Next Article in Journal
Polymer-Functionalized Mitochondrial Transplantation to Fibroblasts Counteracts a Pro-Fibrotic Phenotype
Previous Article in Journal
Glypican-3 (GPC-3) Structural Analysis and Cargo in Serum Small Extracellular Vesicles of Hepatocellular Carcinoma Patients
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 13
10.3390/ijms241310923
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Necroptosis Mediates Muscle Protein Degradation in a Cachexia Model of Weanling Pig with Lipopolysaccharide Challenge

by
Junjie Guo
1,†,
Xu Qin
1,†,
Yang Wang
1,
Xiangen Li
1,
Xiuying Wang
1,
Huiling Zhu
1,
Shaokui Chen
1,
Jiangchao Zhao
2,
Kan Xiao
1,3,* and
Yulan Liu
1,3,*
1
Hubei Key Laboratory of Animal Nutrition and Feed Science, Wuhan Polytechnic University, Wuhan 430023, China
2
Department of Animal Science, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701, USA
3
School of Animal Science and Nutritional Engineering, Wuhan Polytechnic University, No. 68 Xuefu South Rd., Wuhan 430023, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(13), 10923; https://doi.org/10.3390/ijms241310923
Submission received: 5 May 2023 / Revised: 16 June 2023 / Accepted: 19 June 2023 / Published: 30 June 2023
(This article belongs to the Section Macromolecules)
Browse Figures
Review Reports Versions Notes

Abstract

:
Necroptosis, an actively researched form of programmed cell death closely related to the inflammatory response, is important in a variety of disorders and diseases. However, the relationship between necroptosis and muscle protein degradation in cachexia is rarely reported. This study aimed to elucidate whether necroptosis played a crucial role in muscle protein degradation in a cachexia model of weaned piglets induced by lipopolysaccharide (LPS). In Experiment 1, the piglets were intraperitoneally injected with LPS to construct the cachexia model, and sacrificed at different time points after LPS injection (1, 2, 4, 8, 12, and 24 h). In Experiment 2, necrostatin-1 (Nec-1), a necroptosis blocker, was pretreated in piglets before the injection of LPS to inhibit the occurrence of necroptosis. Blood and longissimus dorsi muscle samples were collected for further analysis. In the piglet model with LPS-induced cachexia, the morphological and ultrastructural damage, and the release of pro-inflammatory cytokines including tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 were dynamically elicited in longissimus dorsi muscle. Further, protein concentration and protein/DNA ratio were dynamically decreased, and protein degradation signaling pathway, containing serine/threonine kinase (Akt), Forkhead box O (FOXO), muscular atrophy F-box (MAFbx), and muscle ring finger protein 1 (MuRF1), was dynamically activated in piglets after LPS challenge. Moreover, mRNA and protein expression of necroptosis signals including receptor-interacting protein kinase (RIP)1, RIP3, and mixed lineage kinase domain-like pseudokinase (MLKL), were time-independently upregulated. Subsequently, when Nec-1 was used to inhibit necroptosis, the morphological damage, the increase in expression of pro-inflammatory cytokines, the reduction in protein content and protein/DNA ratio, and the activation of the protein degradation signaling pathway were alleviated. These results provide the first evidence that necroptosis mediates muscle protein degradation in cachexia by LPS challenge.

1. Introduction

Cachexia, a complex clinical disease, is characterized by anorexia, emaciation, and muscle atrophy [1]. Specifically, cachexia leads to reducing protein synthesis and enhancing degradation, which declines the quality, strength, and function of skeletal muscle in patients [2]. Cancer cachexia is now acknowledged to not only be induced by malnutrition, but also caused by the abnormalities of metabolism, and immune and nerve responses, of which proinflammatory factors play a detrimental role in promoting the development of cachexia [3,4]. While its mechanism of pathogenesis has been widely investigated, the molecular basis of cachexia affecting muscle protein degradation remains elusive.
The serine/threonine kinase (Akt)/Forkhead box O (FOXO) is now considered to be one of the main pathways for regulating muscle protein degradation. FOXO interacts with the ubiquitin-proteasome system (UPS) to activate its key genes, muscular atrophy F-box (MAFbx) and muscle ring finger protein 1 (MuRF1) [5,6]. Importantly, MAFbx and MuRF1 are key substances for triggering muscle atrophy and protein degradation [7,8]. Furthermore, proinflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 can activate the Akt/FOXO/UPS signaling pathway and are considered to be deeply involved in muscle protein degradation [9].
Previous evidence suggests that necrosis and apoptosis are two main cell death models playing an important role in muscle atrophy and regeneration in various acute and chronic musculoskeletal disorders including cachexia, sarcopenia, and aging [10,11,12]. Recently, necroptosis, a new pattern of programmed cell death, has been discovered, which possesses the same morphological characteristics as necrosis and is strictly regulated by signaling molecules similar to apoptosis [13,14]. Convincing evidence has shown that the induction of necroptosis by TNF-α is a canonical pathway [15]. Briefly, receptor-interacting protein kinase (RIP)1 is autophosphorylated under the inhibition of caspase-8, and then RIP3 and mixed lineage kinase domain-like pseudokinase (MLKL) are phosphorylated to form a necrotic complex, which is known as a key mechanism controlling necroptosis [16]. As necroptosis progresses, cells rupture and release a lot of cellular contents, which leads to inflammatory reactions and secondary injury of nearby tissues [17].
Accumulating research has suggested that necroptosis plays an essential role in multiple diseases of various tissues and organs, such as dextran sulfate sodium-induced colitis [18], non-alcoholic fatty liver disease [19], and arsenic-induced neuronal necroptosis [20]. However, the role of necroptosis in cachexia-induced muscle protein degradation has not been investigated. Thus, in this study, we aimed to investigate if necroptosis might play an essential role in muscle protein degradation induced by cachexia. The pig is thought of as an ideal model animal for studying various physiological and pathological disorders of humans [21]. Here, we constructed a piglet model of cachexia by challenging them with lipopolysaccharide (LPS) [22], the important component of the outer membrane of Gram-negative bacteria, to investigate the relationship of muscle protein degradation and necroptosis. Further, necrostatin-1 (Nec-1), a frequently used inhibitor of necroptosis [23], was employed before LPS treatment, to explore the contribution of necroptosis to muscle protein degradation.

2. Results

2.1. LPS Challenge Dynamically Changes Physiological and Biochemical Indexes for Diagnosis of Cachexia in Weanling Pigs

Cachexia is a disease mainly caused by neuroendocrine hormone imbalances or inflammatory factors, leading to muscle protein degradation and increasing energy consumption [1,24,25]. To determine whether the model of LPS-induced cachexia is established, we initially examined the concentrations of several blood markers of cachexia including plasma insulin (INS), growth hormone (GH), cortisol (COR), and glucagon (GLU) [26,27,28]. Compared to the control group, the concentrations of INS and GH in the plasma of LPS-challenged pigs were significantly diminished at 1–4 h (p < 0.05) and 1–24 h (p < 0.05), respectively (Figure 1A,B). However, the levels of COR and GLU were dramatically increased at 1–12 h (p < 0.05) and 2–12 h (p < 0.05), respectively (Figure 1C,D).
Next, we further evaluated the occurrence of muscle damage caused by the LPS challenge. Compared with the control group, LPS-challenged pigs displayed muscle-fiber-free nuclei, inflammatory cell infiltration, hemorrhage, membrane rupture, fibroblast hyperplasia, and muscle-fiber dissolution and atrophy (Figure 1E). Muscle ultrastructure analysis showed that the LPS challenge caused mitochondrial cristae shedding and dissolution, muscle-fiber dissolution and fracture, and Z-line fuzziness and distortion at different time points (Figure 1F).
We then investigated muscle protein degradation, a typical symptom of cachexia [1], by measuring the protein and DNA concentrations in the longissimus dorsi muscle. Compared to the control group, protein concentration and protein/DNA ratio of the longissimus dorsi muscle were diminished at 4–24 h (p < 0.05), with the lowest point at 12 h after LPS injection (Figure 1G–I). The concentration of DNA tended to decrease from 1–4 h after LPS injection (p < 0.10).

2.2. LPS Challenge Dynamically Induces Inflammatory Response and Activates Muscle Protein Degradation Signaling Pathway in Weanling Pigs

The inflammatory response is thought to be a major inducer of muscle atrophy in cachexia [29]. To investigate the dynamic effect of LPS challenge on the inflammatory response of pigs, we first measured the mRNA expression of TNF-α, IL-1β, and IL-6 in the longissimus dorsi muscle. Compared to the control group, the mRNA abundances of TNF-α, IL-1β, and IL-6 in the longissimus dorsi muscle of pigs after LPS injection were significantly elevated at 1 h, 1–24 h, and 1–8 h, respectively (p < 0.05), and peaked at 1–2 h after LPS injection (Figure 2A–C).
Pro-inflammatory cytokines induce muscle protein degradation prevailingly by regulating the signaling pathway of Akt/FOXO/UPS [30,31]. To further confirm whether the muscle protein degradation signaling pathway was activated by the LPS challenge in piglets, we assessed the dynamic changes of the key components of the Akt/FOXO/UPS signaling pathway. Specifically, as compared to the control group, the LPS challenge significantly decreased the mRNA level of Akt at 24 h (p < 0.05) (Figure 2D). The mRNA abundances of FOXO1, MuRF1, and MAFbx were significantly upregulated between 2–12 h, 2–12 h, and 4–24 h after LPS injection, and peaked at 12 h (Figure 2E–G). Similarly, the protein expressions of phosphorylated (p)-Akt and p-FOXO1 and the ratios of p-Akt/total (t)-Akt and p-FOXO1/t-FOXO1 were reduced at 4–24 h, 24 h, 4 h, and 2–12 h, respectively (p < 0.05). Injection of LPS upregulated the protein abundances of t-Akt at 2–8 h and t-FOXO1 at 2 and 12 h (p < 0.05) (Figure 2H–N).

2.3. LPS Challenge Dynamically Induces Muscle Necroptosis in Weanling Pigs

To confirm the involvement of necroptosis in LPS-induced muscle protein degradation, we assessed the mRNA and protein levels of RIP1, RIP3, and MLKL, which are considered to be key signals of necroptosis [17]. Compared to the control group, LPS upregulated the mRNA expression of RIP1 between 1–24 h (peaked at 12 h), RIP3 between 1–24 h (peaked at 4 h), and MLKL between 1–12 h (peaked at 4 h) (p < 0.05) (Figure 3A–C). The protein abundances of t-RIP1 between 1–12 h, p-RIP1 between 1–12 h, t-RIP3 between 1–12 h, p-RIP3 between 2–8 h, t-MLKL between 1–24 h, and p-MLKL between 4–12 h were significantly elevated (p < 0.05). The ratios of p-RIP1/t-RIP1 between 1–12 h and p-MLKL/t-MLKL at 24 h were also significantly increased (p < 0.05) (Figure 3D–M).

2.4. Nec-1 Inhibits Muscle Necroptosis Induced by LPS in Weanling Pigs

Since RIP1 is essential for the induction of canonical necroptosis, we pretreated piglets with Nec-1, an inhibitor of RIP1 kinase activity, to inhibit RIP1 autophosphorylation to block necroptosis. As the results showed (Figure 4A–M), the mRNA expression of RIP1, RIP3, and MLKL and the protein expression of t-RIP1, t-RIP3, and p-MLKL were significantly elevated (p < 0.05) after 4 h of LPS injection. Nevertheless, Nec-1 alleviated the increase of the protein abundances of t-RIP1, t-RIP3, and p-MLKL induced by LPS challenge in longissimus dorsi muscle (p < 0.05).

2.5. Inhibition of Necroptosis by Nec-1 Relieves Muscle Structure Injury, Inflammation, and Protein Degradation Induced by LPS in Weanling Pigs

To further explore whether inhibition of necroptosis alleviated LPS-induced cachexia, we first measured the effect of Nec-1 on blood markers of cachexia. Nec-1 increased the content of GH (p < 0.05) and decreased the concentration of COR in plasma (p < 0.05) (Figure 5A,B). Compared with the control group, Nec-1 reduced INS level in the blood (p < 0.05) (Figure S1A). GLU level was increased in LPS + Nec-1 group compared to the LPS group (p < 0.05) (Figure S1B). In addition, Nec-1 alleviated muscle-fiber-free nuclei, inflammatory cell infiltration, hemorrhage, fascia rupture and shedding, fibroblast proliferation, muscle-fiber atrophy, and other morphological structure damage induced by LPS challenge (Figure 5C). Consistently, LPS treatment diminished the protein concentration and protein/DNA ratio (p < 0.05). Nec-1 restored the decrease of protein concentration and protein/DNA ratio induced by LPS challenge to normal levels in the longissimus dorsi muscle (p < 0.05) (Figure 5D–F).
We further investigated whether inhibition of necroptosis attenuated inflammatory response and muscle protein degradation. LPS challenge at 4 h upregulated the mRNA expression of IL-1β and IL-6 (p < 0.05). As expected, Nec-1 alleviated the increase of IL-1β and IL-6 mRNA abundance induced by the LPS challenge (p < 0.05) (Figure 5G–I). In addition, LPS treatment at 4 h elevated MuRF1 and MAFbx mRNA abundance but were alleviated by Nec-1 pretreatment (p < 0.05) (Figure 5K–M). Nec-1 pretreatment restored the reduction of the ratio of p-FOXO1/t-FOXO1 to the normal level (p < 0.05) (Figure 5N–T).

3. Discussion

In recent years, necroptosis, a new type of cell death that is different from traditional cell necrosis and apoptosis, has been confirmed to be involved in physiological and pathological processes of various tissues and organs, such as neurodegenerative disease, intervertebral disc degeneration, and nephritis [32,33,34]. However, whether necroptosis contributes to muscle protein degradation in cachexia remains unclear.
Using LPS-stimulated piglets to establish the model of cachexia, we quantified the concentrations of plasma markers of cachexia, such as INS, GH, COR, and GLU [28]. Various reports have revealed that hormone secretion disorder can be triggered by LPS challenge, specifically manifested as reduced plasma INS and GH concentrations [35,36], and increased plasma COR and GLU concentrations [37,38]. These changes are highly consistent with the physiological changes of cachexia patients. We found that the levels of INS and GH were significantly diminished at 1 h after LPS injection and the concentrations of COR and GLU were dramatically increased at 2–12 h after LPS challenge. In agreement with previously published results of cachexia patients and organisms [26,27,28], the INS and GH levels and the COR and GLU levels were decreased and increased, respectively. Since severe muscle mass loss and protein degradation are manifested in cachexia patients [39], we first explored the dynamic effect of the LPS challenge on muscle damage by observing the morphology and ultrastructure of muscle. As expected, injection of LPS at different time points (1, 2, 4, 8, 12, and 24 h) induced different degrees of muscle injury. We further explored the dynamic effect of the contents of protein and DNA and the ratio of protein/DNA in longissimus dorsi muscle by LPS challenge. The protein/DNA ratio is an effective indicator of muscle protein mass [9]. Our results demonstrated that the content of protein and the ratio of protein/DNA decreased after LPS injection 4–24 h. In agreement with our results, Liu et al. [40] showed that the ratio of protein/DNA was diminished in the longissimus dorsi muscle and gastrocnemius muscle at 4 h after LPS injection. These results indicate that LPS dynamically changes physiological and biochemical indexes for the diagnosis of cachexia in weanling pigs.
Cachexia, a complex and fatal metabolic disease, can cause severe systemic inflammation and obvious muscle atrophy [22]. Proinflammatory cytokines, particularly TNF-α, IL-6, and IL-1β, are considered to be important mediators of cachexia induction [39]. Here, we showed that the mRNA levels of TNF-α, IL-1β, and IL-6 increased significantly at 1–8 h after the LPS challenge, and reached the peak value at 1–2 h, which was similar to the results of Valentine et al. [41] and Joseph et al. [42]. These results further proved that cachexia could lead to an inflammatory response in the body. Akt/FOXO/UPS pathway is recognized as the primary mechanism of muscle wasting in cachexia [3,4]. Akt, a key signaling protein, exerts an important role in insulin signaling transduction [43]. It inhibits muscle protein degradation by phosphorylation and inactivation of FOXO [44]. Phosphorylation and inactivation of FOXO lead to transcriptional inhibition of FOXO target genes, i.e., MAFbx and MuRF1, and consequently result in a reduction in protein degradation. In our study, LPS caused marked but temporary upregulation of the mRNA expression of FOXO1, MuRF1, and MAFbx, peaking at 8–12 h. Similarly, Liu et al. [45] showed that MuRF1 and MAFbx expression was elevated at 4 h after LPS injection in the gastrocnemius muscle of piglets. Furthermore, our data showed that p-Akt protein expression and p-FOXO1/t-FOXO1 ratio were dynamically decreased. These results indicate that LPS-induced proinflammatory cytokines inhibited Akt phosphorylation, thereby reducing FOXO phosphorylation, and consequently increasing the expression of MAFbx and MuRF1 to trigger muscle protein degradation [44,46,47]. According to our data, we demonstrate that LPS induces the release of proinflammatory cytokines and then the activation of muscle protein degradation signals, which are key symptoms of cachexia.
Generally, cell necrosis is closely related to the occurrence of muscle atrophy. Thus, we next elucidated whether the muscle underwent necroptosis after the LPS challenge. RIP1, RIP3, and MLKL are indispensable components that mediated the activation of necroptosis [16,17]. We found that mRNA expression levels of these three key genes were mainly upregulated at 1–12 h and primarily peaked at 4 h. The protein expression displayed an analogous time-dependent increase but principally peaked at 8 h, which coincided with the spatiotemporal differences in the complex gene expression mechanism (involving transcription and translation) in organisms [48]. In agreement with our findings, Morgan et al. [49] reported that the mRNA abundances of RIP1, RIP3, and MLKL were upregulated in the tibialis anterior muscle of mice lacking dystrophin. Our data suggest that LPS induces inflammatory response and muscle protein degradation accompanied by necroptosis of muscle. Interestingly, changes in the major components of necroptosis occurred slightly later than the immediate changes in inflammatory genes and earlier than the larger changes in key genes for muscle protein degradation.
We then pretreated LPS-challenged piglets with Nec-1, a specific inhibitor to block the interaction between RIP1 and RIP3 [50], to investigate whether necroptosis played an important role in muscle protein degradation. We observed that Nec-1 reversed the up-regulation of the protein abundances of t-RIP1, t-RIP3, and p-MLKL in the longissimus dorsi muscle of LPS-treated piglets, suggesting that Nec-1 was efficacious to block necroptosis in the muscle of LPS-challenged pigs. In agreement with our results, Nec-1 also exerted a similar effect in rat models of adjuvant arthritis [51], asthma [52], and hypertrophic scars [53].
Further analysis showed that suppression of necroptosis using Nec-1 ameliorated the change of blood markers (GH and COR) of cachexia by LPS challenge. Nec-1 reduced INS level in the blood. It is well established that INS has the function of reducing blood glucose level but GLU has the function of raising blood glucose level. This may be why the GLU levels was increased in the LPS+Nec-1 group. We also observed that inhibition of necroptosis alleviated muscle morphological damage induced by the LPS challenge. Similar to our research, Morgan et al. [49] showed that RIP3 deficiency significantly reduced inflammatory cell infiltration in muscle fibers and Nec-1s alleviated TNF-α-induced increase of injury and necrosis in C2C12 myoblasts. Remarkably, inhibition of necroptosis by knocking out the RIP3 gene or using Nec-1s improved muscle-fiber function [49,54]. In addition, our data showed that the up-regulation of muscle IL-1β and IL-6 mRNA abundance induced by LPS were ameliorated by Nec-1. Similarly, recent literature reported that Nec-1 significantly reduced the levels of TNF-α, IL-1β, and IL-6 and reduced the severity of arthritis in rats [51,52]. Expectedly, restraining necroptosis alleviated the reduction in protein content, protein/DNA ratio, and p-FOXO1/t-FOXO1 ratio, and the upregulation of MuRF1 and MAFbx mRNA level induced by LPS. Our discovery suggests that necroptosis is involved in muscle inflammation and protein degradation by LPS challenge.

4. Materials and Methods

4.1. Animals and Experimental Design

Animal housing, feeding management, and all experimental protocols for the piglets used in this study were in compliance with the Animals (Scientific Procedures) Act 1986 under the Home Office Code of Practice. All experiments were performed following the guidelines established by the Animal Care and Use Committee of Wuhan Polytechnic University (Wuhan, China). Sixty-six male weaned piglets (Duroc × Large White × Landrace, 28 ± 3 d of age, initial body weight of 7.1 ± 0.9 kg BW) were provided by Aodeng Agricultural and Animal Husbandry Technology Co., Ltd. (Tianmen, China). All piglets were individually housed in metabolic cages measuring 1.8 m × 1.1 m in length × width and were allowed to eat and drink freely for two weeks. The ambient temperature ranged from 27 °C to 29 °C.
In experiment 1, forty-two weaned piglets were randomly divided into 7 groups (n = 6 piglets/group) according to initial body weight and ancestry, including the control group and six LPS-treated groups. The piglets in six LPS-treated groups received an intraperitoneal injection of Escherichia coli LPS (Escherichia coli serotype O55: B5, Sigma Chemical Inc., St. Louis, MO, USA) at the dose of 100 μg/kg BW, and then were humanly killed at 1, 2, 4, 8, 12, and 24 h, respectively. The piglets in the control group were injected with the same amount of sterile saline and slaughtered immediately (0 h).
In experiment 2, twenty-four weaned piglets were randomly allocated to 4 groups (n = 6 piglets/group) according to initial body weight and ancestry with a 2 × 2 factorial arrangement of treatments. The pigs were pretreated with Nec-1 (MedChem Express, Monmouth Junction, NJ, USA) at 1.0 mg/kg BW or the equal quantity of 2% dimethylsulphoxide (DMSO, the solvent of Nec-1) 30 min earlier than the intraperitoneal injection of LPS or sterile saline, and were slaughtered at 4 h after injection of LPS or sterile saline.

4.2. Blood and Muscle Sample Collection

Blood samples were collected initially into 10 mL vacuum tubes by the precaval vein, and plasma was obtained by centrifugation at 3500× g and 4 °C for 10 min. Plasma samples were stored at −20 °C until analysis. After blood collection, the pigs were slaughtered under anesthesia with an intramuscular administration of sodium pentobarbital (80 mg/kg BW). Two patch muscles (3 mm3 and 1 cm3) were harvested from the longissimus dorsi muscle. The smaller piece of muscle was rinsed with phosphate solution at 4 °C, and fixed with 2.5% glutaraldehyde stored at 4 °C for ultrastructural analysis. Another bigger piece of muscle was fixed with 4% paraformaldehyde for morphological analysis. Furthermore, a portion of the remaining longissimus dorsi muscle was removed and frozen in liquid nitrogen immediately, then stored at −80 °C for further analysis.

4.3. Plasma Hormone Measurement

The concentrations of INS, GH, COR, and GLU in the plasma were measured by commercial 125I RIA assay kits (Beijing North Institute of Biological Technology Co., Ltd., Beijing, China). All experimental processes were conducted in accordance with the manufacturer’s protocols.

4.4. Muscle Morphologic Analysis

Muscle segments (1 cm3) fixed with 4% paraformaldehyde-phosphate buffer were dehydrated with a series of increasing concentration gradient of ethanol, cleared with xylene, embedded with Paraffin wax, sectioned (5 μm) and stained with hematoxylin and eosin. Specifically, slices of each sample were made respectively along the transverse and longitudinal sides of the muscle-fiber texture. Morphological observation of the longissimus dorsi muscle was conducted at 400× magnification of a light microscope.

4.5. Muscle Ultrastructural Observation

The smaller pieces of muscle (3 mm3) from each pig were fixed with 2.5% glutaraldehyde, and subsequently fixed in 1% osmium tetroxide. The muscle samples were then dehydrated with graded ethanol and acetones, permeated in a mixture of acetone and epoxy resin, embedded in Epon 812 (Eimicon, Shanghai, China), cut into ultrathin sections (70 nm), and stained with uranyl acetate and lead citrate. Ultrastructural analysis of muscle was evaluated by using a transmission electron microscope (TEM) (Tecnai, FEI, Hillsboro, OR, USA) at an accelerating voltage of 200 kV and a magnification of 6000 by a seasoned pathologist blinded manner.

4.6. Muscle Protein and DNA Concentration Determination

Muscle samples of 100 mg were weighed and added to pre-cooled saline at a 1:10 (w/v) ratio and then homogenized with a homogenizer (PT-3100D, Kinematica, Malters, Switzerland) to prepare 10% tissue homogenate for further analysis. The concentration of muscle protein was determined using Coomassie brilliant blue kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Muscle DNA content was measured by UV spectrophotometry method [55].

4.7. mRNA Abundance Analysis

An appropriate muscle sample (50−70 mg) was added into the enzyme-free 2 mL eppendorf tube which contained 1 mL Trizol reagent (TaKaRa Biotechnology Co., Dalian, China) to obtain total RNA. RNA quality was evaluated by agarose gel electrophoresis, and its quantity was detected by using a Nanodrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). cDNA synthesis and quantitative real-time PCR were executed using PrimeScript® RT Kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) and SYBR® Premix Ex Taq™ (Tli RNaseH Plus) qPCR kit (TaKaRa Biotechnology Co., Ltd., Dalian, China), respectively. The PCR cycling conditions included denaturation at 95 °C for 30 s, followed by 40 cycles of annealing at 95 °C for 5 s and extension at 60 °C for 34 s. The primer pairs designed with Primer Premier 6.0 are shown in Table 1. Relative mRNA expression of each target gene was normalized to the expression of the housekeeping gene (GAPDH), and was calculated according to the 2−ΔΔCT method [56].

4.8. Protein Expression Analysis

Total proteins were extracted from muscle using a commercial total protein extraction kit (#KGP250/KGP2100, Jiangsu KeyGEN BioTECH Corp., Ltd., Nanjing, China) according to the operation instruction. Protein samples were separated by electrophoresis on 12% sodium dodecyl sulfate-polyacrylamide gel, transferred onto polyvinylidene difluoride membranes, blocked with 3% bovine serum albumin in TBS/Tween-20 buffer, and incubated with primary antibodies and then with secondary antibodies. The information of antibodies used in the Western blot is shown in Table 2. The protein content of the band was measured by using GeneTools software (Syngene, Frederick, MD, USA). The relative concentration of each target protein was indicated as the ratio of target protein/GAPDH protein. In addition, the protein abundance of the phosphorylated form of the target protein was also normalized to its total protein content.

4.9. Statistical Analysis

For comparison between the two groups, the data were analyzed using Student’s t-test. For multiple comparisons, a one-way ANOVA test was performed using the general linear model procedures of Statistical Analysis System (SAS Inst. Inc., Cary, NC, USA), followed by Duncan’s multiple comparison tests for post hoc testing. The experimental data were expressed as means ± SEM. The statistical significance level of data was set at p ≤ 0.05.

5. Conclusions

Collectively, we demonstrate that necroptosis plays an important role in muscle protein degradation in LPS-induced cachexia. More specifically, muscle inflammation, protein degradation, and necroptosis occur in the LPS-induced cachexia model of weaned piglets. Inhibition of necroptosis with Nec-1 alleviates muscle inflammation and protein degradation. This suggests that inhibitors of necroptosis may be promising new drugs for treating muscle protein degradation caused by cachexia. Future research is warranted to elucidate the specific mechanism of necroptosis mediating muscle protein degradation. Moreover, the study of pretreatment with Nec-1s, a more specific inhibitor than Nec-1, is worth pursuing in the future to exclude interference from other modes of cell death.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241310923/s1.

Author Contributions

Y.L. and K.X. designed research; Y.L., J.G., K.X., X.Q., Y.W., X.L., X.W., H.Z., S.C. and J.Z. conducted research; Y.L., J.G., X.Q., K.X., Y.W. and X.L. analyzed data; Y.L., X.Q., K.X. and J.G. wrote the paper; Y.L. and K.X. had primary responsibility for final content. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32272906 and U22A20517).

Institutional Review Board Statement

All experiments were carried out by the Chinese Guidelines for Animal Welfare and Experimental Protocol, and were approved by the Animal Care and Use Committee of Wuhan Polytechnic University.

Data Availability Statement

The data used to support the findings of this study are included in the article.

Acknowledgments

We would like to thank Chien-An Andy Hu (University of New Mexico School of Medicine) and Guolong Zhang (Oklahoma State University) for critical suggestions about experimental design, and Jordan Crawford (University of Arkansas) for reviewing this manuscript.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Nishikawa, H.; Goto, M.; Fukunishi, S.; Asai, A.; Nishiguchi, S.; Higuchi, K. Cancer cachexia: Its mechanism and clinical significance. Int. J. Mol. Sci. 2021, 22, 8491. [Google Scholar] [CrossRef] [PubMed]
  2. Muscaritoli, M.; Anker, S.D.; Argiles, J.; Aversa, Z.; Bauer, J.M.; Biolo, G.; Boirie, Y.; Bosaeus, I.; Cederholm, T.; Costelli, P.; et al. Consensus definition of sarcopenia, cachexia and pre-cachexia: Joint document elaborated by Special Interest Groups (SIG) “cachexia-anorexia in chronic wasting diseases” and “nutrition in geriatrics”. Clin. Nutr. 2010, 29, 154–159. [Google Scholar] [CrossRef] [PubMed]
  3. Fearon, K.C.H.; Glass, D.J.; Guttridge, D.C. Cancer cachexia: Mediators, signaling, and metabolic pathways. Cell Metab. 2012, 16, 153–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Petruzzelli, M.; Wagner, E.F. Mechanisms of metabolic dysfunction in cancer-associated cachexia. Genes Dev. 2016, 30, 489–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Park, J.; Cho, J.; Song, E.J. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment. Arch. Pharm. Res. 2020, 43, 1144–1161. [Google Scholar] [CrossRef]
  6. Kodani, N.; Nakae, J. Tissue-specific metabolic regulation of FOXO-binding protein: FOXO does not act alone. Cells 2020, 9, 702. [Google Scholar] [CrossRef] [Green Version]
  7. Rudar, M.; Fiorotto, M.L.; Davis, T.A. Regulation of muscle growth in early postnatal life in a swine model. Annu. Rev. Anim. Biosci. 2019, 7, 309–335. [Google Scholar] [CrossRef]
  8. Yin, L.; Li, N.; Jia, W.H.; Wang, N.Q.; Liang, M.D.; Yang, X.Y.; Du, G.H. Skeletal muscle atrophy: From mechanisms to treatments. Pharmacol. Res. 2021, 172, 105807. [Google Scholar] [CrossRef]
  9. Crossland, H.; Constantin-Teodosiu, D.; Gardiner, S.M.; Constantin, D.; Greenhaff, P.L. A potential role for Akt/FOXO signalling in both protein loss and the impairment of muscle carbohydrate oxidation during sepsis in rodent skeletal muscle. J. Physiol. Sci. 2008, 586, 5589–5600. [Google Scholar] [CrossRef]
  10. Lala-Tabbert, N.; Lejmi-Mrad, R.; Timusk, K.; Fukano, M.; Holbrook, J.; St-Jean, M.; LaCasse, E.C.; Korneluk, R.G. Targeted ablation of the cellular inhibitor of apoptosis 1 (cIAP1) attenuates denervation-induced skeletal muscle atrophy. Skelet. Muscle 2019, 9, 13. [Google Scholar] [CrossRef]
  11. Dinulovic, I.; Furrer, R.; Di Fulvio, S.; Ferry, A.; Beer, M.; Handschin, C. PGC-1 alpha modulates necrosis, inflammatory response, and fibrotic tissue formation in injured skeletal muscle. Skelet. Muscle 2016, 6, 11. [Google Scholar] [CrossRef] [Green Version]
  12. Ogihara, K.; Aoki, K.; Zubkov, A.Y.; Zhang, J.H. Oxyhemoglobin produces apoptosis and necrosis in cultured smooth muscle cells. Brain Res. 2001, 889, 89–97. [Google Scholar] [CrossRef]
  13. Yuan, J.; Amin, P.; Ofengeim, D. Necroptosis and RIPK1-mediated neuroinflammation in CNS diseases. Nat. Rev. Neurosci. 2019, 20, 19–33. [Google Scholar] [CrossRef]
  14. Yan, J.; Wan, P.; Choksi, S.; Liu, Z.G. Necroptosis and tumor progression. Trends Cancer 2022, 8, 21–27. [Google Scholar] [CrossRef]
  15. Shan, B.; Pan, H.L.; Najafov, A.; Yuan, J.Y. Necroptosis in development and diseases. Genes Dev. 2018, 32, 327–340. [Google Scholar] [CrossRef]
  16. Zhou, W.; Yuan, J.Y. Necroptosis in health and diseases. Semin. Cell Dev. Biol. 2014, 35, 14–23. [Google Scholar] [CrossRef] [Green Version]
  17. Kim, C. The modulation of necroptosis and its therapeutic potentials. Mol. Cell Toxicol. 2021, 17, 93–97. [Google Scholar] [CrossRef]
  18. Xie, Y.; Zhao, Y.; Shi, L.; Li, W.; Chen, K.; Li, M.; Chen, X.; Zhang, H.; Li, T.; Matsuzawa-Ishimoto, Y.; et al. Gut epithelial TSC1/mTOR controls RIPK3-dependent necroptosis in intestinal inflammation and cancer. J. Clin. Investig. 2020, 130, 2111–2128. [Google Scholar] [CrossRef] [Green Version]
  19. Majdi, A.; Aoudjehane, L.; Ratziu, V.; Islam, T.; Afonso, M.B.; Conti, F.; Mestiri, T.; Lagouge, M.; Foufelle, F.; Ballenghien, F.; et al. Inhibition of receptor-interacting protein kinase 1 improves experimental non-alcoholic fatty liver disease. J. Hepatol. 2020, 72, 627–635. [Google Scholar] [CrossRef]
  20. Wang, H.H.; Chen, Y.; Liu, X.D.; Zhang, R.; Wang, X.T.; Zhang, Q.H.; Wei, Y.T.; Fang, F.; Yuan, Y.; Zhou, Q.Q.; et al. TNF-alpha derived from arsenite-induced microglia activation mediated neuronal necroptosis. Ecotoxicol. Environ. Saf. 2022, 236, 13. [Google Scholar] [CrossRef]
  21. Odle, J.; Lin, X.; Jacobi, S.K.; Kim, S.W.; Stahl, C.H. The suckling piglet as an agrimedical model for the study of pediatric nutrition and metabolism. Annu. Rev. Anim. Biosci. 2014, 2, 419–444. [Google Scholar] [CrossRef] [PubMed]
  22. Braun, T.P.; Grossberg, A.J.; Krasnow, S.M.; Levasseur, P.R.; Szumowski, M.; Zhu, X.X.; Maxson, J.E.; Knoll, J.G.; Barnes, A.P.; Marks, D.L. Cancer- and endotoxin-induced cachexia require intact glucocorticoid signaling in skeletal muscle. FASEB J. 2013, 27, 3572–3582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Guan, E.Q.; Wang, Y.; Wang, C.X.; Zhang, R.Y.; Zhao, Y.M.; Hong, J. Necrostatin-1 attenuates lipopolysaccharide-induced acute lung injury in mice. Exp. Lung Res. 2017, 43, 378–387. [Google Scholar] [CrossRef] [PubMed]
  24. Aniort, J.; Stella, A.; Philipponnet, C.; Poyet, A.; Polge, C.; Claustre, A.; Combaret, L.; Béchet, D.; Attaix, D.; Boisgard, S.; et al. Muscle wasting in patients with end-stage renal disease or early-stage lung cancer: Common mechanisms at work. J. Cachexia Sarcopenia Muscle 2019, 10, 323–337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Argiles, J.M.; Lopez-Soriano, F.J.; Busquets, S. Mediators of cachexia in cancer patients. Nutrition 2019, 66, 11–15. [Google Scholar] [CrossRef] [PubMed]
  26. Anker, S.D.; Sharma, R. The syndrome of cardiac cachexia. Int. J. Cardiol. 2002, 85, 51–66. [Google Scholar] [CrossRef]
  27. Biazi, G.R.; Frasson, I.G.; Miksza, D.R.; de Morais, H.; Silva, F.D.; Bertolini, G.L.; de Souza, H.M. Decreased hepatic response to glucagon, adrenergic agonists, and cAMP in glycogenolysis, gluconeogenesis, and glycolysis in tumor-bearing rats. J. Cell Biochem. 2018, 119, 7300–7309. [Google Scholar] [CrossRef]
  28. Trobec, K.; von Haehling, S.; Anker, S.D.; Lainscak, M. Growth hormone, insulin-like growth factor 1, and insulin signaling-a pharmacological target in body wasting and cachexia. J. Cachexia Sarcopenia Muscle 2011, 2, 191–200. [Google Scholar] [CrossRef] [Green Version]
  29. Chiappalupi, S.; Sorci, G.; Vukasinovic, A.; Salvadori, L.; Sagheddu, R.; Coletti, D.; Renga, G.; Romani, L.; Donato, R.; Riuzzi, F. Targeting RAGE prevents muscle wasting and prolongs survival in cancer cachexia. J. Cachexia Sarcopenia Muscle 2020, 11, 929–946. [Google Scholar] [CrossRef] [Green Version]
  30. Argilés, J.M.; Busquets, S.; Stemmler, B.; López-Soriano, F.J. Cancer cachexia: Understanding the molecular basis. Nat. Rev. Cancer 2014, 14, 754–762. [Google Scholar] [CrossRef]
  31. Porporato, P.E. Understanding cachexia as a cancer metabolism syndrome. Oncogenesis 2016, 5, e200. [Google Scholar] [CrossRef] [Green Version]
  32. Zhao, H.; Jaffer, T.; Eguchi, S.; Wang, Z.; Linkermann, A.; Ma, D. Role of necroptosis in the pathogenesis of solid organ injury. Cell Death Dis. 2015, 6, 10. [Google Scholar] [CrossRef] [Green Version]
  33. Chen, S.; Lv, X.; Hu, B.; Shao, Z.; Wang, B.; Ma, K.; Lin, H.; Cui, M. RIPK1/RIPK3/MLKL-mediated necroptosis contributes to compression-induced rat nucleus pulposus cells death. Apoptosis 2017, 22, 626–638. [Google Scholar] [CrossRef]
  34. Jog, N.R.; Caricchio, R. The role of necrotic cell death in the pathogenesis of immune mediated nephropathies. Clin. Immunol. 2014, 153, 243–253. [Google Scholar] [CrossRef] [Green Version]
  35. Kang, P.; Zhang, L.; Hou, Y.; Ding, B.; Yi, D.; Wang, L.; Zhu, H.; Liu, Y.; Yin, Y.; Wu, G. Effects of L-proline on the growth performance, and blood parameters in weaned lipopolysaccharide (LPS)-challenged pigs. Asian-Australas J. Anim. Sci. 2014, 27, 1150–1156. [Google Scholar] [CrossRef]
  36. Landgraf, M.A.; Silva, R.C.; Corrêa-Costa, M.; Hiyane, M.I.; Carvalho, M.H.; Landgraf, R.G.; Câmara, N.O. Leptin downregulates LPS-induced lung injury: Role of corticosterone and insulin. Cell Physiol. Biochem. 2014, 33, 835–846. [Google Scholar] [CrossRef] [Green Version]
  37. Nordgreen, J.; Munsterhjelm, C.; Aae, F.; Popova, A.; Boysen, P.; Ranheim, B.; Heinonen, M.; Raszplewicz, J.; Piepponen, P.; Lervik, A.; et al. The effect of lipopolysaccharide (LPS) on inflammatory markers in blood and brain and on behavior in individually-housed pigs. Physiol. Behav. 2018, 195, 98–111. [Google Scholar] [CrossRef]
  38. Xiong, X.Y.; Liang, J.; Xu, Y.Q.; Liu, Y. The Tilapia collagen peptide mixture TY001 protects against LPS-induced inflammation, disruption of glucose metabolism, and aberrant expression of circadian clock genes in mice. Chronobiol. Int. 2019, 36, 1013–1023. [Google Scholar] [CrossRef]
  39. Schmidt, S.F.; Rohm, M.; Herzig, S.; Berriel Diaz, M. Cancer cachexia: More than skeletal muscle wasting. Trends Cancer 2018, 4, 849–860. [Google Scholar] [CrossRef]
  40. Liu, Y.; Chen, F.; Odle, J.; Lin, X.; Zhu, H.; Shi, H.; Hou, Y.; Yin, J. Fish oil increases muscle protein mass and modulates Akt/FOXO, TLR4, and NOD signaling in weanling piglets after lipopolysaccharide challenge. J. Nutr. 2013, 143, 1331–1339. [Google Scholar] [CrossRef] [Green Version]
  41. Valentine, R.J.; Jefferson, M.A.; Kohut, M.L.; Eo, H. Imoxin attenuates LPS-induced inflammation and MuRF1 expression in mouse skeletal muscle. Physiol. Rep. 2018, 6, e13941. [Google Scholar] [CrossRef] [PubMed]
  42. Bivona, J.J., 3rd; Crymble, H.M.; Guigni, B.A.; Stapleton, R.D.; Files, D.C.; Toth, M.J.; Poynter, M.E.; Suratt, B.T. Macrophages augment the skeletal muscle proinflammatory response through TNFα following LPS-induced acute lung injury. FASEB J. 2021, 35, e21462. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, H.; Chi, M.; Chen, L.; Sun, X.; Wan, L.; Yang, Q.; Guo, C. Linalool prevents cisplatin induced muscle atrophy by regulating IGF-1/Akt/FOXO pathway. Front. Pharmacol. 2020, 11, 598166. [Google Scholar] [CrossRef] [PubMed]
  44. Goldbraikh, D.; Neufeld, D.; Eid-Mutlak, Y.; Lasry, I.; Gilda, J.E.; Parnis, A.; Cohen, S. USP1 deubiquitinates Akt to inhibit PI3K-Akt-FoxO signaling in muscle during prolonged starvation. EMBO Rep. 2020, 21, e48791. [Google Scholar] [CrossRef] [PubMed]
  45. Liu, Y.; Wang, X.; Leng, W.; Pi, D.; Tu, Z.; Zhu, H.; Shi, H.; Li, S.; Hou, Y.; Hu, C.A. Aspartate inhibits LPS-induced MAFbx and MuRF1 expression in skeletal muscle in weaned pigs by regulating Akt, AMPKα and FOXO1. Innate Immun. 2017, 23, 34–43. [Google Scholar] [CrossRef]
  46. Lecker, S.H.; Jagoe, R.T.; Gilbert, A.; Gomes, M.; Baracos, V.; Bailey, J.; Price, S.R.; Mitch, W.E.; Goldberg, A.L. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J. 2004, 18, 39–51. [Google Scholar] [CrossRef] [Green Version]
  47. Glass, D.J. Skeletal muscle hypertrophy and atrophy signaling pathways. Int. J. Biochem. Cell Biol. 2005, 37, 1974–1984. [Google Scholar] [CrossRef]
  48. Liu, Y.; Beyer, A.; Aebersold, R. On the dependency of cellular protein levels on mRNA abundance. Cell 2016, 165, 535–550. [Google Scholar] [CrossRef] [Green Version]
  49. Morgan, J.E.; Prola, A.; Mariot, V.; Pini, V.; Meng, J.; Hourde, C.; Dumonceaux, J.; Conti, F.; Relaix, F.; Authier, F.J.; et al. Necroptosis mediates myofibre death in dystrophin-deficient mice. Nat. Commun. 2018, 9, 3655. [Google Scholar] [CrossRef]
  50. Yan, B.; Zhang, H.; Dai, T.; Gu, Y.; Qiu, X.; Hu, C.; Liu, Y.; Wei, K.; Li, D. Necrostatin-1 promotes ectopic periodontal tissue like structure regeneration in LPS-treated PDLSCs. PLoS ONE 2018, 13, e0207760. [Google Scholar] [CrossRef] [Green Version]
  51. Chen, Y.; Zhu, C.J.; Zhu, F.; Dai, B.B.; Song, S.J.; Wang, Z.Q.; Feng, Y.B.; Ge, J.F.; Zhou, R.P.; Chen, F.H. Necrostatin-1 ameliorates adjuvant arthritis rat articular chondrocyte injury via inhibiting ASIC1a-mediated necroptosis. Biochem. Biophys. Res. Commun. 2018, 504, 843–850. [Google Scholar] [CrossRef]
  52. Han, X.A.; Jie, H.Y.; Wang, J.H.; Zhang, X.M.; Wang, J.; Yu, C.X.; Zhang, J.L.; He, J.; Chen, J.Q.; Lai, K.F.; et al. Necrostatin-1 ameliorates neutrophilic inflammation in asthma by suppressing MLKL phosphorylation to inhibiting NETs release. Front. Immunol. 2020, 11, 666. [Google Scholar] [CrossRef] [Green Version]
  53. Lin, P.T.; Xue, X.D.; Zhao, Z.D.; Lu, J.Y.; Xie, P.L. Necrostatin-1, RIP1/RIP3 inhibitor, relieves transforming growth factor β-induced wound-healing process in formation of hypertrophic scars. J. Cosmet. Dermatol. 2021, 20, 2612–2618. [Google Scholar] [CrossRef]
  54. Kamiya, M.; Mizoguchi, F.; Kawahata, K.; Wang, D.; Nishibori, M.; Day, J.; Louis, C.; Wicks, I.P.; Kohsaka, H.; Yasuda, S. Targeting necroptosis in muscle fibers ameliorates inflammatory myopathies. Nat. Commun. 2022, 13, 166. [Google Scholar] [CrossRef]
  55. Johnson, L.R.; Chandler, A.M. RNA and DNA of gastric and duodenal mucosa in antrectomized and gastrin-treated rats. Am. J. Physiol. Renal. Physiol. 1973, 224, 937–940. [Google Scholar] [CrossRef]
  56. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−△△CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Ijms 24 10923 g001 550
Figure 1. LPS challenge dynamically changes physiological and biochemical indexes for the diagnosis of cachexia in weanling pigs. Blood and longissimus dorsi muscle samples were collected from the control group (0 h after injection of saline) and LPS-treated groups (1, 2, 4, 8, 12, and 24 h after injection of LPS) (A–D) The concentrations of INS, GH, COR, and GLU in the plasma. (E) Representative morphological characteristics of H&E staining of longissimus dorsi muscle. Arrows indicate muscle-fiber-free nuclei (a), inflammatory cell infiltration (b), hemorrhage (c), membrane rupture (d), fibroblast hyperplasia (e), and muscle-fiber dissolution and atrophy (f). Original magnification: 400×, scale bars = 50 μm. (F) Representative ultrastructure of longissimus dorsi muscle observed by using TEM. Arrows indicate mitochondrial cristae shedding and dissolution (a), muscle-fiber dissolution and fracture (b), and Z-line fuzziness and distortion (c). Magnification: 6000×, scale bars = 2 μm. (G–I) Protein and DNA concentrations and protein/DNA ratio in muscle. Data are presented as means ± standard errors of the mean (SEM), n = 6. *** p < 0.001, ** p < 0.01, * p < 0.05, and # 0.05 < p < 0.10, different from the control group (0 h).
Figure 1. LPS challenge dynamically changes physiological and biochemical indexes for the diagnosis of cachexia in weanling pigs. Blood and longissimus dorsi muscle samples were collected from the control group (0 h after injection of saline) and LPS-treated groups (1, 2, 4, 8, 12, and 24 h after injection of LPS) (A–D) The concentrations of INS, GH, COR, and GLU in the plasma. (E) Representative morphological characteristics of H&E staining of longissimus dorsi muscle. Arrows indicate muscle-fiber-free nuclei (a), inflammatory cell infiltration (b), hemorrhage (c), membrane rupture (d), fibroblast hyperplasia (e), and muscle-fiber dissolution and atrophy (f). Original magnification: 400×, scale bars = 50 μm. (F) Representative ultrastructure of longissimus dorsi muscle observed by using TEM. Arrows indicate mitochondrial cristae shedding and dissolution (a), muscle-fiber dissolution and fracture (b), and Z-line fuzziness and distortion (c). Magnification: 6000×, scale bars = 2 μm. (G–I) Protein and DNA concentrations and protein/DNA ratio in muscle. Data are presented as means ± standard errors of the mean (SEM), n = 6. *** p < 0.001, ** p < 0.01, * p < 0.05, and # 0.05 < p < 0.10, different from the control group (0 h).
Ijms 24 10923 g001
Ijms 24 10923 g002 550
Figure 2. LPS challenge dynamically induces inflammatory response and activates muscle protein degradation signaling pathway in weanling pigs. Longissimus dorsi muscle samples were collected from the control group (0 h after injection of saline) and LPS-treated groups (1, 2, 4, 8, 12, and 24 h after injection of LPS). (A–G) mRNA levels of pro-inflammatory cytokines (including TNF-α, IL-1β, and IL-6) and the key components of muscle protein degradation signaling pathway (including Akt, FOXO1, MuRF1, and MAFbx). (H) Representative image of t-Akt, p-Akt, t-FOXO1, and p-FOXO1 protein expression. (I–N) Protein expression of t-Akt, p-Akt, t-FOXO1, and p-FOXO1. Data are presented as means ± SEM, n = 6. *** p < 0.001, ** p < 0.01, * p < 0.05, and # 0.05 < p < 0.10, different from the control group (0 h).
Figure 2. LPS challenge dynamically induces inflammatory response and activates muscle protein degradation signaling pathway in weanling pigs. Longissimus dorsi muscle samples were collected from the control group (0 h after injection of saline) and LPS-treated groups (1, 2, 4, 8, 12, and 24 h after injection of LPS). (A–G) mRNA levels of pro-inflammatory cytokines (including TNF-α, IL-1β, and IL-6) and the key components of muscle protein degradation signaling pathway (including Akt, FOXO1, MuRF1, and MAFbx). (H) Representative image of t-Akt, p-Akt, t-FOXO1, and p-FOXO1 protein expression. (I–N) Protein expression of t-Akt, p-Akt, t-FOXO1, and p-FOXO1. Data are presented as means ± SEM, n = 6. *** p < 0.001, ** p < 0.01, * p < 0.05, and # 0.05 < p < 0.10, different from the control group (0 h).
Ijms 24 10923 g002
Ijms 24 10923 g003 550
Figure 3. LPS challenge dynamically induces muscle necroptosis in weanling pigs. Longissimus dorsi muscle samples were collected from the control group (0 h after injection of saline) and LPS-treated groups (1, 2, 4, 8,12, and 24 h after injection of LPS). (A–C) mRNA levels of RIP1, RIP3, and MLKL. (D–M) Protein expression of t-RIP1, p-RIP1, t-RIP3, p-RIP3, t-MLKL, and p-MLKL. Data are presented as means ± SEM, n = 6. *** p < 0.001, ** p < 0.01, * p < 0.05, and # 0.05 < p < 0.10, different from the control group (0 h).
Figure 3. LPS challenge dynamically induces muscle necroptosis in weanling pigs. Longissimus dorsi muscle samples were collected from the control group (0 h after injection of saline) and LPS-treated groups (1, 2, 4, 8,12, and 24 h after injection of LPS). (A–C) mRNA levels of RIP1, RIP3, and MLKL. (D–M) Protein expression of t-RIP1, p-RIP1, t-RIP3, p-RIP3, t-MLKL, and p-MLKL. Data are presented as means ± SEM, n = 6. *** p < 0.001, ** p < 0.01, * p < 0.05, and # 0.05 < p < 0.10, different from the control group (0 h).
Ijms 24 10923 g003
Ijms 24 10923 g004 550
Figure 4. Nec-1 inhibits muscle necroptosis induced by LPS in weanling pigs. The piglets were pretreated with Nec-1 or DMSO for 30 min and then injected with saline or LPS for 4 h. (A–C) mRNA levels of RIP1, RIP3, and MLKL. (D–M) Protein expression of t-RIP1, p-RIP1, t-RIP3, p-RIP3, t-MLKL, and p-MLKL. Data are presented as the means ± SEM, n = 6. abc means without a common letter differ (p < 0.05).
Figure 4. Nec-1 inhibits muscle necroptosis induced by LPS in weanling pigs. The piglets were pretreated with Nec-1 or DMSO for 30 min and then injected with saline or LPS for 4 h. (A–C) mRNA levels of RIP1, RIP3, and MLKL. (D–M) Protein expression of t-RIP1, p-RIP1, t-RIP3, p-RIP3, t-MLKL, and p-MLKL. Data are presented as the means ± SEM, n = 6. abc means without a common letter differ (p < 0.05).
Ijms 24 10923 g004
Ijms 24 10923 g005 550
Figure 5. Inhibition of necroptosis by Nec-1 relieves muscle structure injury, inflammation, and protein degradation induced by LPS in weanling pigs. The piglets were pretreated with Nec-1 or DMSO for 30 min and then injected with saline or LPS for 4 h. (A,B) The concentrations of GH and COR in the plasma. (C) Representative morphological characteristics of H&E staining of longissimus dorsi muscle. Arrows indicate muscle-fiber-free nuclei (a), inflammatory cell infiltration (b), hemorrhage (c), membrane rupture (d), fibroblast hyperplasia (e), and muscle-fiber dissolution and atrophy (f). Original magnification: 400×, scale bars = 50 μm. (D–F) Protein and DNA concentrations and protein/DNA ratio in muscle. (G–M) mRNA levels of pro-inflammatory cytokines (including TNF-α, IL-1β, and IL-6) and the key components of muscle protein degradation signaling pathway (including Akt, FOXO1, MuRF1, and MAFbx). (N–T) Protein expression of t-Akt, p-Akt, t-FOXO1, and p-FOXO1. Data are presented as the means ± SEM, n = 6. abc means without a common letter differ (p < 0.05).
Figure 5. Inhibition of necroptosis by Nec-1 relieves muscle structure injury, inflammation, and protein degradation induced by LPS in weanling pigs. The piglets were pretreated with Nec-1 or DMSO for 30 min and then injected with saline or LPS for 4 h. (A,B) The concentrations of GH and COR in the plasma. (C) Representative morphological characteristics of H&E staining of longissimus dorsi muscle. Arrows indicate muscle-fiber-free nuclei (a), inflammatory cell infiltration (b), hemorrhage (c), membrane rupture (d), fibroblast hyperplasia (e), and muscle-fiber dissolution and atrophy (f). Original magnification: 400×, scale bars = 50 μm. (D–F) Protein and DNA concentrations and protein/DNA ratio in muscle. (G–M) mRNA levels of pro-inflammatory cytokines (including TNF-α, IL-1β, and IL-6) and the key components of muscle protein degradation signaling pathway (including Akt, FOXO1, MuRF1, and MAFbx). (N–T) Protein expression of t-Akt, p-Akt, t-FOXO1, and p-FOXO1. Data are presented as the means ± SEM, n = 6. abc means without a common letter differ (p < 0.05).
Ijms 24 10923 g005
Table
Table 1. Primer sequences used in real-time PCR.
Table 1. Primer sequences used in real-time PCR.
GenePrimer SequenceAmplification LengthSERIAL NUMBER
TNF-αF: TCCAATGGCAGAGTGGGTATG67NM_214022.1
R: AGCTGGTTGTCTTTCAGCTTCAC
IL-1βF: GCTAACTACGGTGACAACAATAATG186NM_214055.1
R: CTTCTCCACTGCCACGATGA
IL-6F: AAGGTGATGCCACCTCAGAC151JQ839263.1
R: TCTGCCAGTACCTCCTTGCT
AktF: GAAGAAGGAGGTCATCGT178NM_001159776.1
R: GGACAGGTGGAAGAAGAG
FOXO-1F: TTCACCAGGCACCATCAT236NM_214014.2
R: GAGGAGAGTCGGAAGTAAGT
MuFR1F: ATGGAGAACCTGGAGAAGCA219FJ905227.1
R: ACGGTCCATGATCACCTCAT
MAFbxF: TCACAGCTCACATCCCTGAG167NM_001044588.1
R: GACTTGCCGACTCTCTGGAC
RIP1F: ACATCCTGTACGGCAACTCT175XM_005665538.2
R: CGGGTCCAGGTGTTTATCC
RIP3F: CTTGTTGTCTGTCCGTGAGC238XM_001927424.3
R: GAGGAGGTTGGGCTGTTGA
MLKLF: TCTCGCTGCTGCTTCA105XM_013998184.1
R: CTCGCTTGTCTTCCTCTG
GAPDHF: CGTCCCTGAGACACGATGGT194AF017079.1
R: GCCTTGACTGTGCCGTGGAAT
TNF, Tumor necrosis factor; IL, Interleukin; Akt, Serine/threonine kinase; FOXO1, Forkhead box O 1; MuRF1, Muscle RING finger 1; MAFbx, Muscle atrophy F-box; RIP, Receptor interacting protein kinase; MLKL, Mixed lineage kinase domain-like protein; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.
Table
Table 2. The information of antibodies used in Western blot.
Table 2. The information of antibodies used in Western blot.
Antibodies (Host)Catalog NumberManufacturersDilution Ratio
RIP1 (rabbit)LS-B8214LifeSpan BioSciences (Lynnwood, WA, USA)1:1000
p-RIP1 (rabbit)91702SCell Signaling Technology (Danvers, MA, USA)1:1000
RIP3 (rabbit)SC-135170Santa Cruz Biotechnology (Dallas, TX, USA)1:1000
p-RIP1 (rabbit)91702SCell Signaling Technology1:1000
MLKL (rabbit)37705SCell Signaling Technology1:1000
p-MLKL (rabbit)62233SCell Signaling Technology1:1000
Akt (rabbit)9272SCell Signaling Technology1:1000
p-Akt (rabbit)9271SCell Signaling Technology1:1000
FOXO1 (rabbit)9454SCell Signaling Technology1:1000
p-FOXO1 (rabbit)9464SCell Signaling Technology1:1000
GAPDH (mouse)FD0063Hangzhou Fude Biological Technology (Hangzhou, China)1:5000
IgG-HRP (goat anti-rabbit)ANT020Wuhan Antejie Biotechnology(Wuhan, China)1:5000
IgG-HRP (goat anti-mouse)ANT019Wuhan Antejie Biotechnology1:5000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, J.; Qin, X.; Wang, Y.; Li, X.; Wang, X.; Zhu, H.; Chen, S.; Zhao, J.; Xiao, K.; Liu, Y. Necroptosis Mediates Muscle Protein Degradation in a Cachexia Model of Weanling Pig with Lipopolysaccharide Challenge. Int. J. Mol. Sci. 2023, 24, 10923. https://doi.org/10.3390/ijms241310923

AMA Style

Guo J, Qin X, Wang Y, Li X, Wang X, Zhu H, Chen S, Zhao J, Xiao K, Liu Y. Necroptosis Mediates Muscle Protein Degradation in a Cachexia Model of Weanling Pig with Lipopolysaccharide Challenge. International Journal of Molecular Sciences. 2023; 24(13):10923. https://doi.org/10.3390/ijms241310923

Chicago/Turabian Style

Guo, Junjie, Xu Qin, Yang Wang, Xiangen Li, Xiuying Wang, Huiling Zhu, Shaokui Chen, Jiangchao Zhao, Kan Xiao, and Yulan Liu. 2023. "Necroptosis Mediates Muscle Protein Degradation in a Cachexia Model of Weanling Pig with Lipopolysaccharide Challenge" International Journal of Molecular Sciences 24, no. 13: 10923. https://doi.org/10.3390/ijms241310923

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop