Folate and Cobalamin Deficiencies during Pregnancy Disrupt the Glucocorticoid Response in Hypothalamus through N-Homocysteinilation of the Glucocorticoid Receptor
Abstract
:1. Introduction
2. Results
2.1. Effect of Vitamin B9 on One-Carbon Metabolism Markers and Expression of Glucocorticoid Receptor (GR) in the Hypothalamus
2.2. B9-Deficiency Leads to N-Homocysteinilation of GR and Loss of Function
2.3. Behavioral Characterization of Rat Offspring
3. Discussion
4. Materials and Methods
4.1. Animals and Tissue Collection
4.2. Cell Culture
4.3. Measurement of Maternal Plasma Concentrations of Homocysteine, Vitamin B12, and Folate and Offspring Tissue Concentrations of SAM and SAH
4.4. Immunohistochemistry
4.5. Western Blotting
4.6. RNA Extraction and Quantitative RT-PCR
4.7. Mass Spectrometry
4.8. Behavioral Evaluation
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Oliver, M.H.; Jaquiery, A.L.; Bloomfield, F.H.; Harding, J.E. The effects of maternal nutrition around the time of conception on the health of the offspring. Soc. Reprod. Fertil. 2007, 64, 397–410. [Google Scholar] [CrossRef] [PubMed]
- Guéant, J.L.; Caillerez-Fofou, M.; Battaglia-Hsu, S.; Alberto, J.M.; Freund, J.N.; Dulluc, I.; Adjalla, C.; Maury, F.; Merle, C.; Nicolas, J.P.; et al. Molecular and cellular effects of vitamin B12 in brain, myocardium and liver through its role as co-factor of methionine synthase. Biochimie 2013, 95, 1033–1040. [Google Scholar] [CrossRef] [PubMed]
- Ricci, D.; Martinelli, D.; Ferrantini, G.; Lucibello, S.; Gambardella, M.L.; Olivieri, G.; Chieffo, D.; Battaglia, D.; Diodato, D.; Iarossi, G.; et al. Early neurodevelopmental characterization in children with cobalamin C/defect. J. Inherit. Metab. Dis. 2020, 43, 367–374. [Google Scholar] [CrossRef] [PubMed]
- Mattson, M.P.; Shea, T.B. Folate and homocysteine metabolism in neural plasticity and neurodegenerative disorders. Trends Neurosci. 2003, 26, 137–146. [Google Scholar] [CrossRef]
- Blaise, S.A.; Nedelec, E.; Schroeder, H.; Alberto, J.M.; Bossenmeyer-Pourié, C.; Guéant, J.L.; Daval, J.L. Gestational vitamin B deficiency leads to homocysteine-associated brain apoptosis and alters neurobehavioral development in rats. Am. J. Pathol. 2007, 170, 667–679. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Troen, A.M.; Shea-Budgell, M.; Shukitt-Hale, B.; Smith, D.E.; Selhub, J.; Rosenberg, I.H. B-vitamin deficiency causes hyperhomocysteinemia and vascular cognitive impairment in mice. Proc. Natl. Acad. Sci. USA 2008, 105, 12474–12479. [Google Scholar] [CrossRef] [Green Version]
- Daval, J.L.; Blaise, S.; Guéant, J.L. Vitamin B deficiency causes neural cell loss and cognitive impairment in the developing rat. Proc. Natl. Acad. Sci. USA 2009, 6, 106. [Google Scholar] [CrossRef] [Green Version]
- Tomizawa, H.; Matsuzawa, D.; Ishii, D.; Matsuda, S.; Kawai, K.; Mashimo, Y.; Sutoh, C.; Shimizu, E. Methyl-donor deficiency in adolescence affects memory and epigenetic status in the mouse hippocampus. Genes Brain Behav. 2015, 14, 301–309. [Google Scholar] [CrossRef] [Green Version]
- Geoffroy, A.; Saber-Cherif, L.; Pourié, G.; Helle, D.; Umoret, R.; Guéant, J.L.; Bossenmeyer-Pourié, C.; Daval, J.L. Developmental Impairments in a Rat Model of Methyl Donor Deficiency: Effects of a Late Maternal Supplementation with Folic Acid. Int. J. Mol. Sci. 2019, 20, 973. [Google Scholar] [CrossRef] [Green Version]
- Pourié, G.; Martin, N.; Bossenmeyer-Pourié, C.; Akchiche, N.; Guéant-Rodriguez, R.M.; Geoffroy, A.; Jeannesson, E.; El Hajj Chehadeh, S.; Mimoun, K.; Brachet, P.; et al. Folate- and vitamin B12-deficient diet during gestation and lactation alters cerebellar synapsin expression via impaired influence of estrogen nuclear receptor α. FASEB J. 2015, 29, 3713–3725. [Google Scholar] [CrossRef]
- Hassan, Z.; Coelho, D.; Kokten, T.; Alberto, J.M.; Umoret, R.; Daval, J.L.; Guéant, J.L.; Bossenmeyer-Pourié, C.; Pourié, G. Brain Susceptibility to Methyl Donor Deficiency: From Fetal Programming to Aging Outcome in Rats. Int. J. Mol. Sci. 2019, 20, 5692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Battaglia-Hsu, S.F.; Akchiche, N.; Noel, N.; Alberto, J.M.; Jeannesson, E.; Orozco-Barrios, C.E.; Martinez-Fong, D.; Daval, J.L.; Guéant, J.L. Vitamin B12 deficiency reduces proliferation and promotes differentiation of neuroblastoma cells and up-regulates PP2A, proNGF, and TACE. Proc. Natl. Acad. Sci. USA 2009, 106, 21930–21935. [Google Scholar] [CrossRef] [Green Version]
- Akchiche, N.; Bossenmeyer-Pourié, C.; Pourié, G.; Koziel, V.; Nédélec, E.; Guéant, J.L.; Daval, J.L. Differentiation and neural integration of hippocampal neuronal progenitors: Signaling pathways sequentially involved. Hippocampus 2010, 20, 949–961. [Google Scholar] [CrossRef] [PubMed]
- Kirsch, S.H.; Herrmann, W.; Obeid, R. Genetic defects in folate and cobalamin pathways affecting the brain. Clin. Chem. Lab. Med. 2013, 51, 139–155. [Google Scholar] [CrossRef] [PubMed]
- Kerek, R.; Geoffroy, A.; Bison, A.; Martin, N.; Akchiche, N.; Pourié, G.; Helle, D.; Guéant, J.L.; Bossenmeyer-Pourié, C.; Daval, J.L. Early methyl donor deficiency may induce persistent brain defects by reducing Stat3 signaling targeted by miR-124. Cell Death Dis. 2013, 4, e755. [Google Scholar] [CrossRef] [Green Version]
- Willekens, J.; Hergalant, S.; Pourié, G.; Marin, F.; Alberto, J.M.; Georges, L.; Paoli, J.; Nemos, C.; Daval, J.L.; Guéant, J.L.; et al. Wnt Signaling Pathways Are Dysregulated in Rat Female Cerebellum Following Early Methyl Donor Deficiency. Mol. Neurobiol. 2019, 56, 892–906. [Google Scholar] [CrossRef] [PubMed]
- Scalabrino, G. Vitamin-regulated cytokines and growth factors in the CNS and elsewhere. J. Neurochem. 2009, 111, 1309–1326. [Google Scholar] [CrossRef]
- Sohn, J.W. Network of hypothalamic neurons that control appetite. BMB Rep. 2015, 48, 229–233. [Google Scholar] [CrossRef]
- Ulrich-Lai, Y.M.; Herman, J.P. Neural regulation of endocrine and autonomic stress responses. Nat. Rev. Neurosci. 2009, 10, 397–409. [Google Scholar] [CrossRef] [Green Version]
- Otte, C.; Gold, S.M.; Penninx, B.W.; Pariante, C.M.; Etkin, A.; Fava, M.; Mohr, D.C.; Schatzberg, A.F. Major depressive disorder. Nat. Rev. Dis. Primers 2016, 2, 16065. [Google Scholar] [CrossRef] [Green Version]
- Keller, J.; Gomez, R.; Williams, G.; Lembke, A.; Lazzeroni, L.; Murphy, G.M., Jr.; Schatzberg, A.F. HPA axis in major depression: Cortisol, clinical symptomatology and genetic variation predict cognition. Mol. Psychiatry 2017, 22, 527–536. [Google Scholar] [CrossRef] [PubMed]
- Ross, M.G.; Desai, M. Developmental programming of appetite/satiety. Ann. Nutr. Metab. 2014, 64 (Suppl. 1), 36–44. [Google Scholar] [CrossRef] [PubMed]
- Ralevski, A.; Horvath, T.L. Developmental programming of hypothalamic neuroendocrine systems. Front. Neuroendocrinol. 2015, 39, 52–58. [Google Scholar] [CrossRef] [PubMed]
- Fatima, M.; Srivastav, S.; Mondal, A.C. Prenatal stress and depression associated neuronal development in neonates. Int. J. Dev. Neurosci. 2017, 60, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Wood, C.E. Development and programming of the hypothalamus-pituitary-adrenal axis. Clin. Obstet. Gynecol. 2013, 56, 610–621. [Google Scholar] [CrossRef]
- Geoffroy, A.; Kerek, R.; Pourié, G.; Helle, D.; Guéant, J.L.; Daval, J.L.; Bossenmeyer-Pourié, C. Late Maternal Folate Supplementation Rescues from Methyl Donor Deficiency-Associated Brain Defects by Restoring Let-7 and miR-34 Pathways. Mol. Neurobiol. 2017, 54, 5017–5033. [Google Scholar] [CrossRef] [Green Version]
- Sheng, J.A.; Bales, N.J.; Myers, S.A.; Bautista, A.I.; Roueinfar, M.; Hale, T.M.; Handa, R.J. The Hypothalamic-Pituitary-Adrenal Axis: Development, Programming Actions of Hormones, and Maternal-Fetal Interactions. Front. Behav. Neurosci. 2021, 14, 601939. [Google Scholar] [CrossRef]
- Saber Cherif, L.; Pourié, G.; Geoffroy, A.; Julien, A.; Helle, D.; Robert, A.; Umoret, R.; Guéant, J.L.; Bossenmeyer-Pourié, C.; Daval, J.L. Methyl Donor Deficiency during Gestation and Lactation in the Rat Affects the Expression of Neuropeptides and Related Receptors in the Hypothalamus. Int. J. Mol. Sci. 2019, 20, 5097. [Google Scholar] [CrossRef] [Green Version]
- Nicolaides, N.C.; Kyratzi, E.; Lamprokostopoulou, A.; Chrousos, G.P.; Charmandari, E. Stress, the stress system and the role of glucocorticoids. Neuroimmunomodulation 2015, 22, 6–19. [Google Scholar] [CrossRef]
- Herman, J.P.; McKlveen, J.M.; Ghosal, S.; Kopp, B.; Wulsin, A.; Makinson, R.; Scheimann, J.; Myers, B. Regulation of the Hypothalamic-Pituitary-Adrenocortical Stress Response. Compr. Physiol. 2016, 6, 603–621. [Google Scholar]
- Silverman, M.N.; Sternberg, E.M. Glucocorticoid regulation of inflammation and its functional correlates: From HPA axis to glucocorticoid receptor dysfunction. Ann. N. Y. Acad. Sci. 2012, 1261, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Gjerstad, J.K.; Lightman, S.L.; Spiga, F. Role of glucocorticoid negative feedback in the regulation of HPA axis pulsatility. Stress 2018, 21, 403–416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shimizu, H.; Arima, H.; Watanabe, M.; Goto, M.; Banno, R.; Sato, I.; Ozaki, N.; Nagasaki, H.; Oiso, Y. Glucocorticoids increase neuropeptide Y and agouti-related peptide gene expression via adenosine monophosphate-activated protein kinase signaling in the arcuate nucleus of rats. Endocrinology 2008, 149, 4544–4553. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gyengesi, E.; Liu, Z.W.; D’Agostino, G.; Gan, G.; Horvath, T.L.; Gao, X.B.; Diano, S. Corticosterone regulates synaptic input organization of POMC and NPY/AgRP neurons in adult mice. Endocrinology 2010, 151, 5395–5402. [Google Scholar] [CrossRef] [Green Version]
- Takeda, E.; Terao, J.; Nakaya, Y.; Miyamoto, K.; Baba, Y.; Chuman, H.; Kaji, R.; Ohmori, T.; Rokutan, K. Stress control and human nutrition. J. Med. Investig. 2004, 51, 139–145. [Google Scholar] [CrossRef] [PubMed]
- Foster, M.T.; Warne, J.P.; Ginsberg, A.B.; Horneman, H.F.; Pecoraro, N.C.; Akana, S.F.; Dallman, M.F. Palatable foods, stress, and energy stores sculpt corticotropin-releasing factor, adrenocorticotropin, and corticosterone concentrations after restraint. Endocrinology 2009, 150, 2325–2333. [Google Scholar] [CrossRef]
- Weikum, E.R.; Knuesel, M.T.; Ortlund, E.A.; Yamamoto, K.R. Glucocorticoid receptor control of transcription: Precision and plasticity via allostery. Nat. Rev. Mol. Cell. Biol. 2017, 18, 159–174. [Google Scholar] [CrossRef]
- Reynolds, E. Vitamin B12, folic acid, and the nervous system. Lancet Neurol. 2006, 5, 949–960. [Google Scholar] [CrossRef]
- Li, F.; Watkins, D.; Rosenblatt, D.S. Vitamin B(12) and birth defects. Mol. Genet. Metab. 2009, 98, 166–172. [Google Scholar] [CrossRef]
- Rubini, E.; Baijens, I.M.M.; Horánszky, A.; Schoenmakers, S.; Sinclair, K.D.; Zana, M.; Dinnyés, A.; Steegers-Theunissen, R.P.M.; Rousian, M. Maternal One-Carbon Metabolism during the Periconceptional Period and Human Foetal Brain Growth: A Systematic Review. Genes 2021, 12, 1634. [Google Scholar] [CrossRef]
- Li, S.; Liu, D.; Zhang, R.; Lei, F.; Liu, X.; Cheng, Y.; Li, C.; Xiao, M.; Guo, L.; Li, M.; et al. The association of maternal dietary folate intake and folic acid supplementation with small-for-gestational-age births: A cross-sectional study in Northwest China. Br. J. Nutr. 2019, 122, 459–467. [Google Scholar] [CrossRef] [PubMed]
- Chaudhury, S.; Sharma, V.; Kumar, V.; Nag, T.C.; Wadhwa, S. Activity-dependent synaptic plasticity modulates the critical phase of brain development. Brain Dev. 2016, 38, 355–363. [Google Scholar] [CrossRef] [PubMed]
- Yoo, S.; Blackshaw, S. Regulation and function of neurogenesis in the adult mammalian hypothalamus. Prog. Neurobiol. 2018, 170, 53–66. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.D.; Luo, Y.J.; Chen, Z.K.; Quintanilla, L.; Cherasse, Y.; Zhang, L.; Lazarus, M.; Huang, Z.L.; Song, J. Hypothalamic modulation of adult hippocampal neurogenesis in mice confers activity-dependent regulation of memory and anxiety-like behavior. Nat. Neurosci. 2022, 25, 630–645. [Google Scholar] [CrossRef] [PubMed]
- El Hajj Chehadeh, S.; Pourié, G.; Martin, N.; Alberto, J.M.; Daval, J.L.; Guéant, J.L.; Leininger-Muller, B. Gestational methyl donor deficiency alters key proteins involved in neurosteroidogenesis in the olfactory bulbs of newborn female rats and is associated with impaired olfactory performance. Br. J. Nutr. 2014, 111, 1021–1031. [Google Scholar] [PubMed] [Green Version]
- Ghemrawi, R.; Arnold, C.; Battaglia-Hsu, S.F.; Pourié, G.; Trinh, I.; Bassila, C.; Rashka, C.; Wiedemann, A.; Flayac, J.; Robert, A.; et al. SIRT1 activation rescues the mislocalization of RNA-binding proteins and cognitive defects induced by inherited cobalamin disorders. Metabolism 2019, 101, 153992. [Google Scholar] [CrossRef]
- Dreumont, N.; Mimoun, K.; Pourié, C.; Quadros, E.V.; Alberto, J.M.; Umoret, R.; Helle, D.; Robert, A.; Daval, J.L.; Guéant, J.L.; et al. Glucocorticoid Receptor Activation Restores Learning Memory by Modulating Hippocampal Plasticity in a Mouse Model of Brain Vitamin B12 Deficiency. Mol. Neurobiol. 2021, 58, 1024–1035. [Google Scholar] [CrossRef]
- Bossenmeyer-Pourié, C.; Smith, A.D.; Lehmann, S.; Deramecourt, V.; Sablonnière, B.; Camadro, J.M.; Pourié, G.; Kerek, R.; Helle, D.; Umoret, R.; et al. N-homocysteinylation of tau and MAP1 is increased in autopsy specimens of Alzheimer’s disease and vascular dementia. J. Pathol. 2019, 248, 291–303. [Google Scholar] [CrossRef]
- Sharma, G.S.; Kumar, T.; Dar, T.A.; Singh, L.R. Protein N-homocysteinylation: From cellular toxicity to neurodegeneration. Biochim. Biophys. Acta 2015, 1850, 2239–2245. [Google Scholar] [CrossRef]
- Wisłowska-Stanek, A.; Kołosowska, K.; Maciejak, P. Neurobiological Basis of Increased Risk for Suicidal Behaviour. Cells 2021, 10, 2519. [Google Scholar] [CrossRef]
- Masuo, Y.; Satou, T.; Takemoto, H.; Koike, K. Smell and Stress Response in the Brain: Review of the Connection between Chemistry and Neuropharmacology. Molecules 2021, 26, 2571. [Google Scholar] [CrossRef] [PubMed]
- Glinka, M.E.; Samuels, B.A.; Diodato, A.; Teillon, J.; Feng Mei, D.; Shykind, B.M.; Hen, R.; Fleischmann, A. Olfactory deficits cause anxiety-like behaviors in mice. J. Neurosci. 2012, 32, 6718–6725. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krusemark, E.A.; Novak, L.R.; Gitelman, D.R.; Li, W. When the sense of smell meets emotion: Anxiety-state-dependent olfactory processing and neural circuitry adaptation. J. Neurosci. 2013, 33, 15324–15332. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Z.; Hoffman, C.A.; Chelette, B.M.; Thiebaud, N.; Fadool, D.A. Elevated Anxiety and Impaired Attention in Super-Smeller, Kv1.3 Knockout Mice. Front. Behav. Neurosci. 2018, 12, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turecki, G.; Meaney, M.J. Effects of the Social Environment and Stress on Glucocorticoid Receptor Gene Methylation: A Systematic Review. Biol. Psychiatry 2016, 79, 87–96. [Google Scholar] [CrossRef] [Green Version]
- Berretta, E.; Guida, E.; Forni, D.; Provenzi, L. Glucocorticoid receptor gene (NR3C1) methylation during the first thousand days: Environmental exposures and developmental outcomes. Neurosci. Biobehav. Rev. 2021, 125, 493–502. [Google Scholar] [CrossRef]
- McKee, S.E.; Reyes, T.M. Effect of supplementation with methyl-donor nutrients on neurodevelopment and cognition: Considerations for future research. Nutr. Rev. 2018, 76, 497–511. [Google Scholar] [CrossRef] [Green Version]
- Chery, C.; Barbe, F.; Lequere, C.; Abdelmouttaleb, I.; Gerard, P.; Barbarino, P.; Boutroy, J.L.; Guéant, J.L. Hyperhomocysteinemia is related to a decreased blood level of vitamin B12 in the second and third trimester of normal pregnancy. Clin. Chem. Lab. Med. 2002, 40, 1105–1108. [Google Scholar] [CrossRef]
- Paxinos, G.; Watson, C. The Rat Brain in Stereotaxic Coordinates, 7th ed.; Elsevier: Amsterdam, The Netherlands, 2013; p. 480. [Google Scholar]
- Ren, J.; Mann, Y.S.; Zhang, Y.; Browne, M.D. Synthesis and Mass Spectrometry Analysis of Oligo-peptoids. J. Vis. Exp. 2018, 132, 56652. [Google Scholar]
- Slamberová, R.; Pometlová, M.; Charousová, P. Postnatal development of rat pups is altered by prenatal methamphetamine exposure. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2006, 30, 82–88. [Google Scholar] [CrossRef]
Plasma Folate (nmol/L) | Plasma Vitamin B12 (pmol/L) | Plasma Homocysteine (µmol/L) | |
---|---|---|---|
21d Control-Vehicle | 75 ± 8.3 | 918.6 ± 54.7 | 5.8 ± 1.5 |
21d MDD-Vehicle | 18.5 ± 6.2 ** | 389.3 ± 157.1 ** | 17.6 ± 6.3 ** |
21d Control + Folic Acid | 111.17 ± 33.51 ** | 878.9 ± 141.16 | 4.7 ± 1.1 |
21d MDD + Folic Acid | 98.1 ± 24.84 **/°° | 397.2 ± 122.4 ** | 6.4 ± 2.1 **/°° |
Genes | Pimers | Sequences |
---|---|---|
AgRP | Forward | CGGAGGTGCTAGATCCACAGA |
AgRP | Reverse | AGGACTCGT GCAGCC TTACAC |
GR | Forward | TGAAGCTTCGGGATGCCATT |
GR | Reverse | ATTGTGCTGTCCTTCCACTG |
Pol II | Forward | AGCAAGCGGTTCCAGAGAAG |
Pol II | Reverse | TCCCGAACACTGACATATCTCA |
RPS 29 | Forward | ATGGGTCACCAGCAGCTCTA |
RPS 29 | Reverse | CATGTTCAGCCCGTATTTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Michel, A.; Kokten, T.; Saber-Cherif, L.; Umoret, R.; Alberto, J.-M.; Helle, D.; Julien, A.; Daval, J.-L.; Guéant, J.-L.; Bossenmeyer-Pourié, C.; et al. Folate and Cobalamin Deficiencies during Pregnancy Disrupt the Glucocorticoid Response in Hypothalamus through N-Homocysteinilation of the Glucocorticoid Receptor. Int. J. Mol. Sci. 2023, 24, 9847. https://doi.org/10.3390/ijms24129847
Michel A, Kokten T, Saber-Cherif L, Umoret R, Alberto J-M, Helle D, Julien A, Daval J-L, Guéant J-L, Bossenmeyer-Pourié C, et al. Folate and Cobalamin Deficiencies during Pregnancy Disrupt the Glucocorticoid Response in Hypothalamus through N-Homocysteinilation of the Glucocorticoid Receptor. International Journal of Molecular Sciences. 2023; 24(12):9847. https://doi.org/10.3390/ijms24129847
Chicago/Turabian StyleMichel, Arnaud, Tunay Kokten, Lynda Saber-Cherif, Rémy Umoret, Jean-Marc Alberto, Déborah Helle, Amélia Julien, Jean-Luc Daval, Jean-Louis Guéant, Carine Bossenmeyer-Pourié, and et al. 2023. "Folate and Cobalamin Deficiencies during Pregnancy Disrupt the Glucocorticoid Response in Hypothalamus through N-Homocysteinilation of the Glucocorticoid Receptor" International Journal of Molecular Sciences 24, no. 12: 9847. https://doi.org/10.3390/ijms24129847