Short-Term Irisin Treatment Enhanced Neurotrophin Expression Differently in the Hippocampus and the Prefrontal Cortex of Young Mice
Abstract
:1. Introduction
2. Results
2.1. Short-Term Irisin Injections Differently Increased the Expression of Neurotrophic/Growth Factors in the Hippocampus and the Prefrontal Cortex (PFC)
2.2. Short-Term Irisin Administration Did Not Affect the Expression of Il-6 and Il-1β in Either the Hippocampus or the PFC
2.3. Short-Term Irisin Administration Modulated Gene Expression in a Sex-Independent Way in Both the Hippocampus and the PFC
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Short-Term Irisin Administration
4.3. Gene Expression Analysis by qRT-PCR Assays
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ruegsegger, G.N.; Booth, F.W. Health Benefits of Exercise. Cold Spring Harb. Perspect. Med. 2018, 8, a029694. [Google Scholar] [CrossRef] [PubMed]
- Warburton, D.E.; Nicol, C.W.; Bredin, S.S. Health benefits of physical activity: The evidence. Can. Med. Assoc. J. 2006, 174, 801–809. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Yan, Z. Molecular Mechanisms of Exercise and Healthspan. Cells 2022, 1, 872. [Google Scholar] [CrossRef] [PubMed]
- Safdar, A.; Saleem, A.; Tarnopolsky, M.A. The potential of endurance exercise-derived exosomes to treat metabolic diseases. Nat. Rev. Endocrinol. 2016, 12, 504–517. [Google Scholar] [CrossRef]
- Zhao, R. Irisin at the crossroads of inter-organ communications: Challenge and implications. Front. Endocrinol. 2022, 13, 989135. [Google Scholar] [CrossRef]
- Pignataro, P.; Dicarlo, M.; Zerlotin, R.; Zecca, C.; Dell’Abate, M.T.; Buccoliero, C.; Logroscino, G.; Colucci, S.; Grano, M. FNDC5/Irisin System in Neuroinflammation and Neurodegenerative Diseases: Update and Novel Perspective. Int. J. Mol. Sci. 2021, 22, 1605. [Google Scholar] [CrossRef]
- Boström, P.; Wu, J.; Jedrychowski, M.P.; Korde, A.; Ye, L.; Lo, J.C.; Rasbach, K.A.; Boström, E.A.; Choi, J.H.; Long, J.Z.; et al. A PGC1-α-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 2012, 481, 463–468. [Google Scholar] [CrossRef]
- Colaianni, G.; Lippo, L.; Sanesi, L.; Brunetti, G.; Celi, M.; Cirulli, N.; Passeri, G.; Reseland, J.; Schipani, E.; Faienza, M.F.; et al. Deletion of the Transcription Factor PGC-1α in Mice Negatively Regulates Bone Mass. Calcif. Tissue Int. 2018, 103, 638–652. [Google Scholar] [CrossRef]
- Wrann, C.D.; White, J.P.; Salogiannnis, J.; Laznik-Bogoslavski, D.; Wu, J.; Ma, D.; Lin, J.D.; Greenberg, M.E.; Spiegelman, B.M. Exercise induces hippocampal BDNF through a PGC-1α/FNDC5 pathway. Cell Metab. 2013, 18, 649–659. [Google Scholar] [CrossRef]
- Young, M.F.; Valaris, S.; Wrann, C.D. A role for FNDC5/Irisin in the beneficial effects of exercise on the brain and in neurodegenerative diseases. Prog. Cardiovasc. Dis. 2019, 62, 172–178. [Google Scholar] [CrossRef]
- Qi, J.Y.; Yang, L.K.; Wang, X.S.; Wang, M.; Li, X.B.; Feng, B.; Wu, Y.M.; Liu, S.B.; Zhang, K. Mechanism of CNS regulation by irisin, a multifunctional protein. Brain Res. Bull. 2022, 188, 11–20. [Google Scholar] [CrossRef]
- World Health Organization. Depression and Other Common Mental Disorders: Global Health Estimates 2017. Available online: https://apps.who.int/iris/handle/10665/254610 (accessed on 15 April 2023).
- WHO Depression. Available online: http://www.who.int/mediacentre/factsheets/fs369/en/ (accessed on 15 April 2023).
- Wang, S.; Pan, J. Irisin ameliorates depressive-like behaviors in rats by regulating energy metabolism. Biochem. Biophys. Res. Commun. 2016, 474, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Siteneski, A.; Cunha, M.P.; Lieberknecht, V.; Pazini, F.L.; Gruhn, K.; Brocardo, P.S.; Rodrigues, A.L.S. Central irisin administration affords antidepressant-like effect and modulates neuroplasticity-related genes in the hippocampus and prefrontal cortex of mice. Prog. Neuropsychopharmacol. Biol. Psychiatry 2018, 84, 294–303. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ruan, M.; Chen, J.; Fang, Y. Major Depressive Disorder: Advances in Neuroscience Research and Translational Applications. Neurosci. Bull. 2021, 37, 863–880. [Google Scholar] [CrossRef]
- Filatova, E.V.; Shadrina, M.I.; Slominsky, P.A. Major Depression: One Brain, One Disease, One Set of Intertwined Processes. Cells 2021, 10, 1283. [Google Scholar] [CrossRef] [PubMed]
- Geschwind, D.H.; Flint, J. Genetics and genomics of psychiatric disease. Science 2015, 349, 1489–1494. [Google Scholar] [CrossRef]
- Otte, C.; Gold, S.M.; Penninx, B.W.; Pariante, C.M.; Etkin, A.; Fava, M.; Mohr, D.C.; Schatzberg, A.F. Major depressive disorder. Nat. Rev. Dis. Primers 2016, 2, 16065. [Google Scholar] [CrossRef]
- McAllister-Williams, R.H.; Arango, C.; Blier, P.; Demyttenaere, K.; Falkai, P.; Gorwood, P.; Hopwood, M.; Javed, A.; Kasper, S.; Malhi, G.S.; et al. The identification, assessment and management of difficult-to-treat depression: An international consensus statement. J. Affect Disord. 2020, 267, 264–282. [Google Scholar] [CrossRef]
- Voineskos, D.; Daskalakis, Z.J.; Blumberger, D.M. Management of Treatment-Resistant Depression: Challenges and Strategies. Neuropsychiatr. Dis. Treat. 2020, 16, 221–234. [Google Scholar] [CrossRef]
- Faquih, A.E.; Memon, R.I.; Hafeez, H.; Zeshan, M.; Naveed, S. A Review of Novel Antidepressants: A Guide for Clinicians. Cureus 2019, 11, e4185. [Google Scholar] [CrossRef]
- Caldarone, B.J.; Zachariou, V.; King, S.L. Rodent models of treatment-resistant depression. Eur. J. Pharmacol. 2015, 753, 51–65. [Google Scholar] [CrossRef] [PubMed]
- Pignataro, P.; Dicarlo, M.; Zerlotin, R.; Storlino, G.; Oranger, A.; Sanesi, L.; Lovero, R.; Buccoliero, C.; Mori, G.; Colaianni, G.; et al. Antidepressant Effect of Intermittent Long-Term Systemic Administration of Irisin in Mice. Int. J. Mol. Sci. 2022, 23, 7596. [Google Scholar] [CrossRef] [PubMed]
- Ryan, N.D. Child and adolescent depression: Short-term treatment effectiveness and long-term opportunities. Int. J. Methods Psychiatr. Res. 2003, 2, 44–53. [Google Scholar] [CrossRef]
- Pignataro, P.; Dicarlo, M.; Suriano, C.; Sanesi, L.; Zerlotin, R.; Storlino, G.; Oranger, A.; Zecca, C.; Dell’Abate, M.T.; Mori, G. Once-Daily Subcutaneous Irisin Administration Mitigates Depression- and Anxiety-like Behavior in Young Mice. Int. J. Mol. Sci. 2023, 24, 6715. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.J.; Adams, D.H.; Simen, A.; Simen, B.B.; Rajkowska, G.; Stockmeier, C.A.; Overholser, J.C.; Meltzer, H.Y.; Jurjus, G.J.; Konick, L.C.; et al. Gene expression profiling in postmortem prefrontal cortex of major depressive disorder. J. Neurosci. 2007, 27, 13329–13340. [Google Scholar] [CrossRef] [PubMed]
- Schmaal, L.; Veltman, D.J.; van Erp, T.G.; Sämann, P.G.; Frodl, T.; Jahanshad, N.; Loehrer, E.; Tiemeier, H.; Hofman, A.; Niessen, W.J.; et al. Subcortical brain alterations in major depressive disorder: Findings from the ENIGMA Major Depressive Disorder working group. Mol. Psychiatry 2016, 21, 806–812. [Google Scholar] [CrossRef] [PubMed]
- Pizzagalli, D.A.; Roberts, A.C. Prefrontal cortex and depression. Neuropsychopharmacology 2022, 47, 225–246. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Sun, L.H.; Yang, W.; Cui, R.J.; Xu, S.B. The Role of BDNF in the Neuroimmune Axis Regulation of Mood Disorders. Front. Neurol. 2019, 10, 515. [Google Scholar] [CrossRef]
- Levada, O.A.; Troyan, A.S. Insulin-like growth factor-1: A possible marker for emotional and cognitive disturbances, and treatment effectiveness in major depressive disorder. Ann. Gen. Psychiatry 2017, 16, 38. [Google Scholar] [CrossRef] [PubMed]
- Mondal, A.C.; Fatima, M. Direct and indirect evidences of BDNF and NGF as key modulators in depression: Role of antidepressants treatment. Int. J. Neurosci. 2019, 129, 283–296. [Google Scholar] [CrossRef]
- Deng, Z.; Deng, S.; Zhang, M.-R.; Tang, M.-M. Fibroblast Growth Factors in Depression. Front. Pharmacol. 2019, 10, 60. [Google Scholar] [CrossRef] [PubMed]
- Troubat, R.; Barone, P.; Leman, S.; Desmidt, T.; Cressant, A.; Atanasova, B.; Brizard, B.; El Hage, W.; Surget, A.; Belzung, C.; et al. Neuroinflammation and depression: A review. Eur. J. Neurosci. 2021, 53, 151–171. [Google Scholar] [CrossRef]
- Grygiel-Górniak, B.; Limphaibool, N.; Puszczewicz, M. Cytokine secretion and the risk of depression development in patients with connective tissue diseases. Psychiatry Clin. Neurosci. 2019, 73, 302–316. [Google Scholar] [CrossRef]
- Lourenco, M.V.; Frozza, R.L.; de Freitas, G.B.; Zhang, H.; Kincheski, G.C.; Ribeiro, F.C.; Gonçalves, R.A.; Clarke, J.R.; Beckman, D.; Staniszewski, A.; et al. Exercise-linked FNDC5/irisin rescues synaptic plasticity and memory defects in Alzheimer’s models. Nat. Med. 2019, 25, 165–175. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.R.; Valaris, S.; Young, M.F.; Haley, E.B.; Luo, R.; Bond, S.F.; Mazuera, S.; Kitchen, R.R.; Caldarone, B.J.; Bettio, L.E.B.; et al. Exercise hormone irisin is a critical regulator of cognitive function. Nat. Metab. 2021, 3, 1058–1070. [Google Scholar] [CrossRef] [PubMed]
- Pandya, M.; Altinay, M.; Malone, D.A.; Anand, A. Where in the Brain Is Depression? Curr. Psychiatry Rep. 2012, 14, 634–642. [Google Scholar] [CrossRef] [PubMed]
- Neto, F.L.; Borges, G.; Torres-Sanchez, S.; Mico, J.A.; Berrocoso, E. Neurotrophins role in depression neurobiology: A review of basic and clinical evidence. Curr. Neuropharmacol. 2011, 9, 530–552. [Google Scholar] [CrossRef] [PubMed]
- Wiener, C.D.; de Mello Ferreira, S.; Pedrotti Moreira, F.; Bittencourt, G.; de Oliveira, J.F.; Lopez Molina, M.; Jansen, K.; de Mattos Souza, L.D.; Rizzato Lara, D.; Portela, L.V.; et al. Serum levels of nerve growth factor (NGF) in patients with major depression disorder and suicide risk. J. Affect Disord. 2015, 184, 245–248. [Google Scholar] [CrossRef]
- Cunha, A.B.; Frey, B.N.; Andreazza, A.C.; Goi, J.D.; Rosa, A.R.; Gonçalves, C.A.; Santin, A.; Kapczinski, F. Serum brain-derived neurotrophic factor is decreased in bipolar disorder during depressive and manic episodes. Neurosci. Lett. 2006, 398, 215–219. [Google Scholar] [CrossRef]
- Yoshida, T.; Ishikawa, M.; Niitsu, T.; Nakazato, M.; Watanabe, H.; Shiraishi, T.; Shiina, A.; Hashimoto, T.; Kanahara, N.; Hasegawa, T.; et al. Decreased serum levels of mature brain-derived neurotrophic factor (BDNF), but not its precursor proBDNF, in patients with major depressive disorder. PLoS ONE 2012, 7, e42676. [Google Scholar] [CrossRef] [PubMed]
- Molendijk, M.L.; Spinhoven, P.; Polak, M.; Bus, B.A.; Penninx, B.W.; Elzinga, B.M. Serum BDNF concentrations as peripheral manifestations of depression: Evidence from a systematic review and meta-analyses on 179 associations (N = 9484). Mol. Psychiatry 2014, 19, 791–800. [Google Scholar] [CrossRef]
- Carniel, B.P.; da Rocha, N.S. Brain-derived neurotrophic factor (BDNF) and inflammatory markers: Perspectives for the management of depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2021, 108, 110151. [Google Scholar] [CrossRef]
- Filho, C.B.; Jesse, C.R.; Donato, F.; Giacomeli, R.; Del Fabbro, L.; da Silva Antunes, M.; de Gomes, M.G.; Goes, A.T.; Boeira, S.P.; Prigol, M.; et al. Chronic unpredictable mild stress decreases BDNF and NGF levels and Na (+),K (+)-ATPase activity in the hippocampus and prefrontal cortex of mice: Antidepressant effect of chrysin. Neuroscience 2015, 289, 367–380. [Google Scholar] [CrossRef] [PubMed]
- Kubera, M.; Obuchowicz, E.; Goehler, L.; Brzeszcz, J.; Maes, M. In animal models, psychosocial stress-induced (neuro)inflammation, apoptosis and reduced neurogenesis are associated to the onset of depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2011, 35, 744–759. [Google Scholar] [CrossRef] [PubMed]
- Lima-Filho, R.; Fortuna, J.S.; Cozachenco, D.; Isaac, A.R.; Lyra, E.; Silva, N.; Saldanha, A.; Santos, L.E.; Ferreira, S.T.; Lourenco, M.V.; et al. Brain FNDC5/Irisin Expression in Patients and Mouse Models of Major Depression. eNeuro 2023, 10. [Google Scholar] [CrossRef] [PubMed]
- Riva, M.A.; Molteni, R.; Bedogni, F.; Racagni, G.; Fumagalli, F. Emerging role of the FGF system in psychiatric disorders. Trends Pharmacol. Sci 2005, 26, 228–231. [Google Scholar] [CrossRef]
- Gaughran, F.; Payne, J.; Sedgwick, P.M.; Cotter, D.; Berry, M. Hippocampal FGF-2 and FGFR1 mRNA expression in major depression, schizophrenia and bipolar disorder. Brain Res. Bull. 2006, 70, 221–227. [Google Scholar] [CrossRef]
- Duman, R.S.; Monteggia, L.M. A neurotrophic model for stress-related mood disorders. Biol. Psychiatry 2006, 59, 1116–1127. [Google Scholar] [CrossRef]
- Bland, S.T.; Tamlyn, J.P.; Barrientos, R.M.; Greenwood, B.N.; Watkins, L.R.; Campeau, S.; Day, H.E.; Maier, S.F. Expression of fibroblast growth factor-2 and brain-derived neurotrophic factor mRNA in the medial prefrontal cortex and hippocampus after uncontrollable or controllable stress. Neuroscience 2007, 144, 1219–1228. [Google Scholar] [CrossRef]
- Maragnoli, M.E.; Fumagalli, F.; Gennarelli, M.; Racagni, G.; Riva, M.A. Fluoxetine and olanzapine have synergistic effects in the modulation of fibroblast growth factor 2 expression within the rat brain. Biol. Psychiatry 2004, 55, 1095–1102. [Google Scholar] [CrossRef]
- Elsayed, M.; Banasr, M.; Duric, V.; Fournier, N.M.; Licznerski, P.; Duman, R.S. Antidepressant effects of fibroblast growth factor-2 in behavioral and cellular models of depression. Biol. Psychiatry 2004, 72, 258–265. [Google Scholar] [CrossRef] [PubMed]
- Russo, V.C.; Gluckman, P.D.; Feldman, E.L.; Werther, G.A. The insulin-like growth factor system and its pleiotropic functions in brain. Endocr. Rev. 2005, 26, 916–943. [Google Scholar] [CrossRef] [PubMed]
- Basta-Kaim, A.; Szczesny, E.; Glombik, K.; Stachowicz, K.; Slusarczyk, J.; Nalepa, I.; Zelek-Molik, A.; Rafa-Zablocka, K.; Budziszewska, B.; Kubera, M.; et al. Prenatal stress affects insulin-like growth factor-1 (IGF-1) level and IGF-1 receptor phosphorylation in the brain of adult rats. Eur. Neuropsychopharmacol. 2014, 24, 1546–1556. [Google Scholar] [CrossRef] [PubMed]
- Dowlati, Y.; Herrmann, N.; Swardfager, W.; Liu, H.; Sham, L.; Reim, E.K.; Lanctôt, K.L. A meta-analysis of cytokines in major depression. Biol. Psychiatry 2010, 67, 446–457. [Google Scholar] [CrossRef] [PubMed]
- Passos, I.C.; Vasconcelos-Moreno, M.P.; Costa, L.G.; Kunz, M.; Brietzke, E.; Quevedo, J.; Salum, G.; Magalhães, P.V.; Kapczinski, F.; Kauer-Sant’Anna, M. Inflammatory markers in post-traumatic stress disorder: A systematic review, meta-analysis, and meta-regression. Lancet Psychiatry 2015, 2, 1002–1012. [Google Scholar] [CrossRef] [PubMed]
- Tang, M.; Lin, W.; Pan, Y.; Guan, X.; Li, Y. Hippocampal neurogenesis dysfunction linked to depressive-like behaviors in a neuroinflammation induced model of depression. Physiol. Behav. 2016, 161, 166–173. [Google Scholar] [CrossRef]
- Li, S.; Xu, Y.; Zheng, L.; Pang, H.; Zhang, Q.; Lou, L.; Huang, X. Sex Difference in Global Burden of Major Depressive Disorder: Findings from the Global Burden of Disease Study 2019. Front. Psychiatry 2022, 13, 789305. [Google Scholar] [CrossRef]
- Chan, C.B.; Ye, K. Sex differences in brain-derived neurotrophic factor signaling and functions. Neurosci. Res. 2017, 95, 328–335. [Google Scholar] [CrossRef]
- Scharfman, H.E.; Hintz, T.M.; Gomez, J.; Stormes, K.A.; Barouk, S.; Malthankar-Phatak, G.H.; McCloskey, D.P.; Luine, V.N.; Maclusky, N.J. Changes in hippocampal function of ovariectomized rats after sequential low doses of estradiol to simulate the preovulatory estrogen surge. Eur. J. Neurosci. 2007, 26, 2595–2612. [Google Scholar] [CrossRef]
- Liu, Y.; Fowler, C.D.; Young, L.J.; Yan, Q.; Insel, T.R.; Wang, Z. Expression and estrogen regulation of brain-derived neurotrophic factor gene and protein in the forebrain of female prairie voles. J. Comp. Neurol. 2001, 433, 499–514. [Google Scholar] [CrossRef]
- Pan, Y.; Anthony, M.; Clarkson, T.B. Evidence for up-regulation of brain-derived neurotrophic factor mRNA by soy phytoestrogens in the frontal cortex of retired breeder female rats. Neurosci. Lett. 1999, 261, 17–20. [Google Scholar] [CrossRef] [PubMed]
- Solum, D.T.; Handa, R.J. Estrogen regulates the development of brain-derived neurotrophic factor mRNA and protein in the rat hippocampus. J. Neurosci. 2002, 22, 2650–2659. [Google Scholar] [CrossRef] [PubMed]
- Luine, V.; Frankfurt, M. Interactions between estradiol, BDNF and dendritic spines in promoting memory. Neuroscience 2013, 239, 34–45. [Google Scholar] [CrossRef] [PubMed]
- Hayley, S.; Du, L.; Litteljohn, D.; Palkovits, M.; Faludi, G.; Merali, Z.; Poulter, M.O.; Anisman, H. Gender and brain regions specific differences in brain derived neurotrophic factor protein levels of depressed individuals who died through suicide. Neurosci. Lett. 2015, 600, 12–16. [Google Scholar] [CrossRef]
- Kim, M.H.; Leem, Y.H. The effects of peripherally-subacute treatment with irisin on hippocampal dendritogenesis and astrocyte-secreted factors. J. Exerc. Nutr. Bio-Chem. 2019, 23, 32–35. [Google Scholar] [CrossRef] [PubMed]
- Porsolt, R.D.; Le Pichon, M.; Jalfre, M. Depression: A new animal model sensitive to antidepressant treatments. Nature 1977, 266, 730–732. [Google Scholar] [CrossRef]
- Porsolt, R.D.; Bertin, A.; Jalfre, M. Behavioral despair in mice: A primary screening test for antidepressants. Arch. Int. Pharmacodyn. Ther. 1977, 229, 327–336. [Google Scholar]
- Levy, M.J.F.; Boulle, F.; Steinbusch, H.W.; van den Hove, D.L.A.; Kenis, G.; Lanfumey, L. Neurotrophic factors and neuroplasticity pathways in the pathophysiology and treatment of depression. Psychopharmacology 2018, 235, 2195–2220. [Google Scholar] [CrossRef]
- Hill, A.S.; Sahay, A.; Hen, R. Increasing adult hippocampal neurogenesis is sufficient to reduce anxiety and depression-like behaviors. Neuropsychopharmacology 2015, 40, 2368–2378. [Google Scholar] [CrossRef]
- Sharp, T. Molecular and cellular mechanisms of antidepressant action. Curr. Top. Behav. Neurosci. 2013, 14, 309–325. [Google Scholar]
Brain Regions | Genes | Factors | ||
---|---|---|---|---|
Treatment | Sex | Treatment × Sex | ||
Hippocampus | Bdnf | F (1,20) = 1.058; p = 0.316 | F (1,20) = 4.33; p = 0.051 | F (1,20) = 1.177; p = 0.291 |
Ngf | F (1,20) = 3.493; p = 0.076 | F (1,20) = 0.259; p = 0.616 | F (1,20) = 0.359; p = 0.556 | |
Fgf-2 | F (1,20) = 7.395; p = 0.013 | F (1,20) = 0.233; p = 0.634 | F (1,20) = 0.267; p = 0.611 | |
Igf-1 | F (1,18) = 0.633; p = 0.437 | F (1,18) = 0.00292; p = 0.956 | F (1,18) = 1.345; p = 0.261 | |
Il-6 | F (1,18) = 0.739; p = 0.401 | F (1,18) = 2.685; p = 0.119 | F (1,18) = 0.018; p = 0.893 | |
Il-1β | F (1,18) = 1.452; p = 0.244 | F (1,18) = 0.485; p = 0.495 | F (1,18) = 1.002; p = 0.330 | |
PFC | Bdnf | F (1,20) = 28.13; p < 0.0001 | F (1,20) = 2; p = 0.173 | F (1,20) = 8.413; p = 0.009 |
Ngf | F (1,20) = 0.492; p = 0.491 | F (1,20) = 0.538; p = 0.472 | F (1,20) = 5.154; p = 0.034 | |
Fgf-2 | F (1,19) = 3.464; p = 0.078 | F (1,19) = 0.596; p = 0.449 | F (1,19) = 0.029; p = 0.866 | |
Igf-1 | F (1,20) = 0.300; p = 0.589 | F (1,20) = 1.364; p = 0.257 | F (1,20) = 0.282; p = 0.601 | |
Il-6 | F (1,20) = 3.526; p = 0.075 | F (1,20) = 0.025; p = 0.876 | F (1,20) = 0.625; p = 0.439 | |
Il-1β | F (1,20) = 0.347; p = 0.562 | F (1,20) = 1.182; p = 0.289 | F (1,20) = 1.519; p = 0.232 |
Gene | Comparison | t Value | Df | p Value |
---|---|---|---|---|
Bdnf | Female vehicle vs. female irisin | t = 0.050 | 12 | 0.960 |
Female vehicle vs. male vehicle | t = 2.402 | 10 | 0.037 | |
Female vehicle vs. male irisin | t = 0.699 | 10 | 0.500 | |
Female irisin vs. male vehicle | t = 2.361 | 10 | 0.040 | |
Female irisin vs. male irisin | t = 0.662 | 10 | 0.523 | |
Male vehicle vs. male irisin | t = 1.173 | 8 | 0.275 | |
Ngf | Female vehicle vs. female irisin | t = 2.120 | 12 | 0.056 |
Female vehicle vs. male vehicle | t = 0.957 | 10 | 0.361 | |
Female vehicle vs. male irisin | t = 1.766 | 10 | 0.108 | |
Female irisin vs. male vehicle | t = 0.919 | 10 | 0.379 | |
Female irisin vs. male irisin | t = 0.055 | 10 | 0.957 | |
Male vehicle vs. male irisin | t = 0.735 | 8 | 0.484 | |
Fgf-2 | Female vehicle vs. female irisin | t = 1.463 | 12 | 0.169 |
Female vehicle vs. male vehicle | t = 0.729 | 10 | 0.483 | |
Female vehicle vs. male irisin | t = 1.564 | 10 | 0.149 | |
Female irisin vs. male vehicle | t = 2.291 | 10 | 0.045 | |
Female irisin vs. male irisin | t = 0.023 | 10 | 0.982 | |
Male vehicle vs. male irisin | t = 3.122 | 8 | 0.014 | |
Igf-1 | Female vehicle vs. female irisin | t = 0.266 | 11 | 0.795 |
Female vehicle vs. male vehicle | t = 0.762 | 9 | 0.466 | |
Female vehicle vs. male irisin | t = 0.529 | 8 | 0.612 | |
Female irisin vs. male vehicle | t = 0.596 | 10 | 0.565 | |
Female irisin vs. male irisin | t = 0.885 | 9 | 0.399 | |
Male vehicle vs. male irisin | t = 1.449 | 7 | 0.191 | |
Il-6 | Female vehicle vs. female irisin | t = 0.711 | 10 | 0.493 |
Female vehicle vs. male vehicle | t = 1.026 | 10 | 0.329 | |
Female vehicle vs. male irisin | t = 0.511 | 10 | 0.620 | |
Female irisin vs. male vehicle | t = 2.069 | 8 | 0.072 | |
Female irisin vs. male irisin | t = 1.355 | 8 | 0.213 | |
Male vehicle vs. male irisin | t = 0.513 | 8 | 0.622 | |
Il-1β | Female vehicle vs. female irisin | t = 0.179 | 11 | 0.861 |
Female vehicle vs. male vehicle | t = 0.910 | 9 | 0.386 | |
Female vehicle vs. male irisin | t = 0.433 | 10 | 0.674 | |
Female irisin vs. male vehicle | t = 1.128 | 8 | 0.292 | |
Female irisin vs. male irisin | t = 0.388 | 9 | 0.707 | |
Male vehicle vs. male irisin | t = 1.247 | 7 | 0.253 |
Gene | Comparison | t Value | df | p Value |
---|---|---|---|---|
Fgf-2 | Female vehicle vs. female irisin | t = 2.427 | 11 | 0.034 |
Female vehicle vs. male vehicle | t = 0.932 | 10 | 0.373 | |
Female vehicle vs. male irisin | t = 1.734 | 10 | 0.114 | |
Female irisin vs. male vehicle | t = 0.855 | 9 | 0.415 | |
Female irisin vs. male irisin | t = 0.339 | 9 | 0.743 | |
Male vehicle vs. male irisin | t = 0.834 | 8 | 0.429 | |
Igf-1 | Female vehicle vs. female irisin | t = 0.012 | 12 | 0.991 |
Female vehicle vs. male vehicle | t = 1.082 | 10 | 0.305 | |
Female vehicle vs. male irisin | t = 0.412 | 10 | 0.689 | |
Female irisin vs. male vehicle | t = 1.301 | 10 | 0.223 | |
Female irisin vs. male irisin | t = 0.514 | 10 | 0.619 | |
Male vehicle vs. male irisin | t = 0.808 | 8 | 0.442 | |
Il-6 | Female vehicle vs. female irisin | t = 0.863 | 12 | 0.405 |
Female vehicle vs. male vehicle | t = 0.424 | 10 | 0.681 | |
Female vehicle vs. male irisin | t = 1.212 | 10 | 0.253 | |
Female irisin vs. male vehicle | t = 1.583 | 10 | 0.145 | |
Female irisin vs. male irisin | t = 0.712 | 10 | 0.493 | |
Male vehicle vs. male irisin | t = 1.688 | 8 | 0.130 | |
Il-1β | Female vehicle vs. female irisin | t = 1.223 | 12 | 0.245 |
Female vehicle vs. male vehicle | t = 0.098 | 10 | 0.924 | |
Female vehicle vs. male irisin | t = 0.320 | 10 | 0.755 | |
Female irisin vs. male vehicle | t = 1.332 | 10 | 0.212 | |
Female irisin vs. male irisin | t = 1.740 | 10 | 0.112 | |
Male vehicle vs. male irisin | t = 0.595 | 8 | 0.569 |
Gene Name | Gene Bank Number | Primer Sequence (5′–3′) | Product Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|
Gapdh | NM_001289726.1 | Forward ACACCAGTAGACTCCACGACA Reverse ACGGCAAATTCAACGGCACAG | 145 | 60.48 62.59 |
Bdnf | NM_001048139.1 | Forward TGAAGTTGGCTTCCTAGCGG Reverse CCTGGTGGAACTTCTTTGCG | 146 | 60.04 59.41 |
Ngf | NM_001112698.2 | Forward GGAGCGCATCGAGTTTTGG Reverse CCTCACTGCGGCCAGTATAG | 136 | 59.57 59.97 |
Fgf-2 | NM_008006.2 | Forward GCTGCTGGCTTCTAAGTGTG Reverse GTCCAGGTCCCGTTTTGGAT | 158 | 59.20 59.96 |
Igf-1 | NM_001111276.1 | Forward TGCCTGGGTGTCCAAATGTA Reverse TGTATCTTTATTGCAGGTGCGG | 170 | 59.23 59.06 |
Il-6 | NM_001314054.1 | Forward CCAAGAGATAAGCTGGAGTCACA Reverse CGCACTAGGTTTGCCGAGTA | 121 | 59.80 60.11 |
Il-1β | NM_008361.4 | Forward TGCCACCTTTTGACAGTGATG Reverse ATGTGCTGCTGCGAGATTTG | 136 | 59.04 59.55 |
Il-4 | NM_021283.2 | Forward TCACAGCAACGAAGAACACCA Reverse CAGGCATCGAAAAGCCCGAA | 158 | 60.41 61.31 |
Il-10 | NM_010548.2 | Forward GTAGAAGTGATGCCCCAGGC Reverse CACCTTGGTCTTGGAGCTTATT | 187 | 60.46 58.31 |
Il-1ra | NM_001039701.3 | Forward GTGGCCTCGGGATGGAAAT Reverse TGGTTAGTATCCCAGATTCTGAAGG | 148 | 59.77 59.63 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dicarlo, M.; Pignataro, P.; Zerlotin, R.; Suriano, C.; Zecca, C.; Dell’Abate, M.T.; Storlino, G.; Oranger, A.; Sanesi, L.; Mori, G.; et al. Short-Term Irisin Treatment Enhanced Neurotrophin Expression Differently in the Hippocampus and the Prefrontal Cortex of Young Mice. Int. J. Mol. Sci. 2023, 24, 9111. https://doi.org/10.3390/ijms24119111
Dicarlo M, Pignataro P, Zerlotin R, Suriano C, Zecca C, Dell’Abate MT, Storlino G, Oranger A, Sanesi L, Mori G, et al. Short-Term Irisin Treatment Enhanced Neurotrophin Expression Differently in the Hippocampus and the Prefrontal Cortex of Young Mice. International Journal of Molecular Sciences. 2023; 24(11):9111. https://doi.org/10.3390/ijms24119111
Chicago/Turabian StyleDicarlo, Manuela, Patrizia Pignataro, Roberta Zerlotin, Clelia Suriano, Chiara Zecca, Maria Teresa Dell’Abate, Giuseppina Storlino, Angela Oranger, Lorenzo Sanesi, Giorgio Mori, and et al. 2023. "Short-Term Irisin Treatment Enhanced Neurotrophin Expression Differently in the Hippocampus and the Prefrontal Cortex of Young Mice" International Journal of Molecular Sciences 24, no. 11: 9111. https://doi.org/10.3390/ijms24119111