Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae)
Abstract
:1. Introduction
2. Results
2.1. Cloning and Sequence Analysis of PflaPBPs
2.2. Tissue Expression of PflaPBPs
2.3. Prokaryotic Expression and Purification of PflaPBPs
2.4. Test of Fluorescent Probe
2.5. Fluorescence Binding Affinities
2.6. Three-Dimensional Structure and Molecular Docking of PflaPBPs
3. Discussion
4. Materials and Methods
4.1. Insect Rearing and Sample Collection
4.2. RNA Extraction and Cloning of PflaPBPs
4.3. Sequence Analysis
4.4. Tissue Expression of PflaPBPs
4.5. Expression and Purification
4.6. Probe Test and Fluorescence Binding Assays
4.7. Three-Dimensional Structures and Molecular Docking of PflaPBPs
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
References
- Keil, T.A.; Steinbrecht, R.A. Insects as model systems in cell biology. Methods Cell Biol. 2010, 96, 363–394. [Google Scholar] [PubMed]
- Zhou, J.J. Odorant-binding proteins in insects. Vitam. Horm. 2010, 83, 241–272. [Google Scholar] [PubMed]
- Pelosi, P.; Zhou, J.J.; Ban, L.P.; Calvello, M. Soluble proteins in insect chemical communication. Cell Mol. Life Sci. 2006, 63, 1658–1676. [Google Scholar] [CrossRef]
- Fang, N.N.; Hu, Y.W.; Mao, B.; Bi, J.; Zheng, Y.; Guan, C.X.; Wang, Y.F.; Li, J.H.; Mao, Y.K.; Ai, H. Molecular characterization and functional differentiation of three pheromone-binding proteins from Tryporyza intacta. Sci. Rep. 2018, 8, 10774. [Google Scholar] [CrossRef] [Green Version]
- Stengl, M. Pheromone transduction in moths. Front. Cell Neurosci. 2010, 4, 133. [Google Scholar] [CrossRef] [Green Version]
- Gu, S.H.; Zhou, J.J.; Wang, G.R.; Zhang, Y.J.; Guo, Y.Y. Sex pheromone recognition and immunolocalization of three pheromone binding proteins in the black cutworm moth Agrotis ipsilon. Insect Biochem. Mol. Biol. 2013, 43, 237–251. [Google Scholar] [CrossRef] [PubMed]
- Holdcraft, R.; Rodriguez-Saona, C.; Stelinski, L.L. Pheromone autodetection: Evidence and implications. Insects 2016, 7, 17. [Google Scholar] [CrossRef] [Green Version]
- Györgyi, T.K.; Roby-Shemkovitz, A.J.; Lerner, M.R. Characterization and cDNA cloning of the pheromone-binding protein from the tobacco hornworm, Manduca sexta: A tissue-specific developmentally regulated protein. Proc. Natl. Acad. Sci. USA 1988, 85, 9851–9855. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krieger, J.; Grosse-Wilde, E.; Gohl, T.; Breer, H. Candidate pheromone receptors of the silkmoth Bombyx mori. Eur. J. Neurosci. 2005, 21, 2167–2176. [Google Scholar] [CrossRef]
- Forstner, M.; Breer, H.; Krieger, J. A receptor and binding protein interplay in the detection of a distinct pheromone component in the silkmoth Antheraea polyphemus. Int. J. Biol. Sci. 2009, 5, 745–757. [Google Scholar] [CrossRef]
- Laue, M.; Steinbrecht, R.A. Topochemistry of moth olfactory sensillae. Int. J. Insect Morphol. Embryol. 1997, 26, 217–228. [Google Scholar] [CrossRef]
- Callahan, F.E.; Vogt, R.G.; Tucker, M.L.; Dickens, J.C.; Mattoo, A.K. High level expression of “male specific” pheromone binding proteins (PBPs) in the antennae of female noctuiid moths. Insect Biochem. Mol. Biol. 2000, 30, 507–514. [Google Scholar] [CrossRef] [PubMed]
- Vogt, R.G.; Riddiford, L.M. Pheromone binding and inactivation by moth antennae. Nature 1981, 293, 161–163. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Prestwich, G.D. Expression and characterization of a lepidopteran general odorant binding protein. Insect Biochem. Mol. Biol. 1997, 27, 405–412. [Google Scholar] [CrossRef] [PubMed]
- Plettner, E.; Lazar, J.; Prestwich, E.G.; Prestwich, G.D. Discrimination of pheromone enantiomers by two pheromone binding proteins from the gypsy moth Lymantria dispar. Biochemistry 2000, 39, 8953–8962. [Google Scholar] [CrossRef]
- Xiu, W.M.; Dong, S.L. Molecular characterization of two pheromone binding proteins and quantitative analysis of their expression in the beet armyworm, Spodoptera exigua Hübner. J. Chem. Ecol. 2007, 33, 947–961. [Google Scholar] [CrossRef]
- Chang, H.T.; Liu, Y.; Yang, T.; Pelosi, P.; Dong, S.L.; Wang, G.R. Pheromone binding proteins enhance the sensitivity of olfactory receptors to sex pheromones in Chilo suppressalis. Sci. Rep. 2015, 5, 13093. [Google Scholar] [CrossRef] [Green Version]
- Tian, Z.; Qiu, G.; Li, Y.; Zhang, H.; Yan, W.; Yue, Q.; Sun, L. Molecular characterization and functional analysis of pheromone binding proteins and general odorant binding proteins from Carposina sasakii Matsumura (Lepidoptera: Carposinidae). Pest Manag. Sci. 2019, 75, 234–245. [Google Scholar] [CrossRef] [Green Version]
- Sun, M.; Liu, Y.; Walker, W.B.; Liu, C.; Lin, K.; Gu, S.; Zhang, Y.J.; Zhou, J.J.; Wang, G. Identification and characterization of pheromone receptors and interplay between receptors and pheromone binding proteins in the diamondback moth, Plutella xyllostella. PLoS ONE 2013, 8, e62098. [Google Scholar] [CrossRef] [Green Version]
- Dong, K.; Sun, L.; Liu, J.T.; Gu, S.H.; Zhou, J.J.; Yang, R.N.; Dhiloo, K.H.; Gao, X.W.; Guo, Y.Y.; Zhang, Y.J. RNAi-induced electrophysiological and behavioral changes reveal two pheromone binding proteins of Helicoverpa armigera involved in the perception of the main sex pheromone component Z11-16: Ald. J. Chem. Ecol. 2017, 43, 207–214. [Google Scholar] [CrossRef]
- Krieger, J.; Grosse-Wilde, E.; Gohl, T.; Dewer, Y.M.E.; Raming, K.; Breer, H. Genes encoding candidate pheromone receptors in a moth (Heliothis virescens). Proc. Natl. Acad. Sci. USA 2004, 101, 11845–11850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zielonka, M.; Breer, H.; Krieger, J. Molecular elements of pheromone detection in the female moth, Heliothis virescens. Insect Sci. 2018, 25, 389–400. [Google Scholar] [CrossRef] [PubMed]
- Mao, A.; Zhou, J.; Mao, B.; Zheng, Y.; Wang, Y.F.; Li, D.Q.; Wang, P.; Liu, K.Y.; Wang, X.P. Sex pheromone recognition and characterization of three pheromone-binding proteins in the legume pod borer, Maruca vitrata Fabricius (Lepidoptera: Crambidae). Sci. Rep. 2016, 6, 34484. [Google Scholar] [CrossRef]
- Yu, Y.X.; Zhou, P.; Zhang, J.J.; Zheng, C.; Zhang, J.; Chen, N.Z. Pheromone-binding proteins in the Asian gypsy moth females, Lymantria dispar, recognizing the sex pheromone and plant volatiles. Arch. Insect Biochem. 2018, 99, e21477. [Google Scholar] [CrossRef]
- Ye, Z.F.; Liu, X.L.; Han, Q.; Liao, H.; Dong, X.T.; Zhu, G.H.; Dong, S.L. Functional characterization of PBP1 gene in Helicoverpa armigera (Lepidoptera: Noctuidae) by using the CRISPR/Cas9 system. Sci. Rep. 2017, 7, 8470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shiota, Y.; Sakurai, T.; Daimon, T.; Mitsuno, H.; Fujii, T.; Matsuyama, S.; Sezutsu, H.; Ishikawa, Y.; Kanzaki, R. In vivo functional characterisation of pheromone binding protein-1 in the silkmoth, Bombyx mori. Sci. Rep. 2018, 8, 13529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monteys, V.S.I.; Acín, P.; Rosell, G.; Quero, C.; Jiménez, M.A.; Guerrero, A. Moths behaving like butterflies. Evolutionary loss of long range attractant pheromones in Castniid moths: A paysandisia archon model. PLoS ONE 2012, 7, e29282. [Google Scholar]
- Subchev, M.A. Sex pheromone communication in the family Zygaenidae (Insecta: Lepidoptera): A review. Acta Zool. Bulg. 2014, 66, 147–157. [Google Scholar]
- Liu, J.Y. Reproductive Biology of Phauda flammans. Master’s Thesis, Guangxi University, Nanning, China, 2018. [Google Scholar]
- Sasaerila, Y.; Gries, G.; Khaskin, G.; Gries, R. Identification of sex pheromone components of nettle caterpillar, Setothosea asigna. J. Chem. Ecol. 1997, 23, 2187–2196. [Google Scholar] [CrossRef]
- Wakamura, S.; Tanaka, H.; Masumoto, Y.; Sawada, H.; Toyohara, N. Sex pheromone of the blue-striped nettle grub moth Parasa lepida (Cramer) (Lepidoptera: Limacodidae): Identification and field attraction. Appl. Entomol. Zool. 2007, 42, 347–352. [Google Scholar] [CrossRef] [Green Version]
- Zheng, X.L.; Liu, J.Y.; Zhang, Z.L.; Wang, P.; Lu, W. Diel rhythms of sexual behavior and pheromone responses in Phauda flammans Walker (Lepidoptera: Zygaenidae). Pest Manag. Sci. 2019, 75, 3070–3075. [Google Scholar] [CrossRef] [PubMed]
- Subchev, M.A.; Harizanov, A.; Francke, W.; Franke, S.; Plass, E.; Reckziegel, A.; Schroder, F.; Pickett, J.A.; Wadhams, L.J.; Woodcock, C.M. Sex pheromone of the female vine bud moth, Theresimima ampellophaga Bayle-Barelle (Lepidoptera: Zygaenidae), comprises (2S)-butyl (7Z)-tetradeceonate. J. Chem. Ecol. 1998, 24, 1141–1151. [Google Scholar] [CrossRef]
- Subchev, M.A.; Toshova, T.; Tóth, M.; Voigt, E.; Mikulás, J.; Francke, W. Catches of vine bud moth Theresimima ampellophaga (Lepidoptera: Zygaenidae: Procridinae) males in pheromone traps: Effect of the purity and age of baits, design, colour and height of the traps, and daily sexual activity of males. J. Appl. Entomol. 2004, 128, 44–50. [Google Scholar] [CrossRef]
- Subchev, M.A.; Toshova, T.B.; Koshio, C.H.; Franke, S.; Tröger, A.; Twele, R.; Francke, W.; Pickett, J.A.; Wadhams, L.J.; Woodcock, C.M. Identification and biological activity of sex pheromone components from females of the plum moth Illiberis rotundata Jordan (Lepidoptera: Zygaenidae: Procridinae). Chemoecology 2009, 19, 47–54. [Google Scholar] [CrossRef]
- Subchev, M.A.; Efetov, K.A.; Toshova, T.B.; Koshio, C.H. Sex pheromones as isolating mechanisms in two closely related Illiberis species—1. (Primilliberis) rotundata Jordan, 1907, and I. (P.) pruni Dyar, 1905 (Lepidoptera: Zygaenidae: Procridinae). Entomol. Gaz. 2016, 67, 51–57. [Google Scholar]
- Efetov, K.A.; Can, F.; Toshova, T.B.; Subchev, M.A. New sex attractant for Jordanita anatolica (Naufock) (Lepidoptera: Zygaenidae: Procridinae). Acta Zool. Bulg. 2010, 62, 315–319. [Google Scholar]
- Efetov, K.A.; Kucherenko, E.E.; Parshkova, E.V.; Tarmann, G.M. 2-butyl 2-dodecenoate, a new sex attractant for Jordanita (Tremewania) notata (Zeller, 1847) and some other Procridinae species (Lepidoptera: Zygaenidae). SHILAP Revta. Lepid. 2016, 44, 519–527. [Google Scholar]
- Efetov, K.A.; Kucherenko, E.E.; Tarmann, G.M. New synthetic sex attractants for the males of two endemic Iberian Procridinae species (Lepidoptera: Zygaenidae). SHILAP Revta. lepid. 2019, 47, 307–315. [Google Scholar]
- Nageshchandra, B.K.; Rajagopal, B.K.; Balasubramanian, R. Occurrence of slug caterpillar Phauda flammans Wlk. (Lepidoptera: Zygaenidae) on Ficus racemosa L. in south India. Mysore. J. Agr. Sci. 1972, 6, 186–189. [Google Scholar]
- Verma, T.D.; Dogra, G.S. Occurrence of Phauda flammans Wlk. (Lepidoptera: Zygaenidae) on ficus species in Himachal Pradesh. J. Tree Sci. 1982, 1, 130–132. [Google Scholar]
- Fof. Diurnal Leaf Skeletonizing Moth from Vietnam: Phauda flammans. What’s That Bug. 2015. Available online: https://www.whatsthatbug.com/diurnal-leaf-skeletonizing-moth-from-vietnam-phauda-flammans/ (accessed on 3 November 2022).
- Liu, J.Y.; He, Q.L.; Wei, H.; Yang, J.; Li, J.; Lu, W.; Zheng, X.L. Biological characteristics of Phauda flammans (Lepidoptera: Zygaenidae). Plant Protect. 2015, 41, 188–192. [Google Scholar]
- Liu, J.Y.; Ma, Z.H.; Wu, S.Y.; Lin, M.Y.; Zhang, J.; Lu, W.; Zheng, X. L, Studies on the feeding preferences of Phauda flammans Walker (Lepidoptera: Zygaenidae). J. Environ. Entomol. 2016, 38, 924–930. [Google Scholar]
- Anonymous. Hosts—A Database of the World’s Lepidopteran Hostplants. The Natural History. 2019. Available online: http://www.nhm.ac.uk/our-science/data/hostplants/search/list.dsml?beginIndex=140280&browse.dsml=Callidulidae%253D%253D%253D%253DFamily (accessed on 3 November 2022).
- Zheng, X.L.; Li, J.; Su, L.; Liu, J.Y.; Meng, L.Y.; Lin, M.Y.; Zhang, J.; Lu, W. Ecological and morphological characteristics of parasitoids in Phauda flammans (Lepidoptera, Zygaenidae). Parasite 2015, 22, 36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, A.L.; Meng, L.L.; Zhang, W.; Liu, J.Y.; Li, G.Y.; Tan, H.H.; Lu, W.; Zheng, X.L. Effects of five pesticides on toxicity, detoxifying and protective enzymes in Phauda flammans Walker (Lepidoptera: Zygaenidae). Pak. J. Zool. 2019, 51, 1457–1463. [Google Scholar] [CrossRef]
- Xu, R.; Kuang, R.P.; Pay, E.; Dou, H.; de Snoo, G.R. Factors contributing to overuse of pesticides in western China. Environ. Sci. 2008, 5, 235–249. [Google Scholar] [CrossRef] [Green Version]
- McNeil, J.N. Behavioral ecology of pheromone-mediated communication in moths and its importance in the use of pheromone traps. Annu. Rev. Entomol. 1991, 36, 407–430. [Google Scholar] [CrossRef]
- Liu, J.Y.; Zhang, Y.J.; Huang, Z.Y.; Dong, Z.S.; Duan, Y.B.; Lu, W.; Zheng, X.L. Ultrastructural observations of antennal sensilla in Phauda flammans Walker (Lepidoptera: Zygaenidae). J. Entomol. Sci. 2018, 53, 281–294. [Google Scholar] [CrossRef]
- Keil, T.A. Fine structure of the pheromone-sensitive sensilla on the antenna of the hawkmoth, Manduca sexta. Tissue Cell 1989, 21, 139–151. [Google Scholar] [CrossRef]
- Ebbinghaus, D.; Lösel, P.M.; Lindemann, M.; Scherkenbeck, J.; Zebitz, C.P.W. Detection of major and minor sex pheromone components by the male codling moth Cydia pomonella (Lepidoptera: Tortricidae). J. Insect Physiol. 1997, 44, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Maida, R.; Mameli, M.; Muller, B.; Krieger, J.; Steinbrecht, R. The expression pattern of four odorant-binding proteins in male and female silk moths, Bombyx mori. J. Neurocytol. 2005, 34, 149–163. [Google Scholar] [CrossRef] [PubMed]
- Sakurai, T.; Namiki, S.; Kanzaki, R. Molecular and neural mechanisms of sex pheromone reception and processing in the silkmoth Bombyx mori. Front. Physiol. 2014, 5, 125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lundberg, S.; Löfstedt, C. Intra-specific competition in the sex communication channel: A selective force in the evolution of moth pheromones? J. Theor. Biol. 1987, 125, 15–24. [Google Scholar] [CrossRef]
- Zheng, X.L.; Liu, J.Y.; Lu, W.; He, X.Z.; Wang, Q. Mating delay reduces reproductive performance but not longevity in a monandrous moth. J. Insect Sci. 2020, 20, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harari, A.R.; Zahavi, T.; Thiéry, D. Fitness cost of pheromone production in signaling female moths. Evolution 2011, 65, 1572–1582. [Google Scholar] [CrossRef] [PubMed]
- Harari, A.R.; Steinitz, H. The evolution of female sex pheromones. Curr. Zool. 2013, 59, 569–578. [Google Scholar] [CrossRef]
- Schneider, D.; Schulz, S.; Priesner, E.; Ziesmann, J.; Francke, W. Autodetection and chemistry of female and male pheromone in both sexes of the tiger moth Panaxia quadripunctaria. J. Comp. Physiol. A 1998, 182, 153–161. [Google Scholar] [CrossRef]
- Lim, H.; Greenfield, M.D. Female arctiid moths, Utetheisa ornatrix, orient towards and join pheromonal choruses. Anim. Behav. 2008, 75, 673–680. [Google Scholar] [CrossRef]
- Thode, A.B.; Kruse, S.W.; Nix, J.C.; Jones, D.N.M. The role of multiple hydrogen bonding groups in specific alcohol binding sites in proteins: Insights from structural studies of LUSH. J. Mol. Biol. 2008, 376, 1360–1376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, G.; Chen, J.; Yu, H.; Tian, X.; Wu, J. Molecular and functional characterization of pheromone binding protein 1 from the oriental fruit moth, Grapholita molesta (Busck). Sci. Rep. 2018, 8, 2276. [Google Scholar] [CrossRef] [Green Version]
- Zhu, J.; Ban, L.; Song, L.M.; Liu, Y.; Pelosi, P.; Wang, G. General odorant-binding proteins and sex pheromone guide larvae of Plutella xylostella to better food. Insect Biochem. Mol. Biol. 2016, 72, 10–19. [Google Scholar] [CrossRef]
- Liu, H.; Duan, H.; Wang, Q.; Xiao, Y.; Wang, Q.; Xiao, Q.; Sun, L.; Zhang, Y. Key Amino Residues Determining Binding Activities of the Odorant Binding Protein AlucOBP22 to Two Host Plant Terpenoids of Apolygus lucorum. J. Agric. Food Chem. 2019, 67, 5949–5956. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.Q.; Mang, D.Z.; Liao, H.; Ye, J.; Qian, J.L.; Dong, S.L.; Zhang, Y.N.; He, P.; Zhang, Q.H.; Purba, E.R.; et al. Functional Disparity of Three Pheromone-Binding Proteins to Different Sex Pheromone Components in Hyphantria cunea (Drury). J. Agric. Food Chem. 2021, 69, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Iga, M.; Smagghe, G. Identification and expression profile of Halloween genes involved in ecdysteroid biosynthesis in Spodoptera littoralis. Peptides 2010, 31, 456–467. [Google Scholar] [CrossRef]
- Johnson, J.A.; Bitra, K.; Zhang, S.; Wang, L.; Lynn, D.E.; Strand, M.R. The UGACiE1 cell line from Chrysodeixis includens exhibits characteristics of granulocytes and is permissive to infection by two viruses. Insect Biochem. Mol. Biol. 2010, 40, 394–404. [Google Scholar] [CrossRef] [PubMed]
- Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.L.; Barthel, A.; et al. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [Green Version]
- Zhu, F.; Xu, J.J.; Palli, R.; Ferguson, J.; Palli, S.R. Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata. Pest Manag. Sci. 2011, 67, 175–182. [Google Scholar] [CrossRef]
- Scott, J.G.; Michel, K.; Bartholomay, L.C.; Siegfried, B.D.; Hunter, W.B.; Smagghe, G.; Zhu, K.Y.; Douglas, A.E. Towards the elements of successful insect RNAi. J. Insect Physiol. 2013, 59, 1212–1221. [Google Scholar] [CrossRef] [Green Version]
- Palli, S.R. RNA interference in Colorado potato beetle: Steps toward development of dsRNA as a commercial insecticide. Curr. Opin. Insect Sci. 2014, 6, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Shukla, J.N.; Kalsi, M.; Sethi, A.; Narva, K.E.; Fishilevich, E.; Singh, S.; Mogilicherla, K.; Palli, S.R. Reduced stability and intracellular transport of dsRNA contribute to poor RNAi response in lepidopteran insects. RNA Biol. 2016, 13, 656–669. [Google Scholar] [CrossRef]
- Groot, A.T.; Marr, M.; Schöfl, G.; Lorenz, S.; Svatos, A.; Heckel, D.G. Host strain specific sex pheromone variation in Spodoptera frugiperda. Front. Zool. 2008, 5, 20. [Google Scholar] [CrossRef]
- Sun, J.B.; Liu, N.Y.; Li, S.M.; Yan, Q.; Dong, S.L. Molecular cloning, tissue expression profiling and binding characterization of the pheromone binding protein SlitPBP4 from Spodoptera litura (Lepidoptera: Noctuidae). Acta Entomol. Sin. 2018, 61, 657–667. [Google Scholar]
- Hu, Y.; Liu, Y.; Bi, J.; Chen, Y.; Zheng, Y.; Mao, Y.; Mao, Y.; Xu, H.; Guan, C.; Chen, Y.; et al. Field evaluation of sex pheromones and binding specificity of pheromone binding protein 4 in Tryporyza intacta (Lepidoptera: Crambidae). Sci. Rep. 2020, 10, 5464. [Google Scholar] [CrossRef] [Green Version]
- Forstner, M.; Gohl, T.; Breer, H.; Krieger, J. Candidate pheromone binding proteins of the silkmoth Bombyx mori. Invert. Neurosci. 2006, 6, 177–187. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Wang, X.Y.; Tan, L.S.; Lu, W.; Zheng, X.L. Identification of chemosensory genes, including candidate pheromone receptors, in Phauda flammans (Walker) (Lepidoptera: Phaudidae) through transcriptomic analyses. Front. Physiol. 2022, 13, 907694. [Google Scholar] [CrossRef] [PubMed]
- Ma, M.; Chang, M.M.; Lei, C.L.; Yang, F.L. A garlic substance disrupts odorant-binding protein recognition of insect pheromones released from adults of the angoumois grain moth, Sitotroga cerealella(Lepidoptera: Gelechiidae). Insect Mol. Biol. 2016, 25, 530–540. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.T.; Jia, R.J.; Zhu, C.Q.; Shi, X.H.; Zhang, S.N.; Ma, T.; Wen, X.J. Identification of sexing and observation on reproductive system of Phauda flammans. J. Zhejiang Forest. Sci. Technol. 2017, 37, 87–92. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Tian, Z.; Wang, X.Y.; Chen, X.M.; Lu, W.; Wang, X.P.; Zheng, X.L. Screening of Reference Genes for Quantitative Real-Time PCR in Phauda flammans (Walker) (Lepidoptera: Phaudidae). J. Environ. Entomol. 2021, 43, 15–24. [Google Scholar]
- Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef]
- Schwede, T.; Kopp, J.; Guex, N.; Peitsch, M.C. Swiss-model: An automated protein homology-modeling server. Nucleic. Acids. Res. 2003, 31, 3381–3385. [Google Scholar] [CrossRef]
Name | Type III Sum of Squares | df | Mean Square | F | p Value | Partial Eta Squared |
---|---|---|---|---|---|---|
Corrected Model | 2364.730 a | 11 | 214.975 | 1651.377 | p < 0.001 | 0.999 |
Intercept | 507.917 | 1 | 507.917 | 3901.664 | p < 0.001 | 0.994 |
Tissue | 2233.953 | 5 | 446.791 | 3432.113 | p < 0.001 | 0.999 |
Sex | 21.300 | 1 | 21.300 | 163.621 | p < 0.001 | 0.872 |
Tissue × Sex | 109.477 | 5 | 21.895 | 168.194 | p < 0.001 | 0.972 |
Error | 3.124 | 24 | 0.130 | |||
Total | 2875.771 | 36 | ||||
Corrected Total | 2367.854 | 35 |
Name | Type III Sum of Squares | df | Mean Square | F | p Value | Partial Eta Squared |
---|---|---|---|---|---|---|
Corrected Model | 3,672,802.496 a | 11 | 333,891.136 | 28.018 | p < 0.001 | 0.928 |
Intercept | 699,379.439 | 1 | 699,379.439 | 58.687 | p < 0.001 | 0.710 |
Tissue | 3,464,396.971 | 5 | 692,879.394 | 58.142 | p < 0.001 | 0.924 |
Sex | 34,945.539 | 1 | 34,945.539 | 2.932 | p > 0.050 | 0.109 |
Tissue × Sex | 173,459.986 | 5 | 34,691.997 | 2.911 | p < 0.050 | 0.378 |
Error | 286,009.418 | 24 | 11,917.059 | |||
Total | 4,658,191.353 | 36 | ||||
Corrected Total | 3,958,811.915 | 35 |
Ligands | CAS No. | PflaPBP1 | PflaPBP2 | ||
---|---|---|---|---|---|
IC50 (μM) | Ki (μM) | IC50 (μM) | Ki (μM) | ||
Z-9-hexadecenal | 56219-04-6 | 29.13 | 21.26 | 148.92 | 108.68 |
(Z, Z, Z)-9, 12, 15-octadecatrienal | 26537-71-3 | 52.73 | 38.48 | 33.95 | 24.80 |
Gene | Primer Sequence (5′-3′) | Amplicon Length (bp) | PCR Efficiency | Regression Coefficient |
---|---|---|---|---|
Gene cloning | ||||
PflaPBP1 | F: AGCAAAACTGGTACGTGAGA | 740 | n.a. | n.a. |
R: AAGCAAAGTGAATGCGTTTTATGT | ||||
PflaPBP2 | F: TGATCAGAGAGTTGAACGTGAA | 600 | n.a. | n.a. |
R: CCTTCATTCAATGCCTGGTCC | ||||
qRT-PCR | ||||
PflaPBP1 | F: TGAAGAGGGATACTGGGTGTGT | 140 | 1.011 | 0.999 |
R: TTGTGAAGCGGTTTCCTCGG | ||||
PflaPBP2 | F: GGAAATCGG TTCACGGGTTG | 100 | 0.994 | 0.999 |
R: TCATTGCGAATTCCTGGGCA | ||||
GAPDH | F: AACTGCCTTGCTCCACTAGC | 145 | 0.988 | 0.998 |
R: GAGCACCACGACCATCTCTC | ||||
TUB2 | F: CAACTACGCACGAGGACACT | 130 | 1.136 | 0.998 |
R: CACCGCCAAACGAGTGAAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, L.; Tian, Z.; Hu, J.; Wang, X.-Y.; Wang, M.-Q.; Lu, W.; Wang, X.-P.; Zheng, X.-L. Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae). Int. J. Mol. Sci. 2023, 24, 385. https://doi.org/10.3390/ijms24010385
Chen L, Tian Z, Hu J, Wang X-Y, Wang M-Q, Lu W, Wang X-P, Zheng X-L. Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae). International Journal of Molecular Sciences. 2023; 24(1):385. https://doi.org/10.3390/ijms24010385
Chicago/Turabian StyleChen, Lian, Zhong Tian, Jin Hu, Xiao-Yun Wang, Man-Qun Wang, Wen Lu, Xiao-Ping Wang, and Xia-Lin Zheng. 2023. "Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae)" International Journal of Molecular Sciences 24, no. 1: 385. https://doi.org/10.3390/ijms24010385