miR-100-5p Regulates Skeletal Muscle Myogenesis through the Trib2/mTOR/S6K Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. The Expression of miR-100-5p Is Associated with Myogenesis
2.2. miR-100-5p Promotes Myoblast Proliferation and Inhibits Myoblast Differentiation
2.3. Target Gene Screening Revealed That miR-100-5p Directly Targeted Trib2
2.4. Trib2 Knockdown Promotes Myoblast Proliferation and Inhibits Myoblast Differentiation
2.5. miR-100-5p Attenuates Activation of the mTOR Signaling Pathway during Myoblast Differentiation
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. RNA Oligonucleotides and Cell Transfection
4.3. RNA Isolation and Real-Time Quantitative PCR
4.4. Cell Counting Kit-8 (CCK-8) Assays
4.5. 5-Ethynyl-20-Deoxyuridine (EdU) Assay
4.6. Immunofluorescence Staining
4.7. Flow Cytometric Analysis
4.8. Dual-Luciferase Reporter Assay
4.9. Western Blot Assay
4.10. Bioinformation Analysis
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Frontera, W.R.; Ochala, J. Skeletal muscle: A brief review of structure and function. Calcif. Tissue Int. 2015, 96, 183–195. [Google Scholar] [CrossRef] [PubMed]
- Braun, T.; Gautel, M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat. Rev. Mol. Cell Biol. 2011, 12, 349–361. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.; Dilworth, F.J. Differential modulation of cell cycle progression distinguishes members of the myogenic regulatory factor family of transcription factors. FEBS J. 2013, 280, 3991–4003. [Google Scholar] [CrossRef] [PubMed]
- Günther, S.; Kim, J.; Kostin, S.; Lepper, C.; Fan, C.M.; Braun, T. Myf5-positive satellite cells contribute to Pax7-dependent long-term maintenance of adult muscle stem cells. Cell Stem Cell 2013, 13, 590–601. [Google Scholar] [CrossRef] [PubMed]
- Tapscott, S.J. The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription. Development 2005, 132, 2685–2695. [Google Scholar] [CrossRef] [PubMed]
- Seale, P.; Sabourin, L.A.; Girgis-Gabardo, A.; Mansouri, A.; Gruss, P.; Rudnicki, M.A. Pax7 is required for the specification of myogenic satellite cells. Cell 2000, 102, 777–786. [Google Scholar] [CrossRef]
- Archacka, K.; Ciemerych, M.A.; Florkowska, A.; Romanczuk, K. Non-Coding RNAs as Regulators of Myogenesis and Postexercise Muscle Regeneration. Int. J. Mol. Sci. 2021, 22, 11568. [Google Scholar] [CrossRef]
- Zhao, H.; Li, P.; Wang, J. The role of muscle-specific MicroRNAs in patients with chronic obstructive pulmonary disease and skeletal muscle dysfunction. Front. Physiol. 2022, 13, 954364. [Google Scholar] [CrossRef]
- Yan, S.; Pei, Y.; Li, J.; Tang, Z.; Yang, Y. Recent Progress on Circular RNAs in the Development of Skeletal Muscle and Adipose Tissues of Farm Animals. Biomolecules 2023, 13, 314. [Google Scholar] [CrossRef]
- Lv, W.; Jin, J.; Xu, Z.; Luo, H.; Guo, Y.; Wang, X.; Wang, S.; Zhang, J.; Zuo, H.; Bai, W.; et al. lncMGPF is a novel positive regulator of muscle growth and regeneration. J. Cachexia Sarcopenia Muscle 2020, 11, 1723–1746. [Google Scholar] [CrossRef]
- Shukla, G.C.; Singh, J.; Barik, S. MicroRNAs: Processing, Maturation, Target Recognition and Regulatory Functions. Mol. Cell. Pharmacol. 2011, 3, 83–92. [Google Scholar] [PubMed]
- Huntzinger, E.; Izaurralde, E. Gene silencing by microRNAs: Contributions of translational repression and mRNA decay. Nat. Rev. Genet. 2011, 12, 99–110. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, M.T.; Lee, W. Role of MiR-325-3p in the Regulation of CFL2 and Myogenic Differentiation of C2C12 Myoblasts. Cells 2021, 10, 2725. [Google Scholar] [CrossRef] [PubMed]
- Elnour, I.E.; Wang, X.; Zhansaya, T.; Akhatayeva, Z.; Khan, R.; Cheng, J.; Hung, Y.; Lan, X.; Lei, C.; Chen, H. Circular RNA circMYL1 Inhibit Proliferation and Promote Differentiation of Myoblasts by Sponging miR-2400. Cells 2021, 10, 176. [Google Scholar] [CrossRef]
- Dey, P.; Soyer, M.A.; Dey, B.K. MicroRNA-24-3p promotes skeletal muscle differentiation and regeneration by regulating HMGA1. Cell. Mol. Life Sci. 2022, 79, 170. [Google Scholar] [CrossRef]
- Eniafe, J.; Jiang, S. MicroRNA-99 family in cancer and immunity. Wiley Interdiscip. Rev. RNA 2021, 12, e1635. [Google Scholar] [CrossRef]
- Mir, B.A.; Albrecht, E.; Ali, A.; Hansson, O.; Maak, S. MicroRNA-100 Reduced Fetal Bovine Muscle Satellite Cell Myogenesis and Augmented Intramuscular Lipid Deposition by Modulating IGF1R. Cells 2022, 11, 451. [Google Scholar] [CrossRef]
- Jin, Y.; Tymen, S.D.; Chen, D.; Fang, Z.J.; Zhao, Y.; Dragas, D.; Dai, Y.; Marucha, P.T.; Zhou, X. MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing. PLoS ONE 2013, 8, e64434. [Google Scholar] [CrossRef]
- Jahangiri, B.; Khalaj-Kondori, M.; Asadollahi, E.; Purrafee Dizaj, L.; Sadeghizadeh, M. MSC-Derived exosomes suppress colorectal cancer cell proliferation and metastasis via miR-100/mTOR/miR-143 pathway. Int. J. Pharmaceut. 2022, 627, 122214. [Google Scholar] [CrossRef]
- Cao, X.; Tang, S.; Du, F.; Li, H.; Shen, X.; Li, D.; Wang, Y.; Zhang, Z.; Xia, L.; Zhu, Q.; et al. miR-99a-5p Regulates the Proliferation and Differentiation of Skeletal Muscle Satellite Cells by Targeting MTMR3 in Chicken. Genes 2020, 11, 369. [Google Scholar] [CrossRef]
- Mai, Z.; Mi, Y.; Jiang, M.; Wan, S.; Di, Q. Expression and Related Mechanisms of miR-100 and TRIB2 in COPD Patients. J. Healthc. Eng. 2022, 2022, 6556208. [Google Scholar] [CrossRef] [PubMed]
- Eyers, P.A.; Keeshan, K.; Kannan, N. Tribbles in the 21st Century: The Evolving Roles of Tribbles Pseudokinases in Biology and Disease. Trends Cell Biol. 2017, 27, 284–298. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, B.I.; Santos, B.; Link, W.; De Sousa-Coelho, A.L. Tribbles Pseudokinases in Colorectal Cancer. Cancers 2021, 13, 2825. [Google Scholar] [CrossRef] [PubMed]
- Harris, J.A.; Fairweather, E.; Byrne, D.P.; Eyers, P.A. Analysis of human Tribbles 2 (TRIB2) pseudokinase. Method Enzymol. 2022, 667, 79–99. [Google Scholar] [CrossRef]
- Richmond, L.; Keeshan, K. Pseudokinases: A tribble-edged sword. FEBS J. 2020, 287, 4170–4182. [Google Scholar] [CrossRef]
- Warma, A.; Ndiaye, K. Functional effects of Tribbles homolog 2 in bovine ovarian granulosa cells. Biol. Reprod. 2020, 102, 1177–1190. [Google Scholar] [CrossRef]
- Salomé, M.; Magee, A.; Yalla, K.; Chaudhury, S.; Sarrou, E.; Carmody, R.J.; Keeshan, K. A Trib2-p38 axis controls myeloid leukaemia cell cycle and stress response signalling. Cell Death Dis. 2018, 9, 443. [Google Scholar] [CrossRef]
- Takaguri, A.; Ishizaka, R.; Maki, S.; Satoh, K. The role of tribbles homolog 2 in vascular smooth muscle cell proliferation. Cell Biol. Int. 2023, 47, 787–795. [Google Scholar] [CrossRef]
- Nakayama, K.; Ogawa, A.; Miyashita, H.; Tabara, Y.; Igase, M.; Kohara, K.; Miki, T.; Kagawa, Y.; Yanagisawa, Y.; Katashima, M.; et al. Positive natural selection of TRIB2, a novel gene that influences visceral fat accumulation, in East Asia. Hum. Genet. 2013, 132, 201–217. [Google Scholar] [CrossRef]
- Saxton, R.A.; Sabatini, D.M. mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef]
- Ma, X.M.; Blenis, J. Molecular mechanisms of mTOR-mediated translational control. Nat. Rev. Mol. Cell Biol. 2009, 10, 307–318. [Google Scholar] [CrossRef] [PubMed]
- Holz, M.K.; Ballif, B.A.; Gygi, S.P.; Blenis, J. mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 2021, 184, 2255. [Google Scholar] [CrossRef] [PubMed]
- Rion, N.; Castets, P.; Lin, S.; Enderle, L.; Reinhard, J.R.; Eickhorst, C.; Rüegg, M.A. mTOR controls embryonic and adult myogenesis via mTORC1. Development 2019, 146, dev172460. [Google Scholar] [CrossRef]
- Luo, W.; Lin, Z.; Chen, J.; Chen, G.; Zhang, S.; Liu, M.; Li, H.; He, D.; Liang, S.; Luo, Q.; et al. TMEM182 interacts with integrin beta 1 and regulates myoblast differentiation and muscle regeneration. J. Cachexia Sarcopenia Muscle 2021, 12, 1704–1723. [Google Scholar] [CrossRef] [PubMed]
- Miller, J.B.; Everitt, E.A.; Smith, T.H.; Block, N.E.; Dominov, J.A. Cellular and molecular diversity in skeletal muscle development: News from in vitro and in vivo. Bioessays 1993, 15, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Rao, P.K.; Kumar, R.M.; Farkhondeh, M.; Baskerville, S.; Lodish, H.F. Myogenic factors that regulate expression of muscle-specific microRNAs. Proc. Natl. Acad. Sci. USA 2006, 103, 8721–8726. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, J.; Vernus, B.; Chelh, I.; Cassar-Malek, I.; Gabillard, J.C.; Hadj Sassi, A.; Seiliez, I.; Picard, B.; Bonnieu, A. Myostatin and the skeletal muscle atrophy and hypertrophy signaling pathways. Cell. Mol. Life Sci. CMLS 2014, 71, 4361–4371. [Google Scholar] [CrossRef]
- Silva, W.J.; Graça, F.A.; Cruz, A.; Silvestre, J.G.; Labeit, S.; Miyabara, E.H.; Yan, C.; Wang, D.Z.; Moriscot, A.S. miR-29c improves skeletal muscle mass and function throughout myocyte proliferation and differentiation and by repressing atrophy-related genes. Acta Physiol. 2019, 226, e13278. [Google Scholar] [CrossRef]
- Lim, S.; Lee, D.; Morena Da Silva, F.; Koopmans, P.; Vechetti, I.J.; von Walden, F.; Greene, N.P.; Murach, K.A. MicroRNA Control of the Myogenic Cell Transcriptome and Proteome: The Role of miR-16. Am. J. Physiol. Cell Physiol. 2023, 324, C1101–C1109. [Google Scholar] [CrossRef]
- Shintani-Ishida, K.; Tsurumi, R.; Ikegaya, H. Decrease in the expression of muscle-specific miRNAs, miR-133a and miR-1, in myoblasts with replicative senescence. PLoS ONE 2023, 18, e280527. [Google Scholar] [CrossRef]
- Lopez, M.A.; Si, Y.; Hu, X.; Williams, V.; Qushair, F.; Carlyle, J.; Alesce, L.; Conklin, M.; Gilbert, S.; Bamman, M.M.; et al. Smad8 Is Increased in Duchenne Muscular Dystrophy and Suppresses miR-1, miR-133a, and miR-133b. Int. J. Mol. Sci. 2022, 23, 7515. [Google Scholar] [CrossRef] [PubMed]
- Takebayashi, K.; Nasu, K.; Okamoto, M.; Aoyagi, Y.; Hirakawa, T.; Narahara, H. hsa-miR-100-5p, an overexpressed miRNA in human ovarian endometriotic stromal cells, promotes invasion through attenuation of SMARCD1 expression. Reprod. Biol. Endocrinol. RBE 2020, 18, 31. [Google Scholar] [CrossRef] [PubMed]
- Fuso, P.; Di Salvatore, M.; Santonocito, C.; Guarino, D.; Autilio, C.; Mulè, A.; Arciuolo, D.; Rinninella, A.; Mignone, F.; Ramundo, M.; et al. Let-7a-5p, miR-100-5p, miR-101-3p, and miR-199a-3p Hyperexpression as Potential Predictive Biomarkers in Early Breast Cancer Patients. J. Pers. Med. 2021, 11, 816. [Google Scholar] [CrossRef] [PubMed]
- Lai, Y.; Kacal, M.; Kanony, M.; Stukan, I.; Jatta, K.; Kis, L.; Norberg, E.; Vakifahmetoglu-Norberg, H.; Lewensohn, R.; Hydbring, P.; et al. miR-100-5p confers resistance to ALK tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALK positive NSCLC. Biochem. Biophys. Res. Commun. 2019, 511, 260–265. [Google Scholar] [CrossRef]
- Huang, J.; Wang, S.; Feng, X.; Liu, X.; Zhao, J.; Zheng, Q.; Wei, X.; Ma, Y. miRNA transcriptome comparison between muscle and adipose tissues indicates potential miRNAs associated with intramuscular fat in Chinese swamp buffalo. Genome 2019, 62, 729–738. [Google Scholar] [CrossRef]
- Pek, S.L.; Sum, C.F.; Lin, M.X.; Cheng, A.K.; Wong, M.T.; Lim, S.C.; Tavintharan, S. Circulating and visceral adipose miR-100 is down-regulated in patients with obesity and Type 2 diabetes. Mol. Cell. Endocrinol. 2016, 427, 112–123. [Google Scholar] [CrossRef]
- Andriani, F.; Majorini, M.T.; Mano, M.; Landoni, E.; Miceli, R.; Facchinetti, F.; Mensah, M.; Fontanella, E.; Dugo, M.; Giacca, M.; et al. MiR-16 regulates the pro-tumorigenic potential of lung fibroblasts through the inhibition of HGF production in an FGFR-1- and MEK1-dependent manner. J. Hematol. Oncol. 2018, 11, 45. [Google Scholar] [CrossRef]
- Keeshan, K.; Shestova, O.; Ussin, L.; Pear, W.S. Tribbles homolog 2 (Trib2) and HoxA9 cooperate to accelerate acute myelogenous leukemia. Blood Cells Mol. Dis. 2008, 40, 119–121. [Google Scholar] [CrossRef]
- Bailey, F.P.; Byrne, D.P.; Oruganty, K.; Eyers, C.E.; Novotny, C.J.; Shokat, K.M.; Kannan, N.; Eyers, P.A. The Tribbles 2 (TRB2) pseudokinase binds to ATP and autophosphorylates in a metal-independent manner. Biochem. J. 2015, 467, 47–62. [Google Scholar] [CrossRef]
- Do, E.K.; Park, J.K.; Cheon, H.C.; Kwon, Y.W.; Heo, S.C.; Choi, E.J.; Seo, J.K.; Jang, I.H.; Lee, S.C.; Kim, J.H. Trib2 regulates the pluripotency of embryonic stem cells and enhances reprogramming efficiency. Exp. Mol. Med. 2017, 49, e401. [Google Scholar] [CrossRef]
- Dobens, L.L.; Nauman, C.; Fischer, Z.; Yao, X. Control of Cell Growth and Proliferation by the Tribbles Pseudokinase: Lessons from Drosophila. Cancers 2021, 13, 883. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Liang, X.; Shan, T.; Jiang, Q.; Deng, C.; Zheng, R.; Kuang, S. mTOR is necessary for proper satellite cell activity and skeletal muscle regeneration. Biochem. Biophys. Res. Commun. 2015, 463, 102–108. [Google Scholar] [CrossRef] [PubMed]
- Cong, X.X.; Gao, X.K.; Rao, X.S.; Wen, J.; Liu, X.C.; Shi, Y.P.; He, M.Y.; Shen, W.L.; Shen, Y.; Ouyang, H.; et al. Rab5a activates IRS1 to coordinate IGF-AKT-mTOR signaling and myoblast differentiation during muscle regeneration. Cell Death Differ. 2020, 27, 2344–2362. [Google Scholar] [CrossRef] [PubMed]
- Schiaffino, S.; Dyar, K.A.; Ciciliot, S.; Blaauw, B.; Sandri, M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013, 280, 4294–4314. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, T.; Delafontaine, P. Mechanisms of IGF-1-Mediated Regulation of Skeletal Muscle Hypertrophy and Atrophy. Cells 2020, 9, 1970. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.; Kumar, A. Supraphysiological activation of TAK1 promotes skeletal muscle growth and mitigates neurogenic atrophy. Nat. Commun. 2022, 13, 2201. [Google Scholar] [CrossRef]
Name | Sequence (5′ to 3′) |
---|---|
miR-100-5p mimic | AACCCGUAGAUCCGAACUUGUG |
CAAGUUCGGAUCUACGGGUUUU | |
Mimic NC | UUCUCCGAACGUGUCACGUTT |
ACGUGACACGUUCGGAGAATT | |
miR-100-5p inhibitor | CACAAGUUCGGAUCUACGGGUU |
Inhibitior NC | CAGUACUUUUGUGUAGUACAA |
Trib2 siRNA | GCCAGAGUUUCAGCCCGAATT |
UUCGGGCUGAAACUCUGGCTT | |
siRNA NC | UUCUCCGAACGUGUCACGUTT |
ACGUGACACGUUCGGAGAATT |
Gene | Primer Name | Primer Sequence (5′ to 3′) |
---|---|---|
miR-100-5p | Stem-loop | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAGTT |
R | TCGGCAGGAACCCGTAGATCCG | |
F | CTCAACTGGTGTCGTGGA | |
U6 | R | AACGCTTCACGAATTTGCGT |
F | CTCGCTTCGGCAGCACA | |
Trib2 | R | CACTCTTGTCTCCCGATGCC |
F | ACACGGTCCTCTCCTACTTCT | |
Pcna | R | ATTCACCCGACGGCATCTTT |
F | GAACCTCACCAGCATGTCCA | |
Cdk4 | R | TCAGGTCCCGGTGAACAATG |
F | GCCAAAGGAAGGAGGTAAGGG | |
Ccnd | R | ATAGGAACACTGCGGGAGGT |
F | GCCAAAGGAAGGAGGTAAGGG | |
MyHC | R | GAGCCTCGATTCGCTCCTTT |
F | CGGTCGAAGTTGCATCCCT | |
MyoG | R | CTGGGAAGGCAACAGACAT |
F | CAATGCACTGGAGTTCGGT | |
Myomixer | F | CAAGAAGTTCAGGCTTCAGGTG |
R | CACTTCTGGGGGCCCAATC | |
myomaker | F | AGGGGTCCAGGATAAAAGGC |
R | GCCAAGCATTGTGAAGGTCG | |
Gapdh | R | TCCACCACCCTGTTGCTGTAG |
F | AGGGCATCCTGGGCTACACT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, K.; Liufu, S.; Yu, Z.; Xu, X.; Ai, N.; Li, X.; Liu, X.; Chen, B.; Zhang, Y.; Ma, H.; et al. miR-100-5p Regulates Skeletal Muscle Myogenesis through the Trib2/mTOR/S6K Signaling Pathway. Int. J. Mol. Sci. 2023, 24, 8906. https://doi.org/10.3390/ijms24108906
Wang K, Liufu S, Yu Z, Xu X, Ai N, Li X, Liu X, Chen B, Zhang Y, Ma H, et al. miR-100-5p Regulates Skeletal Muscle Myogenesis through the Trib2/mTOR/S6K Signaling Pathway. International Journal of Molecular Sciences. 2023; 24(10):8906. https://doi.org/10.3390/ijms24108906
Chicago/Turabian StyleWang, Kaiming, Sui Liufu, Zonggang Yu, Xueli Xu, Nini Ai, Xintong Li, Xiaolin Liu, Bohe Chen, Yuebo Zhang, Haiming Ma, and et al. 2023. "miR-100-5p Regulates Skeletal Muscle Myogenesis through the Trib2/mTOR/S6K Signaling Pathway" International Journal of Molecular Sciences 24, no. 10: 8906. https://doi.org/10.3390/ijms24108906