Anti-Cancer Roles of Probiotic-Derived P8 Protein in Colorectal Cancer Cell Line DLD-1
Abstract
:1. Introduction
2. Results
2.1. Localization of P8 in DLD-1 Cells
2.2. Identification of P8 Targets in DLD-1 Cells
2.3. Involvement of P8 Targets in P8 Infiltration and Activity
2.4. P8 Targets the Anti-Proliferation Protein GSK3β in DLD-1 Cells
2.5. P8 Down-Regulates the GSK3β Gene by Direct Interaction
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture
4.2. Cell Culture
4.3. Purification of Recombinant P8 Protein from E. coli
4.4. Profiling of Proteins from DLD-1 Lysates Interacting with P8
4.5. Co-Pull-Down Assays
4.6. NGS Sequencing (Microgen, Inc.; Seoul, Republic of Korea)
4.6.1. Truseq DNA Nano
4.6.2. Generation of Raw Data
4.6.3. Analysis Method
Alignment
Annotations of SNPs and Small Indels
Mapping Read Count
4.7. EMSA Assay
4.8. In Vitro GSK3β Kinase Assay
4.9. In Vitro Transcription Assay
4.10. Western Blot Analysis
4.11. Immunocytochemistry Using ImageXpress® Micro Confocal Microscopy
4.12. Cell Proliferation Assay Using ImageXpress Live/Dead
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
CRC | colorectal cancer |
PP | Pediococcus pentosaceus |
MOA | mode of action |
KPNA3 | importin subunit alpha-4 |
GSK3β | glycogen synthase kinase-3 beta |
IARC | international agency for research on cancer |
TEM | transmission electron microscopy |
ELISA | enzyme-linked immunosorbent assay |
NGS | next generation sequencing |
EMSA | electrophoretic mobility-shift assay |
MW | molecular weight |
IPTG | β-D-1-thiogalacto-pyranoside |
GAPDH | glyceraldehyde 3-phosphate dehydrogenase |
BQSR | base quality score recalibration |
MCS | multi cloning site. |
References
- Smith, R.E.T.; Renaud, R.C.; Hoffman, E. Colorectal cancer market. Nat. Rev. Drug. Discov. 2004, 3, 471–472. [Google Scholar] [CrossRef]
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Mathers, C.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int. J. Cancer 2019, 144, 1941–1953. [Google Scholar] [CrossRef] [Green Version]
- “Colon Cancer Treatment (PDQ®)”. NCI. 12 May 2014. Archived from the Original on 5 July 2014. Available online: https://www.cancer.gov/types/colorectal/patient/colon-treatment-pdq#section/all (accessed on 29 June 2014).
- André, T.; Boni, C.; Mounedji-Boudiaf, L.; Navarro, M.; Tabernero, J.; Hickish, T.; Topham, C.; Zaninelli, M.; Clingan, P.; Bridgewater, J.; et al. Oxaliplatin, fluorouracil, and leucovorin as adjuvant treatment for colon cancer. N. Engl. J. Med. 2004, 350, 2343–2351. [Google Scholar] [CrossRef] [Green Version]
- Kusmartsev, S.; Gabrilovich, D.I. Inhibition of myeloid cell differentiation in cancer: The role of reactive oxygen species. J. Leukoc. Biol. 2003, 74, 186–196. [Google Scholar] [CrossRef]
- Nurgali, K.; Jagoe, R.T.; Abalo, R. Editorial: Adverse Effects of Cancer Chemotherapy: Anything New to Improve Tolerance and Reduce Sequelae? Front. Pharmacol. 2018, 9, 245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dantzer, R.; Meagher, M.W.; Cleeland, C.S. Translational approaches to treatment-induced symptoms in cancer patients. Nat. Rev. Clin. Oncol. 2012, 9, 414–426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cleeland, C.S.; Allen, J.D.; Roberts, S.A.; Brell, J.M.; Giralt, S.A.; Khakoo, A.Y.; Kirch, R.A.; Kwitkowski, V.E.; Liao, Z.; Skillings, J. Reducing the toxicity of cancer therapy: Recognizing needs, taking action. Nat. Rev. Clin. Oncol. 2012, 9, 471–478. [Google Scholar] [CrossRef] [PubMed]
- Park, R.-J.; Lee, K.-H.; Kim, S.-J.; Park, J.-Y.; Nam, S.-J.; Yun, H.-D.; Lee, H.-J.; Chang, H.C.; Chung, D.K.; Lee, J.-H.; et al. Isolation of Lactococcus lactis strain with β-galactosidase activity from kimchi and cloning of lacZ gene from the isolated strain. J. Microbiol. Biotechnol. 2002, 12, 157–161. [Google Scholar]
- Gilliland, S.E. Health and nutritional benefits from lactic acid bacteria. FEMS Microbiol. Rev. 1990, 7, 175–188. [Google Scholar] [CrossRef] [PubMed]
- Steidler, L.; Vandenbroucke, K. Genetically modified Lactococcus lactis: Novel tools for drug delivery. Int. J. Dairy. Technol. 2006, 59, 140–146. [Google Scholar] [CrossRef]
- An, B.C.; Yoon, Y.S.; Park, H.J.; Park, S.; Kim, T.Y.; Ahn, J.Y.; Kwon, D.; Choi, O.; Heo, J.Y.; Ryu, Y.; et al. Toxicological evaluation of a probiotic-based delivery system for P8 protein as an anti-colorectal cancer drug. Drug Des. Devel. Ther. 2021, 15, 4761–4793. [Google Scholar] [CrossRef]
- An, B.C.; Ryu, Y.; Hong, S.; Kwon, D.; Chung, M.J. Probiotics as potential therapeutics for colorectal cancer. AJBSR 2020, 9, 101–103. [Google Scholar]
- An, B.C.; Ryu, Y.; Yoon, Y.S.; Choi, O.; Park, H.J.; Kim, T.Y.; Kim, S.I.; Kim, B.K.; Chung, M.J. Colorectal cancer therapy using a Pediococcus pentosaceus SL4 drug delivery system secreting lactic acid bacteria-derived protein P8. Mol. Cells 2019, 30, 755–762. [Google Scholar]
- An, B.C.; Hong, S.; Park, H.J.; Kim, B.K.; Ahn, J.Y.; Ryu, Y.; An, J.H.; Chung, M.J. Anti-colorectal cancer effects of probiotic-derived P8 protein. Genes 2019, 10, 624. [Google Scholar] [CrossRef] [Green Version]
- Kim, B.K.; Yoon, Y.S.; Ryu, Y.; Chung, M.J. Probiotic-derived P8 protein induce apoptosis via regulation of RNF152 in colorectal cancer cells. Am. J. Cancer. Res. 2021, 11, 746–759. [Google Scholar]
- Chung, Y.; Ryu, Y.; An, B.C.; Yoon, Y.S.; Choi, O.; Kim, T.Y.; Yoon, J.; Ahn, J.Y.; Park, H.J.; Kwon, S.K.; et al. A synthetic probiotic engineered for colorectal cancer therapy modulates gut microbiota. Microbiome 2021, 9, 122. [Google Scholar] [CrossRef] [PubMed]
- An, B.C.; Ryu, Y.; Choi, O.; Hong, S.; Heo, J.Y.; Chung, M.J. Genetic engineering of a probiotic-based drug delivery system for colorectal cancer therapy. Cancer Rep. Rev. 2020, 4, 2–3. [Google Scholar]
- Lee, N.K.; Paik, H.D. Bioconversion Using Lactic Acid Bacteria: Ginsenosides, GABA, and Phenolic Compounds. J. Microbiol. Biotechnol. 2017, 27, 869–877. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.E.; Kim, J.Y.; Lee, K.W.; Lee, H.J. Cancer chemopreventive effects of lactic acid bacteria. J. Microbiol. Biotechnol. 2007, 17, 1227–1235. [Google Scholar]
- Geier, M.S.; Butler, R.N.; Howarth, G.S. Probiotics, prebiotics and synbiotics: A role in chemoprevention for colorectal cancer? Cancer Biol. Ther. 2006, 5, 1265–1269. [Google Scholar] [CrossRef] [Green Version]
- Jaekel, S.; Mingot, J.M.; Schwarzmaier, P.; Hartmann, E.; Goerlich, D. Importins fulfill a dual function as nuclear import receptors and cytoplasmic chaperones for exposed basic domains. EMBO J. 2002, 21, 377–386. [Google Scholar] [CrossRef]
- Sarkar, S.; Mandal, C.; Sangwan, R.; Mandal, C. Coupling G2/M arrest to the Wnt/β-catenin pathway restrains pancreatic adenocarcinoma. Endocr. Relat. Cancer 2014, 21, 113–125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davidson, G.; Shen, J.; Huang, Y.L.; Su, Y.; Karaulanov, E.; Bartscherer, K.; Hassler, C.; Stannek, P.; Boutros, M.; Niehrs, C. Cell cycle control of Wnt receptor activation. Dev. Cell 2009, 17, 788–799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, C.; Xiao, G.; Hu, J. Regulation of Wnt/β-catenin signaling by posttranslational modifications. Cell Biosci. 2014, 4, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.; Li, Y.; Semenov, M.; Han, C.; Baeg, G.H.; Tan, Y.; Zhang, Z.; Lin, X.; He, X. Control of β-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 2002, 108, 837–847. [Google Scholar] [CrossRef] [Green Version]
- Gao, C.; Chen, Y.G. Dishevelled: The hub of Wnt signaling. Cell. Signal. 2010, 22, 717–727. [Google Scholar] [CrossRef]
- Zhang, K.; Li, M.; Huang, H.; Li, L.; Yang, J.; Feng, L.; Gou, J.; Jiang, M.; Peng, L.; Chen, L.; et al. Dishevelled1-3 contribute to multidrug resistance in colorectal cancer via activating Wnt/β-catenin signaling. Oncotarget 2017, 8, 115803–115816. [Google Scholar] [CrossRef] [Green Version]
- Tejeda-Muñoz, N.; Robles-Flores, M. Glycogen synthase kinase 3 in Wnt signaling pathway and cancer. IUBMB Life 2015, 67, 914–922. [Google Scholar] [CrossRef]
- McCubrey, J.A.; Steelman, L.S.; Bertrand, F.E.; Davis, N.M.; Sokolosky, M.; Abrams, S.L.; Montalto, G.; D’Assoro, A.B.; Libra, M.; Nicoletti, F.; et al. GSK-3 as potential target for therapeutic intervention in cancer. Oncotarget 2014, 5, 2881–2911. [Google Scholar] [CrossRef] [Green Version]
- Miller, J.R.; Moon, R.T. Signal transduction through beta-catenin and specification of cell fate during embryogenesis. Genes Dev. 1996, 10, 2527–2539. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Li, X.; Lee, M.; Jun, S.; Aziz, K.E.; Feng, L.; Tran, M.K.; Li, N.; McCrea, P.D.; Park, J.I. FOXKs promote Wnt/β-catenin signaling by translocating DVL into the nucleus. Dev. Cell 2015, 32, 707–718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clevers, H. Wnt/beta-catenin signaling in development and disease. Cell 2006, 27, 469–480. [Google Scholar] [CrossRef] [Green Version]
- Shakoori, A.; Ougolkov, A.; Yu, Z.W.; Zhang, B.; Modarressi, M.H.; Billadeau, D.D.; Mai, M.; Takahashi, Y.; Minamoto, T. Deregulated GSK3beta activity in colorectal cancer: Its association with tumor cell survival and proliferation. Biochem. Biophys. Res. Commun. 2005, 334, 1365–1373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ougolkov, A.V.; Fernandez-Zapico, M.E.; Savoy, D.N.; Urrutia, R.A.; Billadeau, D.D. Glycogen synthase kinase-3beta participates in nuclear factor kappaB-mediated gene transcription and cell survival in pancreatic cancer cells. Cancer Res. 2005, 65, 2076–2081. [Google Scholar] [CrossRef] [Green Version]
- Lin, J.; Song, T.; Li, C.; Mao, W. GSK-3β in DNA repair, apoptosis, and resistance of chemotherapy, radiotherapy of cancer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118659. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Wang, L.; Gou, S.M.; Wang, T.L.; Zhang, M.; Liu, T.; Wang, C.Y. shRNA silencing glycogen synthase kinase-3 beta inhibits tumor growth and angiogenesis in pancreatic cancer. Cancer Lett. 2012, 316, 178–186. [Google Scholar] [CrossRef]
- Jeong, Y.J.; Hoe, H.S.; Cho, H.J.; Park, K.K.; Kim, D.D.; Kim, C.H.; Magae, J.; Kang, D.W.; Lee, S.R.; Chang, Y.C. Suppression of c-Myc enhances p21WAF1/CIP1-mediated G1 cell cycle arrest through the modulation of ERK phosphorylation by ascochlorin. J. Cell. Biochem. 2018, 119, 2036–2047. [Google Scholar] [CrossRef]
- Zhang, J.; Song, N.; Zang, D.; Yu, J.; Li, J.; Di, W.; Guo, R.; Zhao, W.; Wang, H. c-Myc promotes tumor proliferation and anti-apoptosis by repressing p21 in rhabdomyosarcomas. Mol. Med. Rep. 2017, 16, 4089–4094. [Google Scholar] [CrossRef] [Green Version]
- Dar, K.B.; Bhat, A.H.; Amin, S.; Anjum, S.; Reshi, B.A.; Zargar, M.A.; Masood, A.; Ganie, S.A. Exploring Proteomic Drug Targets, Therapeutic Strategies and Protein—Protein Interactions in Cancer: Mechanistic View. Curr. Cancer Drug Targets 2019, 19, 430–448. [Google Scholar] [CrossRef]
- Rigaut, G.; Shevchenko, A.; Rutz, B.; Wilm, M.; Mann, M.; Séraphin, B. A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 1999, 17, 1030–1032. [Google Scholar] [CrossRef]
- Bauer, A.; Kuster, B. Affinity purification-mass spectrometry. Powerful tools for the characterization of protein complexes. Eur. J. Biochem. 2003, 270, 570–578. [Google Scholar] [CrossRef] [PubMed]
- Pflieger, D.; Gonnet, F.; de la Fuente van Bentem, S.; Hirt, H.; de la Fuente, A. Linking the proteins—Elucidation of proteome-scale networks using mass spectrometry. Mass Spectrom. Rev. 2011, 30, 268–297. [Google Scholar] [CrossRef] [PubMed]
- Uguru, G.C.; Stephens, K.E.; Stead, J.A.; Towle, J.E.; Baumberg, S.; McDowall, K.J. Transcriptional activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor. Mol. Microbiol. 2005, 58, 131–150. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, V.; Henriques, A.F.A.; Matos, P.; Jordan, P. Ibuprofen disrupts a WNK1/GSK3β/SRPK1 protein complex required for expression of tumor-related splicing variant RAC1B in colorectal cells. Oncotarget 2020, 11, 4421–4437. [Google Scholar] [CrossRef]
- Wang, J.; Zhao, S.; Zhou, Y.; Wei, Y.; Deng, W. Establishment and validation of a non-radioactive method for in vitro transcription assay using primer extension and quantitative real time PCR. PLoS ONE 2015, 10, e0135317. [Google Scholar] [CrossRef]
- Cortadellas, N.; Garcia, A.; Ferández, E. Transmission electron microscopy in cell biology: Sample preparation techniques and image information. In Handbook of Instrumental Techniques; Seoane, J.R., Ed.; CCiTUB: Barcelona, Spain, 2010. [Google Scholar]
Target Proteins | Symbols | Accession # (UniProt) | Cellular Functions |
---|---|---|---|
Glycogen synthase kinase-3 beta | GSK3β | Q6FI27 | Protein kinase activity |
Importin subunit alpha-4 | KPNA3 | O00505 | Nuclear protein import |
GSK3B Targeting Sites of P8 Protein Based on NGS Sequencing Results | ||
---|---|---|
Probe No. | Sites in 3 chr. | Probe Sequences (30 bp) |
GSK3β-1 | 119,840,769 | Sense: ATAAGGGGAACTTTAAAAAAAAGTATCTAT |
GSK3β-2 | 119,861,831 | Sense: ATGAAAATTGCCTAATAATACATTTCTCAG |
GSK3β-3 | 119,867,698 | Sense: GGTATTGAGAACAAAAAATGGCAGAACTCA |
GSK3β-4 | 119,872,127 | Sense: CTTATTAAAAATCCCTAATCAACCCTAACT |
GSK3β-5 | 119,879,433 | Sense: GATTTACCCACTTCAGCCTCCCAAAGTGTT |
GSK3β-6 | 119,883,513 | Sense: TTTCTGGAAAGGGCCAGACAGTAAATATT |
GSK3β-7 | 119,888,927 | Sense: TTTTCTGGAAAGGGCCAGACAGTAAATATT |
GSK3β-8 | 119,889,190 | Sense: CTTGCTGGTTTTGCAGCTCAGGTGGGCATC |
*GSK3β-9 | 119,889,294 | Sense: ATTTCTCAGCCAGCCGACACTCATGGAAAA Anti-sense: TTTCCATGAGTGTCGGCTGGCTGAGAAAT |
GSK3β-10 | 119,890,313 | Sense: AGCATAAAAAGGAATAAACAGGTGATACAG |
GSK3β-11 | 119,922,595 | Sense: AATGGTTCTACTTTGATAACCCTTTTATTAT |
GSK3β-12 | 119,955,234 | Sense: AAAGAACCAACAGCTAAAAAAAAAAAAAAA |
GSK3β-13 | 119,965,364 | Sense: CCACCGTGCCCAGCCATTTTTTTTTTTTATT |
GSK3β-14 | 119,981,533 | Sense: GCACCCGCTGACAAGATGATTCTCTCCCGT |
GSK3β-15 | 120,049,324 | Sense: CTCCAGGCCTGGCCTGGGTGGTTTTAAAAT |
GSK3β-16 | 120,059,642 | Sense: TCTGAAATCTTAGTTCAACTTCCTCACCCA |
GSK3β-17 | 120,085,808 | Sense: ACATTCCGTCTTGAGAAAAAAAAAAAAGTAT |
Names | Sequences |
---|---|
GSK3β-Intron template DNA | 209627 gaca tatagttagg tgttttttaa ttgagtttga caatttctgc ctttgtaatt gaagtactta gactatttac attcagtgta attatcactg tggttgagtt taagttttgc accttcgtat ttgttttcct ttcatcccat ctttcctttg ctctgttttt ccccctcttt tactgccacc tatggattaa atcagtggtt tttatttttt ctattggctt ttaagctata cctccttgtt gcatttttag aggttggtct aggatttaaa atatgcatca atatattaca gtcagtcttc aagtagtaat gtaccatgtc atatagaaaa caagaaccgt gtgacagtat ttccattccc cttcctgttc tttgtgctat agttttcata ctttttaatt ctacatgtta taatccttac aatatttgtt gtttataggg ggaacccgcc cctaatattt caacataggt tttttctatt ttccatgagt gtcggctggc tgagaaataa agagaaagag tacaaagaga ggaattttac agctcggcct ccgggggtga catcacatat cagtagaacc gtgatgccca cctgagctgc aaaaccagca agttttatta aggatttcaa aaggggaggg gatgcaagaa cagggagtag gtcccaagat cacatgtttc atagggcaaa aggcagaaca aagatcacat gcttgtgagg aaacaggaca aaggacaaaa ggcagaactt ttgataaggg tctatgttct gcagtgcacg tattgtcttg ataaacatct taacagaaag cagggtttga gagcagagaa ctggtctgac ctcaaattta ccagggcggg atttttcccc accctgctaa gcctgagggt actgcaggag accagggcgg atttcagtcc ttatctctat ggcataagac agacactccc agagcagccg tttata 21056 |
GSK3β-Intron template DNA-F | CATATGGACATATAGTTAGG |
GSK3β-Intron template DNA-R | GAATTCTATAAACGGCTGCT |
GSK3β-Exon template DNA | 275602 ccttccaca gttaagtttc agtgatacca tactcaggag tgggaagagg aaatcatatt cgtaatttca tttcgttgaa gccctgcctt tgttttggtt ctgaatgtct ttcctcctcg gtagcagtga gaccggtttc atttcatact tagtccattc agggacttag tgtagcacca gggagcccta gagctggagg atatcgaata gattaaattt tgctcgtctc ttccacaagc cctaaccatg ggtcttaaaa acagcagatt ctgggagcct tccatgctct ctctctctcc tcttttatct acttccctcc caaatgagag agtgacagag aattgttttt ttataaatcg aagtttctta atagtatcag gttttgatac gtcagtggtc taaaatgcta tagtgcaatt actagcagtt actgcacgga gtgccaccgt gccaatagag gactgttgtt ttaacaaggg aactcttagc ccatttcctc cctcccgcca tctctaccct tgctcaatga aatatcattt taatttcttt taaaaaaaat cagtttaatt cttactgtgt gcccaacacg aaggcctttt ttgaaagaaa aatagaatgt tttgcctcaa agtagtccatataaaatgtc ttgaatagaa gaaaaaacta ccaaaccaaa ggttactatt tttgaaacat cgtgtgttca ttccagcaag gcagaagact gcaccttctt tccagtgaca tgctgtgtca ttttttttaa gtcctcttaa tttttagaca catttttggt ttatgtttta acaatgtatg cctaaccagt catcttgtct gcaccaatgc aaaggtttct gagaggagta ttctctatccctgtggatat gaagacactg gcatttcatc tatttttccc tttccttttt aaaggattta actttggaat cttccaaagg aagtttggcc aatgccagat ccccaggaat ttgg 276594 |
GSK3β-Exon template DNA-F | CATATGCCTTCCACAGTTAA |
GSK3β-Exon template DNA-R | GAATTCCCAAATTCCTGGGG |
Amplification primer fair for pET28a::GSK3β-Intron/Exon template DNAs using PCR | |
pET28a-F | GGAAGGGAAGAAAGCGAAAG |
pET28a-R | GCAAGGAATGGTGCATGCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
An, B.C.; Ahn, J.Y.; Kwon, D.; Kwak, S.H.; Heo, J.Y.; Kim, S.; Ryu, Y.; Chung, M.J. Anti-Cancer Roles of Probiotic-Derived P8 Protein in Colorectal Cancer Cell Line DLD-1. Int. J. Mol. Sci. 2023, 24, 9857. https://doi.org/10.3390/ijms24129857
An BC, Ahn JY, Kwon D, Kwak SH, Heo JY, Kim S, Ryu Y, Chung MJ. Anti-Cancer Roles of Probiotic-Derived P8 Protein in Colorectal Cancer Cell Line DLD-1. International Journal of Molecular Sciences. 2023; 24(12):9857. https://doi.org/10.3390/ijms24129857
Chicago/Turabian StyleAn, Byung Chull, Jun Young Ahn, Daebeom Kwon, Sang Hee Kwak, Jin Young Heo, Seungwoo Kim, Yongku Ryu, and Myung Jun Chung. 2023. "Anti-Cancer Roles of Probiotic-Derived P8 Protein in Colorectal Cancer Cell Line DLD-1" International Journal of Molecular Sciences 24, no. 12: 9857. https://doi.org/10.3390/ijms24129857