The Placenta—A New Source of Bile Acids during Healthy Pregnancy? First Results of a Gene Expression Study in Humans and Mice
Abstract
:1. Introduction
2. Results and Discussion
3. Materials and Methods
3.1. Collection of Human Placenta and Liver Samples
3.2. Animal Tissue Collection
3.3. Isolation, Characterization, and Culturing of Cells
3.4. Quantitative RT-PCR
3.5. Mathematical Evaluation
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Russell, D.W. The enzymes, regulation, and genetics of bile acid synthesis. Annu. Rev. Biochem. 2003, 72, 137–174. [Google Scholar] [CrossRef] [PubMed]
- Russell, D.W.; Setchell, K.D.R. Bile acid biosynthesis. Biochemistry 1992, 31, 4737–4749. [Google Scholar] [CrossRef]
- Chiang, J.Y.L. Bile acids: Regulation of synthesis. J. Lipid Res. 2009, 50, 1955–1966. [Google Scholar] [CrossRef]
- Hofmann, A.F. The enterohepatic circulation of bile acids in mammals: Form and functions. Front. Biosci.-Landmark 2009, 14, 2584–2598. [Google Scholar] [CrossRef]
- Monteiro-Cardoso, V.F.; Corlianò, M.; Singaraja, R.R. Bile Acids: A Communication Channel in the Gut-Brain Axis. NeuroMolecular Med. 2021, 23, 99–117. [Google Scholar] [CrossRef] [PubMed]
- Pan, X.; Elliott, C.T.; McGuinness, B.; Passmore, P.; Kehoe, P.G.; Hölscher, C.; McClean, P.L.; Graham, S.F.; Green, B.D. Metabolomic profiling of bile acids in clinical and experimental samples of Alzheimer’s disease. Metabolites 2017, 7, 28. [Google Scholar] [CrossRef]
- Milona, A.; Owen, B.M.; Cobbold, J.F.L.; Willemsen, E.C.L.; Cox, I.J.; Boudjelal, M.; Cairns, W.; Schoonjans, K.; Taylor-Robinson, S.D.; Klomp, L.W.J.; et al. Raised hepatic bile acid concentrations during pregnancy in mice are associated with reduced farnesoid X receptor function. Hepatology 2010, 52, 1341–1349. [Google Scholar] [CrossRef] [PubMed]
- Castaño, G.; Lucangioli, S.; Sookoian, S.; Mesquida, M.; Lemberg, A.; Di Scala, M.; Franchi, P.; Carducci, C.; Tripodi, V. Bile acid profiles by capillary electrophoresis in intrahepatic cholestasis of pregnancy. Clin. Sci. 2006, 110, 459–465. [Google Scholar] [CrossRef] [PubMed]
- Egan, N.; Bartels, Ä.; Khashan, A.S.; Broadhurst, D.I.; Joyce, C.; O’Mullane, J.; O’Donoghue, K. Reference standard for serum bile acids in pregnancy. BJOG Int. J. Obstet. Gynaecol. 2012, 119, 493–498. [Google Scholar] [CrossRef] [PubMed]
- Colombo, C.; Roda, A.; Roda, E.; Buscaglia, M.; Dell’Agnola, C.A.; Filippetti, P.; Ronchi, M.; Sereni, F. Correlation between fetal and maternal serum bile acid concentration. Pediatr. Res. 1985, 19, 227–231. [Google Scholar] [CrossRef]
- Sasaki, H. Development of Bile Acid Metabolism in Neonates during Perinatal Period Part 1: Bile acid levels in sera of Mothers, fetuses and neonates. Pediatr. Int. 1984, 26, 150–160. [Google Scholar] [CrossRef]
- Itoh, S.; Onishi, S.; Isobe, K.; Manabe, M.; Inukai, K. Foetomaternal relationships of serum bile acid pattern estimated by high-pressure liquid chromatography. Biochem. J. 1982, 204, 141–145. [Google Scholar] [CrossRef] [PubMed]
- Geenes, V.; Lövgren-Sandblom, A.; Benthin, L.; Lawrence, D.; Chambers, J.; Gurung, V.; Thornton, J.; Chappell, L.; Khan, E.; Dixon, P.; et al. The Reversed Feto-Maternal Bile Acid Gradient in Intrahepatic Cholestasis of Pregnancy Is Corrected by Ursodeoxycholic Acid. PLoS ONE 2014, 9, e83828. [Google Scholar] [CrossRef]
- Ontsouka, E.; Epstein, A.; Kallol, S.; Zaugg, J.; Baumann, M.; Schneider, H.; Albrecht, C. Placental expression of bile acid transporters in intrahepatic cholestasis of pregnancy. Int. J. Mol. Sci. 2021, 22, 10434. [Google Scholar] [CrossRef]
- Sepúlveda, W.H.; González, C.; Cruz, M.A.; Rudolph, M.I. Vasoconstrictive effect of bile acids on isolated human placental chorionic veins. Eur. J. Obstet. Gynecol. Reprod. Biol. 1991, 42, 211–215. [Google Scholar] [CrossRef]
- Lofthouse, E.M.; Torrens, C.; Manousopoulou, A.; Nahar, M.; Cleal, J.K.; O’Kelly, M.I.; Sengers, B.G.; Garbis, S.D.; Lewis, R.M. Ursodeoxycholic acid inhibits uptake and vasoconstrictor effects of taurocholate in human placenta. FASEB J. 2019, 33, 8211–8220. [Google Scholar] [CrossRef] [PubMed]
- De Aguiar Vallim, T.Q.; Tarling, E.J.; Edwards, P.A. Pleiotropic roles of bile acids in metabolism. Cell Metab. 2013, 17, 657–669. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Jia, Z.H.; Wei, X.R.; Ma, S.; Lu, T.C.; Li, T.T.; Gu, Y.Y. Role of bile acid on maintaining metabolic homeostasis. J. Shanghai Jiaotong Univ. Med. Sci. 2020, 40, 1126–1130. [Google Scholar]
- Kawamata, Y.; Fujii, R.; Hosoya, M.; Harada, M.; Yoshida, H.; Miwa, M.; Fukusumi, S.; Habata, Y.; Itoh, T.; Shintani, Y.; et al. A G protein-coupled receptor responsive to bile acids. J. Biol. Chem. 2003, 278, 9435–9440. [Google Scholar] [CrossRef]
- Schroeder, M.; Jakovcevski, M.; Polacheck, T.; Drori, Y.; Luoni, A.; Röh, S.; Zaugg, J.; Ben-Dor, S.; Albrecht, C.; Chen, A. Placental miR-340 mediates vulnerability to activity based anorexia in mice. Nat. Commun. 2018, 9, 1596. [Google Scholar] [CrossRef]
- Schroeder, M.; Jakovcevski, M.; Polacheck, T.; Drori, Y.; Ben-Dor, S.; Röh, S.; Chen, A. Sex dependent impact of gestational stress on predisposition to eating disorders and metabolic disease. Mol. Metab. 2018, 17, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Fisher, M.M.; Yousef, I.M. Sex differences in the bile acid composition of human bile: Studies in patients with and without gallstones. Can. Med. Assoc. J. 1973, 109, 190–193. [Google Scholar]
- Payne, A.H.; Hales, D.B. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 2004, 25, 947–970. [Google Scholar] [CrossRef] [PubMed]
- Karahoda, R.; Kallol, S.; Groessl, M.; Ontsouka, E.; Anderle, P.; Fluck, C.; Staud, F.; Albrecht, C. Revisiting steroidogenic pathways in the human placenta and primary human trophoblast cells. Int. J. Mol. Sci. 2021, 22, 1704. [Google Scholar] [CrossRef]
- Fuenzalida, B.; Cantin, C.; Kallol, S.; Carvajal, L.; Pastén, V.; Contreras-Duarte, S.; Albrecht, C.; Gutierrez, J.; Leiva, A. Cholesterol uptake and efflux are impaired in human trophoblast cells from pregnancies with maternal supraphysiological hypercholesterolemia. Sci. Rep. 2020, 10, 5264. [Google Scholar] [CrossRef]
- Guzmán-Gutiérrez, E.; Westermeier, F.; Salomón, C.; González, M.; Pardo, F.; Leiva, A.; Sobrevia, L. Insulin-increased L-arginine transport requires A2A adenosine receptors activation in human umbilical vein endothelium. PLoS ONE 2012, 7, e41705. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Baumann, M.; Nikitina, L.; Wenger, F.; Surbek, D.; Körner, M.; Albrecht, C. RNA degradation differentially affects quantitative mRNA measurements of endogenous reference genes in human placenta. Placenta 2013, 34, 544–547. [Google Scholar] [CrossRef] [PubMed]
Genes | Tissue | Detection | Mean ± SD a Ct Values | Range of Ct Values 1 |
---|---|---|---|---|
ACOX2 | Placenta (n = 12) | 8/12 | 35.4 ± 2.82 | 32.5–39.5 |
Liver (n = 3) | 3/3 | 23.8 ± 2.26 | 21.5–26.0 | |
AKR1C4 | Placenta (n = 12) | 12/12 | 30.5 ± 2.78 | 23.2–33.1 |
Liver (n = 3) | 3/3 | 19.6 ± 0.55 | 19.2–20.2 | |
AKR1D1 | Placenta (n = 12) | 5/12 | 37.8 ± 1.88 | 34.9–39.9 |
Liver (n = 3) | 3/3 | 26.4 ± 6.32 | 19.5–31.9 | |
BAAT | Placenta (n = 12) | 1/12 | 39.5 | - |
Liver (n = 3) | 3/3 | 24.7 ± 0.44 | 24.2–25.0 | |
CYP7A1 | Placenta (n = 12) | 4/12 | 35.6 ± 2.21 | 32.3–37.1 |
Liver (n = 3) | 3/3 | 26.6 ± 4.63 | 23.6–31.9 | |
CYP7B1 | Placenta (n = 12) | 11/12 | 34.6 ± 5.11 | 20.7–38.7 |
Liver (n = 3) | 3/3 | 28.5 ± 1.79 | 27.5–30.6 | |
CYP8B1 | Placenta (n = 12) | 12/12 | 33.5 ± 3.46 | 24.9–38.2 |
Liver (n = 3) | 3/3 | 26.7 ± 2.11 | 24.3–28.0 | |
CYP27A1 | Placenta (n = 12) | 10/12 | 32.9 ± 3.35 | 29.7–38.9 |
Liver (n = 3) | 3/3 | 21.4 ± 1.30 | 20.1–22.7 | |
CYP39A1 | Placenta (n = 12) | 12/12 | 31.1 ± 3.33 | 22.6–35.3 |
Liver (n = 3) | 3/3 | 22.7 ± 1.03 | 21.6–23.6 | |
CYP46A1 | Placenta (n = 12) | 5/12 | 38.4 ± 0.75 | 37.7–39.5 |
Liver (n = 3) | 3/3 | 31.5 ± 2.18 | 29.6–33.9 | |
CH25H | Placenta (n = 12) | 12/12 | 31.7 ± 3.44 | 23.7–37.7 |
Liver (n = 3) | 3/3 | 29.4 ± 1.78 | 28.1–30.4 | |
HSD3B7 | Placenta (n = 12) | 10/12 | 33.7 ± 3.94 | 28.9–39.7 |
Liver (n = 3) | 3/3 | 25.4 ± 2.35 | 23.1–27.8 | |
HSD17B1 | Placenta (n = 12) | 12/12 | 25.5 ± 4.78 | 21.3–37.0 |
Liver (n = 3) | 3/3 | 32.7 ± 2.94 | 29.3–34.4 | |
SLC27A2 | Placenta (n = 12) | 11/12 | 32.3 ± 4.29 | 26.9–38.9 |
Liver (n = 3) | 3/3 | 22.0 ± 1.26 | 20.7–23.2 | |
SCP2 | Placenta (n = 12) | 12/12 | 29.9 ± 4.07 | 19.7–34.7 |
Liver (n = 3) | 3/3 | 25.8 ± 3.13 | 22.2–27.9 | |
YWHAZ | Placenta (n = 12) | 12/12 | 26.5 ± 3.11 | 20.9–30.4 |
Liver (n = 3) | 3/3 | 24.1 ± 0.7 | 23.0–24.7 | |
Ubiquitin | Placenta (n = 12) | 12/12 | 23.4 ± 2.15 | 20.0–27.0 |
Liver (n = 3) | 3/3 | 23.3 ± 0.77 | 22.4–23.9 |
Genes | Primary Cytotrophoblasts (CTB; n = 5) | Primary Syncytiotrophoblasts (STB; n = 5) | Human Umbilical Vein Endothelial Cells (HUVEC; n = 2) |
---|---|---|---|
CYP7A1 CT value Similarity to placental tissue | 31.0 ± 1.26 No | 31.4 ± 1.30 No | n/d Yes |
CYP27A1 CT value Similarity to placental tissue | 29.1 ± 2.47 Yes | 28.2 ± 4.68 Yes | 28.3 ± 0.06 Yes |
CYP46A1 CT value Similarity to placental tissue | n/d Yes | n/d Yes | n/d Yes |
CH25H CT value Similarity to placental tissue | 29.3 ± 2.69 Yes | 28.7 ± 2.63 Yes | 32.9 ± 1.02 Yes |
CYP39A1 CT value Similarity to placental tissue | 25.9 ± 1.03 Yes | 24.8 ± 1.84 Yes | 30.3 ± 0.83 Yes |
CYP7B1 CT value Similarity to placental tissue | n/d No | n/d No | n/d No |
CYP8B1 CT value Similarity to placental tissue | 31.2 ± 1.70 Yes | 30.2 ± 2.03 Yes | 35.2 ± 0.72 Yes |
HSD3B7 CT value Similarity to placental tissue | 28.4 ± 0.18 Yes | 29.0 ± 0.33 Yes | 26.3 ± 0.44 Yes |
HSD17B1 CT value Similarity to placental tissue | 24.3 ± 3.73 Yes | 25.6 ± 4.35 Yes | 28.1 ± 3.92 Yes |
ACOX2 CT value Similarity to placental tissue | n/d Yes | n/d Yes | n/d Yes |
AKR1D1 CT value Similarity to placental tissue | 26.9 ± 1.65 No | 25.7 ± 1.85 No | 32.4 ± 1.90 No |
AKR1C4 CT value Similarity to placental tissue | 24.0 ± 1.63 Yes | 24.1 ± 1.53 Yes | 32.9 ± 3.65 Yes |
SLC27A2 CT value Similarity to placental tissue | 24.5 ± 1.11 Yes | 24.6 ± 0.59 Yes | 34.9 ± 0.21 Yes |
BAAT CT value Similarity to placental tissue | n/d Yes | n/d Yes | n/d Yes |
SCP2 CT value Similarity to placental tissue | 21.8 ± 1.51 Yes | 21.5 ± 1.50 Yes | 33.8 ± 0.19 Yes |
YWHAZ CT value Similarity to placental tissue | 21.8 ± 2.66 Yes | 21.9 ± 1.19 Yes | 22.5 ± 0.21 Yes |
Ubiquitin CT value Similarity to placental tissue | 24.3 ± 2.63 Yes | 25.3 ± 1.89 Yes | 19.5 ± 0.1 Yes |
Parameter | Clinical Data | ||
---|---|---|---|
Gravidity | Median = 2 | 25–75% = 1.5–2.5 | Range 1–3 |
Parity | Median = 2 | 25–75% = 1–2.5 | Range 1–3 |
Gestational age (weeks) | Mean = 39.4 | SD = 0.9 | Range 38–41 |
Maternal age (years) | Mean = 32.6 | SD = 4.6 | Range 27–38 |
Smoking/drugs | 0/12 | ||
Birth weight (gram) | Mean = 3525 | SD = 211 | Range 3300–3736 |
Placental weight (gram) | Mean = 649 | SD = 155 | Range 500–800 |
Sex offspring | Male = 6 | Female = 6 |
Gene | Forward Primer (5′-> 3′) | Reverse Primer (5′-> 3′) | Acc. Number |
---|---|---|---|
ACOX2 | CCGCAGGAAAGTTGAGAGCA | AAGGCCACGTCTCCAGAAAG | NM_003500.4 |
AKR1C4 | AGATGGTCCAACCAGCCTTG | TGGCTTGAGAGCCATTGGG | NM_001818.5 |
AKR1D1 | CAAACACAAGCCAGTCAGCAAC | GATGATCGCGCCACATGAGC | NM_005989.4 |
BAAT | GTTCTCTTGCTAGGTTTTG | ACCATCTGAAAGGGAATC | NM_001701.4 |
CYP7A1 | TTGCTACTTCTGCGAAGGCA | TCCGTGAGGGAATTCAAGGC | NM_000780.4 |
CYP7B1 | GTTCTTCTTGGTGGAAAG | ATTGATAGCAGAGGTGAA | NM_004820.5 |
CYP8B1 | TACACTCAGCCAGCACCAAG | AAAGAGGCTGTCCTCATGCC | NM_004391.3 |
CYP27A1 | CGGTCCAATGTGGATGTCCT | GTACCAGTGGTGTCCTTCCG | NM_000784.4 |
CYP39A1 | TCGTACAGCATCAATTCCAAAGA | CCATTGTCCCATGAGTGCCT | NM_016593.5 |
CYP46A1 | AGGTCATTGGTTCTAAGAG | ATAGGTGCTGAACAAGAG | NM_006668.2 |
CH25H | ACATACGTGGGCTTTTGCCT | CATGCTGGTAGAGGGTCTGC | NM_003956.4 |
HSD3B7 | GTCTATGTGGGCAATGTT | TCCATCGTAGCAGAAGTA | NM_025193.4 |
HSD17B1 | TTATTGCGCCAGCAAGTTCG | TTCTCCATGAAGGCGGTGTG | NM_000413.4 |
SLC27A2 | ACCACAGGTCTTCCAAAAGCA | AGTCCGCAAGGCAAGAGTAG | NM_003645.4 |
SCP2 | TTAGATAAGAAGGCTGACTG | TACTTACCGACTGAGGAT | AH004933.2 |
YWHAZa | CCGTTACTTGGCTGAGGTTG | AGTTAAGGGCCAGACCCAGT | NM_001135699.2 |
Ubiquitin | TCGCAGCCGGGATTTG | GCATTGTCAAGTGACGATCACA | NM_021009 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ontsouka, E.; Schroeder, M.; Ok, L.; Vaillancourt, C.; Stroka, D.; Albrecht, C. The Placenta—A New Source of Bile Acids during Healthy Pregnancy? First Results of a Gene Expression Study in Humans and Mice. Int. J. Mol. Sci. 2023, 24, 9511. https://doi.org/10.3390/ijms24119511
Ontsouka E, Schroeder M, Ok L, Vaillancourt C, Stroka D, Albrecht C. The Placenta—A New Source of Bile Acids during Healthy Pregnancy? First Results of a Gene Expression Study in Humans and Mice. International Journal of Molecular Sciences. 2023; 24(11):9511. https://doi.org/10.3390/ijms24119511
Chicago/Turabian StyleOntsouka, Edgar, Mariana Schroeder, Linda Ok, Cathy Vaillancourt, Deborah Stroka, and Christiane Albrecht. 2023. "The Placenta—A New Source of Bile Acids during Healthy Pregnancy? First Results of a Gene Expression Study in Humans and Mice" International Journal of Molecular Sciences 24, no. 11: 9511. https://doi.org/10.3390/ijms24119511