NET Formation Was Reduced via Exposure to Extremely Low-Frequency Pulsed Electromagnetic Fields
Abstract
:1. Introduction
2. Results
2.1. 16 Hz ELF-PEMF Exposure Does Not Affect ROS Formation or Ca2+ Influx
2.2. 16 Hz ELF-PEMF Exposure Does Not Induce NET Formation
2.3. 16 Hz ELF-PEMF Exposure Does Not Change MAPK Activation
2.4. The 16 Hz ELF-PEMF Exposure Reduces NET Formation by Not Only PMA but Also by LPS and H2O2
3. Discussion
4. Materials and Methods
4.1. Neutrophil Isolation
4.2. ELF-PEMF Exposure
4.3. ROS Measurement
4.4. Ca2+ Measurement
4.5. RNA Isolation and cDNA Synthesis
4.6. RT-PCR
4.7. Sytox Green Assay
4.8. Immunofluorescence
4.9. Western Blot
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gomez-Barrena, E.; Rosset, P.; Lozano, D.; Stanovici, J.; Ermthaller, C.; Gerbhard, F. Bone fracture healing: Cell therapy in delayed unions and nonunions. Bone 2015, 70, 93–101. [Google Scholar] [CrossRef]
- Karl, T.; Gussmann, A.; Storck, M. Chronische Wunden—Perspektiven der integrierten Versorgung. Zentralblatt Chir. 2007, 132, 232–235. [Google Scholar] [CrossRef]
- Ziegler, P.; Nussler, A.K.; Wilbrand, B.; Falldorf, K.; Springer, F.; Fentz, A.K.; Eschenburg, G.; Ziegler, A.; Stöckle, U.; Maurer, E.; et al. Pulsed Electromagnetic Field Therapy Improves Osseous Consolidation after High Tibial Osteotomy in Elderly Patients-A Randomized, Placebo-Controlled, Double-Blind Trial. J. Clin. Med. 2019, 8, 2008. [Google Scholar] [CrossRef]
- Caliogna, L.; Medetti, M.; Bina, V.; Brancato, A.M.; Castelli, A.; Jannelli, E.; Ivone, A.; Gastaldi, G.; Annunziata, S.; Mosconi, M.; et al. Pulsed Electromagnetic Fields in Bone Healing: Molecular Pathways and Clinical Applications. Int. J. Mol. Sci. 2021, 22, 7403. [Google Scholar] [CrossRef]
- Zhu, S.; He, H.; Zhang, C.; Wang, H.; Gao, C.; Yu, X.; He, C. Effects of pulsed electromagnetic fields on postmenopausal osteoporosis. Bioelectromagnetics 2017, 38, 406–424. [Google Scholar] [CrossRef]
- Mumtaz, S.; Rana, J.N.; Choi, E.H.; Han, I. Microwave Radiation and the Brain: Mechanisms, Current Status, and Future Prospects. Int. J. Mol. Sci. 2022, 23, 9288. [Google Scholar] [CrossRef]
- Goodman, R.; Shirley-Henderson, A. Exposure of cells to extremely low-frequency electromagnetic fields: Relationship to malignancy. Cancer Cells 1990, 2, 355–359. [Google Scholar]
- Zhang, X.; Zhang, J.; Qu, X.; Wen, J. Effects of Different Extremely Low-Frequency Electromagnetic Fields on Osteoblasts. Electromagn. Biol. Med. 2007, 26, 167–177. [Google Scholar] [CrossRef]
- Ehnert, S.; Fentz, A.K.; Schreiner, A.; Birk, J.; Wilbrand, B.; Ziegler, P.; Reumann, M.K.; Wang, H.; Falldorf, K.; Nussler, A.K. Extremely low frequency pulsed electromagnetic fields cause antioxidative defense mechanisms in human osteoblasts via induction of •O2− and H2O2. Sci. Rep. 2017, 7, 14544. [Google Scholar] [CrossRef]
- Chen, Y.; Aspera-Werz, R.H.; Menger, M.M.; Falldorf, K.; Ronniger, M.; Stacke, C.; Histing, T.; Nussler, A.K.; Ehnert, S. Exposure to 16 Hz Pulsed Electromagnetic Fields Protect the Structural Integrity of Primary Cilia and Associated TGF-β Signaling in Osteoprogenitor Cells Harmed by Cigarette Smoke. Int. J. Mol. Sci. 2021, 22, 7036. [Google Scholar] [CrossRef]
- Chen, Y.; Braun, B.J.; Menger, M.M.; Ronniger, M.; Falldorf, K.; Histing, T.; Nussler, A.K.; Ehnert, S. Intermittent Exposure to a 16 Hz Extremely Low Frequency Pulsed Electromagnetic Field Promotes Osteogenesis In Vitro through Activating Piezo 1-Induced Ca2+ Influx in Osteoprogenitor Cells. J. Funct. Biomater. 2023, 14, 165. [Google Scholar] [CrossRef]
- Hoff, P.; Gaber, T.; Strehl, C.; Jakstadt, M.; Hoff, H.; Schmidt-Bleek, K.; Lang, A.; Rohner, E.; Huscher, D.; Matziolis, G.; et al. A Pronounced Inflammatory Activity Characterizes the Early Fracture Healing Phase in Immunologically Restricted Patients. Int. J. Mol. Sci. 2017, 18, 583. [Google Scholar] [CrossRef]
- Julier, Z.; Park, A.J.; Briquez, P.S.; Martino, M.M. Promoting tissue regeneration by modulating the immune system. Acta Biomater. 2017, 53, 13–28. [Google Scholar] [CrossRef]
- Kovtun, A.; Bergdolt, S.; Wiegner, R.; Radermacher, P.; Huber-Lang, M.; Ignatius, A. The crucial role of neutrophil granulocytes in bone fracture healing. Eur. Cell Mater. 2016, 32, 152–162. [Google Scholar] [CrossRef]
- McIlroy, D.J.; Jarnicki, A.G.; Au, G.G.; Lott, N.; Smith, D.W.; Hansbro, P.M.; Balogh, Z.J. Mitochondrial DNA neutrophil extracellular traps are formed after trauma and subsequent surgery. J. Crit. Care 2014, 29, 1133.e1–1133.e5. [Google Scholar] [CrossRef]
- Wang, J. Neutrophils in tissue injury and repair. Cell Tissue Res. 2018, 371, 531–539. [Google Scholar] [CrossRef]
- Yang, S.; Gu, Z.; Lu, C.; Zhang, T.; Guo, X.; Xue, G.; Zhang, L. Neutrophil Extracellular Traps Are Markers of Wound Healing Impairment in Patients with Diabetic Foot Ulcers Treated in a Multidisciplinary Setting. Adv. Wound Care 2020, 9, 16–27. [Google Scholar] [CrossRef]
- Lee, K.H.; Cavanaugh, L.; Leung, H.; Yan, F.; Ahmadi, Z.; Chong, B.H.; Passam, F. Quantification of NETs-associated markers by flow cytometry and serum assays in patients with thrombosis and sepsis. Int. J. Lab. Hematol. 2018, 40, 392–399. [Google Scholar] [CrossRef]
- Azzouz, D.; Khan, M.A.; Palaniyar, N. ROS induces NETosis by oxidizing DNA and initiating DNA repair. Cell Death Discov. 2021, 7, 113. [Google Scholar] [CrossRef]
- Golbach, L.A.; Scheer, M.H.; Cuppen, J.J.; Savelkoul, H.; Verburg-van Kemenade, B.M. Low-Frequency Electromagnetic Field Exposure Enhances Extracellular Trap Formation by Human Neutrophils through the NADPH Pathway. J. Innate Immun. 2015, 7, 459–465. [Google Scholar] [CrossRef]
- Cuppen, J.J.M.; Gradinaru, C.; Raap-van Sleuwen, B.E.; de Wit, A.C.E.; van der Vegt, T.; Savelkoul, H.F.J. LF-EMF Compound Block Type Signal Activates Human Neutrophilic Granulocytes In Vivo. Bioelectromagnetics 2022, 43, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Menger, M.M.; Braun, B.J.; Schweizer, S.; Linnemann, C.; Falldorf, K.; Ronniger, M.; Wang, H.; Histing, T.; Nussler, A.K.; et al. Modulation of Macrophage Activity by Pulsed Electromagnetic Fields in the Context of Fracture Healing. Bioengineering 2021, 8, 167. [Google Scholar] [CrossRef] [PubMed]
- Frahm, J.; Lantow, M.; Lupke, M.; Weiss, D.G.; Simkó, M. Alteration in cellular functions in mouse macrophages after exposure to 50 Hz magnetic fields. J. Cell. Biochem. 2006, 99, 168–177. [Google Scholar] [CrossRef] [PubMed]
- Lupke, M.; Rollwitz, J.; Simkó, M. Cell Activating Capacity of 50 Hz Magnetic Fields to Release Reactive Oxygen Intermediates in Human Umbilical Cord Blood-derived Monocytes and in Mono Mac 6 Cells. Free Radic. Res. 2004, 38, 985–993. [Google Scholar] [CrossRef] [PubMed]
- Kirchner, T.; Möller, S.; Klinger, M.; Solbach, W.; Laskay, T.; Behnen, M. The impact of various reactive oxygen species on the formation of neutrophil extracellular traps. Mediat. Inflamm. 2012, 2012, 849136. [Google Scholar] [CrossRef]
- Metzler, K.D.; Fuchs, T.A.; Nauseef, W.M.; Reumaux, D.; Roesler, J.; Schulze, I.; Wahn, V.; Papayannopoulos, V.; Zychlinsky, A. Myeloperoxidase is required for neutrophil extracellular trap formation: Implications for innate immunity. Blood 2011, 117, 953–959. [Google Scholar] [CrossRef]
- Jin, M.; Blank, M.; Goodman, R. ERK1/2 phosphorylation, induced by electromagnetic fields, diminishes during neoplastic transformation. J. Cell. Biochem. 2000, 78, 371–379. [Google Scholar] [CrossRef]
- Nie, K.; Henderson, A. MAP kinase activation in cells exposed to a 60 Hz electromagnetic field. J. Cell. Biochem. 2003, 90, 1197–1206. [Google Scholar] [CrossRef]
- Douda, D.N.; Khan, M.A.; Grasemann, H.; Palaniyar, N. SK3 channel and mitochondrial ROS mediate NADPH oxidase-independent NETosis induced by calcium influx. Proc. Natl. Acad. Sci. USA 2015, 112, 2817–2822. [Google Scholar] [CrossRef]
- Heuer, A.; Stiel, C.; Elrod, J.; Königs, I.; Vincent, D.; Schlegel, P.; Trochimiuk, M.; Appl, B.; Reinshagen, K.; Raluy, L.P.; et al. Therapeutic Targeting of Neutrophil Extracellular Traps Improves Primary and Secondary Intention Wound Healing in Mice. Front. Immunol. 2021, 12, 614347. [Google Scholar] [CrossRef]
- de Bont, C.M.; Koopman, W.J.H.; Boelens, W.C.; Pruijn, G.J.M. Stimulus-dependent chromatin dynamics, citrullination, calcium signalling and ROS production during NET formation. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 1621–1629. [Google Scholar] [CrossRef] [PubMed]
- Varani, K.; Vincenzi, F.; Pasquini, S.; Blo, I.; Salati, S.; Cadossi, M.; De Mattei, M. Pulsed Electromagnetic Field Stimulation in Osteogenesis and Chondrogenesis: Signaling Pathways and Therapeutic Implications. Int. J. Mol. Sci. 2021, 22, 809. [Google Scholar] [CrossRef] [PubMed]
- Cadossi, R.; Massari, L.; Racine-Avila, J.; Aaron, R.K. Pulsed Electromagnetic Field Stimulation of Bone Healing and Joint Preservation: Cellular Mechanisms of Skeletal Response. J. Am. Acad. Orthop. Surg. Glob. Res. Rev. 2020, 4, e1900155. [Google Scholar] [CrossRef] [PubMed]
- Antonsson, E.K.; Mann, R.W. The frequency content of gait. J. Biomech. 1985, 18, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Petecchia, L.; Sbrana, F.; Utzeri, R.; Vercellino, M.; Usai, C.; Visai, L.; Vassalli, M.; Gavazzo, P. Electro-magnetic field promotes osteogenic differentiation of BM-hMSCs through a selective action on Ca(2+)-related mechanisms. Sci. Rep. 2015, 5, 13856. [Google Scholar] [CrossRef]
- Stoiber, W.; Obermayer, A.; Steinbacher, P.; Krautgartner, W.D. The Role of Reactive Oxygen Species (ROS) in the Formation of Extracellular Traps (ETs) in Humans. Biomolecules 2015, 5, 702–723. [Google Scholar] [CrossRef]
- Marques-Carvalho, A.; Kim, H.-N.; Almeida, M. The role of reactive oxygen species in bone cell physiology and pathophysiology. Bone Rep. 2023; in press. [Google Scholar] [CrossRef]
- Winterbourn, C.C.; Kettle, A.J.; Hampton, M.B. Reactive Oxygen Species and Neutrophil Function. Annu. Rev. Biochem. 2016, 85, 765–792. [Google Scholar] [CrossRef]
- Kang, I.S.; Kim, C. NADPH oxidase gp91phox contributes to RANKL-induced osteoclast differentiation by upregulating NFATc1. Sci. Rep. 2016, 6, 38014. [Google Scholar] [CrossRef]
- Lee, N.K.; Choi, Y.G.; Baik, J.Y.; Han, S.Y.; Jeong, D.-w.; Bae, Y.S.; Kim, N.; Lee, S.Y. A crucial role for reactive oxygen species in RANKL-induced osteoclast differentiation. Blood 2005, 106, 852–859. [Google Scholar] [CrossRef]
- Keshari, R.S.; Verma, A.; Barthwal, M.K.; Dikshit, M. Reactive oxygen species-induced activation of ERK and p38 MAPK mediates PMA-induced NETs release from human neutrophils. J. Cell. Biochem. 2013, 114, 532–540. [Google Scholar] [CrossRef] [PubMed]
- Dang, P.M.; Stensballe, A.; Boussetta, T.; Raad, H.; Dewas, C.; Kroviarski, Y.; Hayem, G.; Jensen, O.N.; Gougerot-Pocidalo, M.A.; El-Benna, J. A specific p47phox -serine phosphorylated by convergent MAPKs mediates neutrophil NADPH oxidase priming at inflammatory sites. J. Clin. Investig. 2006, 116, 2033–2043. [Google Scholar] [CrossRef] [PubMed]
- Metzler, K.D.; Goosmann, C.; Lubojemska, A.; Zychlinsky, A.; Papayannopoulos, V. A myeloperoxidase-containing complex regulates neutrophil elastase release and actin dynamics during NETosis. Cell Rep. 2014, 8, 883–896. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Li, M.; Lindberg, M.R.; Kennett, M.J.; Xiong, N.; Wang, Y. PAD4 is essential for antibacterial innate immunity mediated by neutrophil extracellular traps. J. Exp. Med. 2010, 207, 1853–1862. [Google Scholar] [CrossRef] [PubMed]
- Poniedzialek, B.; Rzymski, P.; Nawrocka-Bogusz, H.; Jaroszyk, F.; Wiktorowicz, K. The effect of electromagnetic field on reactive oxygen species production in human neutrophils in vitro. Electromagn. Biol. Med. 2013, 32, 333–341. [Google Scholar] [CrossRef]
- Immler, R.; Simon, S.I.; Sperandio, M. Calcium signalling and related ion channels in neutrophil recruitment and function. Eur. J. Clin. Investig. 2018, 48 (Suppl. S2), e12964. [Google Scholar] [CrossRef]
- Solis, A.G.; Bielecki, P.; Steach, H.R.; Sharma, L.; Harman, C.C.D.; Yun, S.; de Zoete, M.R.; Warnock, J.N.; To, S.D.F.; York, A.G.; et al. Mechanosensation of cyclical force by PIEZO1 is essential for innate immunity. Nature 2019, 573, 69–74. [Google Scholar] [CrossRef]
- Ekpenyong, A.E.; Toepfner, N.; Chilvers, E.R.; Guck, J. Mechanotransduction in neutrophil activation and deactivation. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2015, 1853, 3105–3116. [Google Scholar] [CrossRef]
- Parker, H.; Winterbourn, C.C. Reactive oxidants and myeloperoxidase and their involvement in neutrophil extracellular traps. Front. Immunol. 2012, 3, 424. [Google Scholar] [CrossRef]
- Lefrancais, E.; Mallavia, B.; Zhuo, H.; Calfee, C.S.; Looney, M.R. Maladaptive role of neutrophil extracellular traps in pathogen-induced lung injury. JCI Insight 2018, 3, e98178. [Google Scholar] [CrossRef]
- Del Buono, A.; Zampogna, B.; Osti, L.; Fontanarosa, A.; Garofalo, R.; Papalia, R. Pulsed electromagnetic fields after intramedullary nailing of tibial fractures: A case control study. Int. Orthop. 2021, 45, 2945–2950. [Google Scholar] [CrossRef] [PubMed]
- Ehnert, S.; Falldorf, K.; Fentz, A.K.; Ziegler, P.; Schroter, S.; Freude, T.; Ochs, B.G.; Stacke, C.; Ronniger, M.; Sachtleben, J.; et al. Primary human osteoblasts with reduced alkaline phosphatase and matrix mineralization baseline capacity are responsive to extremely low frequency pulsed electromagnetic field exposure—Clinical implication possible. Bone Rep. 2015, 3, 48–56. [Google Scholar] [CrossRef] [PubMed]
- Funk, R.H. Coupling of pulsed electromagnetic fields (PEMF) therapy to molecular grounds of the cell. Am. J. Transl. Res. 2018, 10, 1260–1272. [Google Scholar] [PubMed]
- Poh, P.S.P.; Seeliger, C.; Unger, M.; Falldorf, K.; Balmayor, E.R.; van Griensven, M. Osteogenic Effect and Cell Signaling Activation of Extremely Low-Frequency Pulsed Electromagnetic Fields in Adipose-Derived Mesenchymal Stromal Cells. Stem Cells Int. 2018, 2018, 5402853. [Google Scholar] [CrossRef] [PubMed]
- Yumoto, H.; Hirao, K.; Tominaga, T.; Bando, N.; Takahashi, K.; Matsuo, T. Electromagnetic Wave Irradiation Promotes Osteoblastic Cell Proliferation and Up-Regulates Growth Factors via Activation of the ERK1/2 and p38 MAPK Pathways. Cell. Physiol. Biochem. 2015, 35, 601–615. [Google Scholar] [CrossRef]
- Goodman, R.; Lin-Ye, A.; Geddis, M.S.; Wickramaratne, P.J.; Hodge, S.E.; Pantazatos, S.P.; Blank, M.; Ambron, R.T. Extremely low frequency electromagnetic fields activate the ERK cascade, increase hsp70 protein levels and promote regeneration in Planaria. Int. J. Radiat. Biol. 2009, 85, 851–859. [Google Scholar] [CrossRef] [PubMed]
- Hakkim, A.; Fuchs, T.A.; Martinez, N.E.; Hess, S.; Prinz, H.; Zychlinsky, A.; Waldmann, H. Activation of the Raf-MEK-ERK pathway is required for neutrophil extracellular trap formation. Nat. Chem. Biol. 2011, 7, 75–77. [Google Scholar] [CrossRef]
- Son, Y.; Cheong, Y.K.; Kim, N.H.; Chung, H.T.; Kang, D.G.; Pae, H.O. Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? J. Signal Transduct. 2011, 2011, 792639. [Google Scholar] [CrossRef]
- Han, J.; Shuvaev, V.V.; Muzykantov, V.R. Targeted interception of signaling reactive oxygen species in the vascular endothelium. Ther. Deliv. 2012, 3, 263–276. [Google Scholar] [CrossRef]
- Patruno, A.; Amerio, P.; Pesce, M.; Vianale, G.; Di Luzio, S.; Tulli, A.; Franceschelli, S.; Grilli, A.; Muraro, R.; Reale, M. Extremely low frequency electromagnetic fields modulate expression of inducible nitric oxide synthase, endothelial nitric oxide synthase and cyclooxygenase-2 in the human keratinocyte cell line HaCat: Potential therapeutic effects in wound healing. Br. J. Dermatol. 2010, 162, 258–266. [Google Scholar] [CrossRef]
- Wang, J.; Cui, J.; Zhu, H. Suppression of type I collagen in human scleral fibroblasts treated with extremely low-frequency electromagnetic fields. Mol. Vis. 2013, 19, 885–893. [Google Scholar] [PubMed]
- Delle Monache, S.; Alessandro, R.; Iorio, R.; Gualtieri, G.; Colonna, R. Extremely low frequency electromagnetic fields (ELF-EMFs) induce in vitro angiogenesis process in human endothelial cells. Bioelectromagnetics 2008, 29, 640–648. [Google Scholar] [CrossRef] [PubMed]
- Cichoń, N.; Bijak, M.; Czarny, P.; Miller, E.; Synowiec, E.; Sliwinski, T.; Saluk-Bijak, J. Increase in Blood Levels of Growth Factors Involved in the Neuroplasticity Process by Using an Extremely Low Frequency Electromagnetic Field in Post-stroke Patients. Front. Aging Neurosci. 2018, 10, 294. [Google Scholar] [CrossRef] [PubMed]
- Fan, W.; Qian, F.; Ma, Q.; Zhang, P.; Chen, T.; Chen, C.; Zhang, Y.; Deng, P.; Zhou, Z.; Yu, Z. 50 Hz electromagnetic field exposure promotes proliferation and cytokine production of bone marrow mesenchymal stem cells. Int. J. Clin. Exp. Med. 2015, 8, 7394–7404. [Google Scholar] [PubMed]
- Ahmadian, S.; Zarchi, S.R.; Bolouri, B. Effects of extremely-low-frequency pulsed electromagnetic fields on collagen synthesis in rat skin. Biotechnol. Appl. Biochem. 2006, 43, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Godina-Nava, J.J.; Eduardo-Ambrosio, P.; Sanchez-Dominguez, D. Comparative analyzes of 120 Hz Electromagnetic Field, respect the interferon-β and Transfer Factor effect in the recovery of chronic ulcers measuring the frequency of the lymphocytes CD4+ and CD8+ in an animal model. J. Phys. Conf. Ser. 2019, 1221, 012056. [Google Scholar] [CrossRef]
- ISO 13485:2016; Medical Devices—Quality Management Systems—Requirements for Regulatory Purposes. International Organization for Standardization: Geneva, Switzerland, 2016.
- ISO 14971:2012; Medical Devices—Application of Risk Management to Medical Devices. International Organization for Standardization: Geneva, Switzerland, 2012.
- Linnemann, C.; Venturelli, S.; Konrad, F.; Nussler, A.K.; Ehnert, S. Bio-impedance measurement allows displaying the early stages of neutrophil extracellular traps. EXCLI J. 2020, 19, 1481–1495. [Google Scholar] [CrossRef]
Primer | GenBank Accession | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Amplicon Size (bp) | Ta (°C) | Cycles |
---|---|---|---|---|---|---|
Piezo1 | NM_001142864.4 | ACCAACCTCATCAGCGACTT | AACAGGTATCGGAAGACGGC | 212 | 56 | 40 |
ELANE | NM_001972.3 | GCGTGGCGAATGTAAACGTC | ACCCGTTGAGCTGGAGAATC | 165 | 58 | 40 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Linnemann, C.; Sahin, F.; Chen, Y.; Falldorf, K.; Ronniger, M.; Histing, T.; Nussler, A.K.; Ehnert, S. NET Formation Was Reduced via Exposure to Extremely Low-Frequency Pulsed Electromagnetic Fields. Int. J. Mol. Sci. 2023, 24, 14629. https://doi.org/10.3390/ijms241914629
Linnemann C, Sahin F, Chen Y, Falldorf K, Ronniger M, Histing T, Nussler AK, Ehnert S. NET Formation Was Reduced via Exposure to Extremely Low-Frequency Pulsed Electromagnetic Fields. International Journal of Molecular Sciences. 2023; 24(19):14629. https://doi.org/10.3390/ijms241914629
Chicago/Turabian StyleLinnemann, Caren, Filiz Sahin, Yangmengfan Chen, Karsten Falldorf, Michael Ronniger, Tina Histing, Andreas K. Nussler, and Sabrina Ehnert. 2023. "NET Formation Was Reduced via Exposure to Extremely Low-Frequency Pulsed Electromagnetic Fields" International Journal of Molecular Sciences 24, no. 19: 14629. https://doi.org/10.3390/ijms241914629
APA StyleLinnemann, C., Sahin, F., Chen, Y., Falldorf, K., Ronniger, M., Histing, T., Nussler, A. K., & Ehnert, S. (2023). NET Formation Was Reduced via Exposure to Extremely Low-Frequency Pulsed Electromagnetic Fields. International Journal of Molecular Sciences, 24(19), 14629. https://doi.org/10.3390/ijms241914629