]
- Milatovic, D.; Zaja-Milatovic, S.; Montine, K.S.; Horner, P.J.; Montine, T.J. Pharmacologic suppression of neuronal oxidative damage and dendritic degeneration following direct activation of glial innate immunity in mouse cerebrum. J. Neurochem. 2003, 87, 1518–1526. [Google Scholar] [CrossRef]
- Richwine, A.F.; Parkin, A.O.; Buchanan, J.B.; Chen, J.; Markham, J.A.; Juraska, J.M.; Johnson, R.W. Architectural changes to CA1 pyramidal neurons in adult and aged mice after peripheral immune stimulation. Psychoneuroendocrinology 2008, 33, 1369–7137. [Google Scholar] [CrossRef] [PubMed]
- Forlenza, O.V.; Miranda, A.S.; Guimar, I.; Talib, L.L.; Diniz, B.S.; Gattaz, W.F.; Teixeira, A.L. Decreased neurotrophic support is associated with cognitive decline in non-demented subjects. J. Alzheim. Dis. 2015, 46, 423–429. [Google Scholar] [CrossRef] [PubMed]
- Gibon, J.; Barker, P.A. Neurotrophins and proneurotrophins: Focus on synaptic activity and plasticity in the brain. Neuroscientist 2017, 23, 587–604. [Google Scholar] [CrossRef]
- McPhee, G.M.; Luke, A.; Downey, L.A.; Stough, C. Neurotrophins as a reliable biomarker for brain function, structure and cognition: A systematic review and meta-analysis. Neurobiol. Learn. Mem. 2020, 175, 107298. [Google Scholar] [CrossRef] [PubMed]
- Przybył, B.J.; Wójcik-Gładysz, A.; Gajewska, A.; Szlis, M. Brain-derived neurotrophic factor (BDNF) affects somatotrophic axis activity in sheep. J. Anim. Feed Sci. 2021, 30, 329–339. [Google Scholar] [CrossRef]
- Conover, J.C.; Yancopoulos, G.D. Neurotrophin regulation of the developing nervous system: Analyses of knockout mice. Rev. Neurosci. 1997, 8, 13–27. [Google Scholar] [CrossRef]
- Lin, C.C.; Huang, T.L. Brain-derived neurotrophic factor and mental disorders. Biomed. J. 2020, 43, 134–142. [Google Scholar] [CrossRef]
- Colucci-D’Amato, L.; Speranza, L.; Volpicelli, F. Neurotrophic factor BDNF, physiological functions and therapeutic potential in depression, neurodegeneration and brain cancer. Int. J. Mol. Sci. 2020, 21, 7777. [Google Scholar] [CrossRef]
- Ivanova, T.; Beyer, C. Pre- and postnatal expression of brain-derived neurotrophic factor mRNA/protein and tyrosine protein kinase receptor B mRNA in the mouse hippocampus. Neurosci. Lett. 2001, 307, 21–24. [Google Scholar] [CrossRef]
- Rao, K.S. DNA repair in aging rat neurons. Neuroscience 2007, 145, 1330–1340. [Google Scholar] [CrossRef]
- Beal, M.F. Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol. 1995, 38, 357–366. [Google Scholar] [CrossRef] [PubMed]
- Evans, M.D.; Dizdaroglu, M.; Cooke, M.S. Oxidative DNA damage and disease: Induction, repair and significance. Mutat. Res. 2004, 567, 1–61. [Google Scholar] [CrossRef] [PubMed]
- Gilmore, E.C.; Nowakowski, R.S.; Caviness, V.S., Jr.; Herrup, K. Cell birth, cell death, cell diversity and DNA breaks: How do they all fit together? Trends Neurosci. 2000, 23, 100–105. [Google Scholar] [CrossRef] [PubMed]
- Cheng, A.; Shinya, K.; Wan, R.; Tang, S.C.; Miura, T.; Tang, H.; Khatri, R.; Gleichman, M.; Ouyang, X.; Liu, D.; et al. Telomere protection mechanisms change during neurogenesis and neuronal maturation: Newly generated neurons are hypersensitive to telomere and DNA damage. J. Neurosci. 2007, 27, 3722–3733. [Google Scholar] [CrossRef] [Green Version]
- Marnett, L.J.; Plastaras, J.P. Endogenous DNA damage and mutation. Trends Genet. 2001, 17, 214–221. [Google Scholar] [CrossRef]
- Krokan, H.E.; Nilsen, H.; Skorpen, F.; Otterlei, M.; Slupphaug, G. Base excision repair of DNA in mammalian cells. Febs Lett. 2000, 476, 73–77. [Google Scholar] [CrossRef]
- Lou, G.L.; Pinsky, C.; Sitar, D.S. Kynurenic acid distribution into brain and peripheral tissues of mice. Can. J. Physiol. Pharmacol. 1994, 72, 161–167. [Google Scholar] [CrossRef]
- Németh, H.; Toldi, J.; Vécsei, L. Role of kynurenines in the central and peripheral nervous systems. Curr. Neurovasc. Res. 2005, 2, 249–260. [Google Scholar] [CrossRef] [PubMed]
- Kessler, M.; Terramani, T.; Lynch, G.; Baudry, M. A glycine site associated with N-methyl-D-aspartic acid receptors: Characterization and identification of a new class of antagonists. J. Neurochem. 1989, 52, 1319–1328. [Google Scholar] [CrossRef]
- Hilmas, C.; Pereira, E.F.; Alkondon, M.; Rassoulpour, A.; Schwarcz, R.; Albuquerque, E.X. The brain metabolite kynurenic acid inhibits α7 nicotinic receptor activity and increases non-α7 nicotinic receptor expression: Physiopathological implications. J. Neurosci. 2001, 21, 7463–7473. [Google Scholar] [CrossRef]
- Amori, L.; Wu, H.Q.; Marinozzi, M.; Pellicciari, R.; Guidetti, P.; Schwarcz, R. Specific inhibition of kynurenate synthesis enhances extracellular dopamine levels in the rodent striatum. Neuroscience 2009, 159, 196–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beggiato, S.; Tanganelli, S.; Fuxe, K.; Antonelli, T.; Schwarcz, R.; Ferraro, L. Endogenous kynurenic acid regulates extracellular GABA levels in the rat prefrontal cortex. Neuropharmacology 2014, 82, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Stone, T.W. Development and therapeutic potential of kynurenic acid and kynurenine derivatives for neuroprotection. Trends Pharmacol. Sci. 2000, 21, 149–154. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Simonavicius, N.; Wu, X. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. J. Biologic. Chem. 2006, 281, 22021–22028. [Google Scholar] [CrossRef] [Green Version]
- Moroni, F.; Cozzi, A.; Sili, M.; Mannaioni, G. Kynurenic acid: A metabolite with multiple actions and multiple targets in brain and periphery. J. Neural. Trans. 2012, 119, 133–139. [Google Scholar] [CrossRef]
- Lugo-Huitron, R.; Blanco-Ayala, T.; Ugalde-Muñiz, P.; Carrillo-Mora, P.; Pedraza-Chaverrí, J.; Silva-Adaya, D.; Maldonado, P.D.; Torres, I.; Pinzón, E.; Ortiz-Islas, E.; et al. On the antioxidant properties of kynurenic acid: Free radical scavenging activity and inhibition of oxidative stress. Neurotoxicol. Teratol. 2011, 33, 538–547. [Google Scholar] [CrossRef]
- Halliwell, B.; Gutteridge, J.M. Free Radicals in Biology and Medicine, 3rd ed.; Oxford Sciences Publication: Oxford, UK, 1999. [Google Scholar]
- Pérez-De La Cruz, V.; Königsberg, M.; Santamaría, A. Kynurenine pathway and disease: An overview. CNS Neurol. Disord. Drug Targets 2007, 6, 398–410. [Google Scholar]
- Veening, J.G.; Barendregt, H.P. The regulation of brain states by neuroactive substances distributed via the cerebrospinal fluid; a review. Cerebrospinal Fluid Res. 2010, 7, 1. [Google Scholar] [CrossRef] [Green Version]
- Wichmann, T.O.; Damkier, H.H.; Pedersen, M. A brief overview of the cerebrospinal fluid system and its implications for brain and spinal cord diseases. Front. Hum. Neurosci. 2022, 15, 737217. [Google Scholar] [CrossRef]
- Yang, L.; Kress, B.T.; Weber, H.J.; Thiyagarajan, M.; Wang, B.; Deane, R.; Benveniste, H.; Iliff, J.J.; Nedergaard, M. Evaluating glymphatic pathway function utilizing clinically relevant intrathecal infusion of CSF tracer. J. Transl. Med. 2013, 11, 107. [Google Scholar] [CrossRef] [Green Version]
- Misztal, T.; Młotkowska, P.; Marciniak, E.; Misztal, A. Allopregnanolone reduces neuroendocrine response to acute stressful stimuli in sheep. J. Endocrinol. 2020, 244, 201–211. [Google Scholar] [CrossRef] [PubMed]
- Misztal, T.; Kowalczyk, P.; Młotkowska, P.; Marciniak, E. The effect of allopregnanolone on enzymatic activity of the DNA base excision repair pathway in the sheep hippocampus and amygdala under natural and stressful conditions. Int. J. Mol. Sci. 2020, 21, 7762. [Google Scholar] [CrossRef] [PubMed]
- Chao, M.V. Neurotrophin signaling in health and disease. Clin. Sci. 2006, 110, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Marini, A.M.; Rabin, S.J.; Lipsky, R.H.; Mocchetti, I. Activity-dependent release of brain-derived neurotrophic factor underlies the neuroprotective effect of N-methyl-D-aspartate. J. Biol. Chem. 1998, 273, 29394–29399. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Moghaddam, B. Regulation of glutamate efflux by excitatory amino acid receptors: Evidence for tonic inhibitory and phasic excitatory regulation. J. Pharmacol. Exp. Ther. 1995, 274, 1209–1215. [Google Scholar]
- Autry, A.; Adachi, M.; Nosyreva, E.; Na, E.S.; Los, M.F.; Cheng, P.; Kavalali, E.T.; Monteggia, L.M. NMDA receptor blockade at rest triggers rapid behavioural antidepressant responses. Nature 2011, 475, 91–95. [Google Scholar] [CrossRef] [Green Version]
- Deutschenbaur, L.; Beck, J.; Kiyhankhadiv, A.; Muhlhauser, M.; Borgwardt, S.; Walter, M.; Hasler, G.; Sollberger, D.; Lang, U.E. Role of calcium, glutamate and NMDA in major depression and therapeutic application. Prog. Neuropsychopharmacol. Biol. Psych. 2016, 64, 325–333. [Google Scholar] [CrossRef]
- Zhou, W.; Wang, N.; Yang, C.; Li, X.M.; Zhou, Z.; Yang, J.J. Ketamine-induced antidepressant effects are associated with AMPA receptors-mediated upregulation of mTOR and BDNF in rat hippocampus and prefrontal cortex. Eur. Psychiatry 2014, 29, 419–423. [Google Scholar] [CrossRef]
- Reichardt, L.F. Neurotrophin-regulated signaling pathways. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2006, 361, 1545–1564. [Google Scholar] [CrossRef] [Green Version]
- von Bohlen und Halbach, O.; von Bohlen und Halbach, V. BDNF effects on dendritic spine morphology and hippocampal function. Cell Tissue Res. 2018, 373, 729–741. [Google Scholar] [CrossRef]
- Alonso, M.; Medina, J.H.; Pozzo-Miller, L. ERK1/2 activation is necessary for BDNF to increase dendritic spine density in hippocampal CA1 pyramidal neurons. Learn. Mem. 2004, 11, 172–178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cerpa, W.; Ramos-Fernandez, E.; Inestrosa, N.C. Modulation of NMDA receptor through secreted soluble factors. Mol. Neurobiol. 2016, 53, 299–309. [Google Scholar] [CrossRef] [PubMed]
- Mattson, M.P.; Lovell, M.A.; Furukawa, K.; Markesbery, W.R. Neurotrophic factors attenuate glutamate-induced accumulation of peroxides, elevation of intracellular Ca2+ concentration, and neurotoxicity and increase antioxidant enzyme activities in hippocampal neurons. J. Neurochem. 1995, 65, 1740–1751. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.L.; Lin, Y.T.; Chuang, P.C.; Bohr, V.A.; Mattson, M.P. BDNF and exercise enhance neuronal DNA repair by stimulating CREB-mediated production of apurinic/apyrimidinic endonuclease 1. Neuromolecular Med. 2014, 16, 161–174. [Google Scholar] [CrossRef]
- Friedberg, E.C.; Walker, G.C.; Siede, W.; Wood, R.D.; Schultz, R.A.; Ellenberger, T. DNA Repair and Mutagenesis, 2nd ed.; ASM Press: Washington, DC, USA, 2006. [Google Scholar]
- Nakabeppu, Y. Cellular levels of 8-oxoguanine in either DNA or the nucleotide pool play pivotal roles in carcinogenesis and survival of cancer cells. Int. J. Mol. Sci. 2014, 15, 12543–12557. [Google Scholar] [CrossRef] [Green Version]
- Zsizsik, B.K.; Hardeland, R. A putative mechanism of kynurenic acid oxidation by free radicals: Scavenging of two hydroxyl radicals and superoxide anion, release of •NO and CO2. In Actions and Redox Properties of Melatonin and Other Aromatic Amino Acid Metabolites; Hardeland, R., Ed.; Cuvillier: Gottingen, Germany, 2001; pp. 164–167. [Google Scholar]
- Hazra, T.K.; Hill, J.W.; Izumi, T.; Mitra, S. Multiple DNA glycosylases for repair of 8-oxoguanine and their potential in vivo functions. Prog. Nucleic Acid Res. Mol. Biol. 2001, 68, 193–205. [Google Scholar]
- Zsizsik, B.; Hardeland, R. Kynurenic acid inhibits hydroxyl radical-induced destruction of 2-deoxyribose. In Studies on Antioxidants and Their Metabolites; Hardeland, R., Ed.; Cuvillier: Gottingen, Germany, 1999; pp. 92–94. [Google Scholar]
- Winczura, A.; Zdzalik, D.; Tudek, B. Damage of DNA and proteins by major lipid peroxidation products in genome stability. Free Radic. Res. 2012, 46, 442–459. [Google Scholar] [CrossRef]
- Shieh, P.B.; Hu, S.C.; Bobb, K.; Timmusk, T.; Ghosh, A. Identification of a signaling pathway involved in calcium regulation of BDNF expression. Neuron 1998, 20, 727–740. [Google Scholar] [CrossRef] [Green Version]
- Fukui, S.; Schwarcz, R.; Rapoport, S.I.; Takada, Y.; Smith, Q.R. Blood-brain barrier transport of kynurenines: Implications for brain synthesis and metabolism. J. Neurochem. 1991, 56, 2007–2017. [Google Scholar] [CrossRef]
- Pocivavsek, A.; Notarangelo, F.M.; Wu, H.O.; Bruno, J.P.; Schwarcz, R. Astrocytes as pharmacological targets in the treatment of schizophrenia: Focus on kynurenic acid. In: Pletnikov, M.V.; Waddington, J.L. Editors. Handb. Behav. Sci. 2016, 23, 423–443. [Google Scholar]
- Ostapiuk, A.; Urbanska, E.M. Kynurenic acid in neurodegenerative disorders—Unique neuroprotection or double-edged sword? CNS Neurosci. Ther. 2022, 28, 19–35. [Google Scholar] [CrossRef] [PubMed]
- Rejdak, K.; Petzold, A.; Kocki, T.; Kurzepa, J.; Grieb, P.; Turski, W.A.; Stelmasiak, Z. Astrocytic activation in relation to inflammatory markers during clinical exacerbation of relapsing-remitting multiple sclerosis. J. Neural Transm. 2007, 114, 1011–1015. [Google Scholar] [CrossRef] [PubMed]
- Pocivavsek, A.; Thomas, M.A.R.; Elmer, G.I.; Bruno, J.P.; Schwarz, R. Continuous kynurenine administration during the prenatal period, but not during adolescence, causes learning and memory deficits in adult rats. Psychopharmacology 2014, 231, 2799–2809. [Google Scholar] [CrossRef] [Green Version]
- Tuboly, G.; Tar, L.; Bohar, Z.; Safrany-Fark, A.; Petrovszki, Z.; Kekesi, G.; Vecsei, L.; Pardutz, A.; Horvath, G. The inimitable kynurenic acid: The roles of different ionotropic receptors in the action of kynurenic acid at a spinal level. Brain Res. Bull. 2015, 112, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Dabrowski, W.; Kwiecień, J.M.; Rola, R.; Klapec, M.; Stanisz, G.J.; Kotlinska-Hasiec, E.; Oakden, W.; Janik, R.; Coote, M.; Frey, B.N.; et al. Prolonged subdural infusion of kynurenic acid is associated with dose-dependent myelin damage in the rat spinal cord. PLoS ONE 2015, 10, e0142598. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strzetelski, J. IZ PIB–INRA Feeding Recommendations for Ruminants and Feed Tables. Kraków, Poland, 2014. (In Polish) [Google Scholar]
- Welento, J.; Szteyn, S.; Milart, Z. Observations on the stereotaxic configuration of the hypothalamus nuclei in the sheep. Anat. Anz. 1969, 124, 1–27. [Google Scholar] [PubMed]
- Traczyk, W.; Przekop, F. Methods of investigation of the function of the hypothalamus and hypophysis in chronic experiments in sheep. Acta Physiol. Pol. 1963, 14, 227–236. [Google Scholar] [PubMed]
- Johnson, J.I.; Sudheimer, K.D.; Davis, K.K.; Kerndt, G.M.; Winn, B.M. The sheep brain atlas. Michigan State University, Brain Biodiversity Bank. Available online: http://brains.anatomy.msu.edu/brains/sheep/index.html (accessed on 5 November 2022).
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pairwise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Kowalczyk, P.; Jaworek, J.; Kot, M.; Sokołowska, B.; Bieleń, A.; Janowska, B.; Cieśla, J.M.; Szparecki, G.; Sadoś, B.; Tudek, B. Inflammation increases oxidative DNA damage repair and stimulates preneoplastic changes in colons of newborn rats. J. Physiol. Pharmacol. 2016, 67, 277–286. [Google Scholar]
GENE | PRIMERS (5′–3′) | GENBANK ACC. NO. | AMPLICON SIZE |
---|---|---|---|
BDNF | F: CGTTGGCTGACACTTTTGAA R: CGCAGCATCCAGGTAATTTT | XM_012143442.1 | 188 |
TRKB | F: TGTCTGAGCTGATCCTGGTG R: TATCTGCAGGTTTGCCAGTG | XM_012117231.2 | 155 |
OGG1 | F: CAGTCATAATAACAGTA R: AACCTCCTCTAAGCACTCAT | NC_040270.1/XM004018285 | 140 |
MPG | F: GCTGAGGGCCAGCCAACACCTGC R: CGCCCCTTTACCCACGGAGCCCA | NC_040275.1/XM027962018.1 | 140 |
TDG | F: ACACAGGATGCTGTGGGGCT R: TCCCTCGGCCTAGAATTTTC | NC_040254.1 | 120 |
APE1 | F: TTAGACATTTGGTTGCC R: GGCACCAACAGGGCTAGCA | NC_040272.1 | 140 |
GAPDH | F: GGGTCATCATCTCTGCACCT R: GGTCATAAGTCCCTCCACGA | NM_001190390.1 | 131 |
PPIC | F: TGGAAAAGTCGTGCCCAAGA R: TGCTTATACCACCAGTGCCA | XM_004008676.1 | 158 |
18S RRNA | F: GCAATTATTCCCCCATGAACG R: GGGACTTAATCAACGCAAGC | NR_003286 | 115 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Roszkowicz-Ostrowska, K.; Młotkowska, P.; Kowalczyk, P.; Marciniak, E.; Barszcz, M.; Misztal, T. Central Stimulatory Effect of Kynurenic Acid on BDNF-TrkB Signaling and BER Enzymatic Activity in the Hippocampal CA1 Field in Sheep. Int. J. Mol. Sci. 2023, 24, 136. https://doi.org/10.3390/ijms24010136
Roszkowicz-Ostrowska K, Młotkowska P, Kowalczyk P, Marciniak E, Barszcz M, Misztal T. Central Stimulatory Effect of Kynurenic Acid on BDNF-TrkB Signaling and BER Enzymatic Activity in the Hippocampal CA1 Field in Sheep. International Journal of Molecular Sciences. 2023; 24(1):136. https://doi.org/10.3390/ijms24010136
Chicago/Turabian StyleRoszkowicz-Ostrowska, Katarzyna, Patrycja Młotkowska, Paweł Kowalczyk, Elżbieta Marciniak, Marcin Barszcz, and Tomasz Misztal. 2023. "Central Stimulatory Effect of Kynurenic Acid on BDNF-TrkB Signaling and BER Enzymatic Activity in the Hippocampal CA1 Field in Sheep" International Journal of Molecular Sciences 24, no. 1: 136. https://doi.org/10.3390/ijms24010136