Korean Red Ginseng Saponins Play an Anti-Inflammatory Role by Targeting Caspase-11 Non-Canonical Inflammasome in Macrophages
Abstract
:1. Introduction
2. Results
2.1. Suppressive Role of KRGSF on Caspase-11 Non-Canonical Inflammasome-Activated Pyroptosis in Macrophages
2.2. Suppressive Role of KRGSF on Caspase-11 Non-Canonical Inflammasome-Activated Production of Inflammatory Mediators in Macrophages
2.3. Mechanism of KRGSF-Suppressed Caspase-11 Non-Canonical Inflammasome Activation in Macrophages
2.4. In Vivo Suppressive Role of KRGSF on Lethal Septic Shock in Mice
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animal Husbandry
4.3. Cell Culture and Treatment
4.4. Cell Viability Assay
4.5. Pyroptosis Assay
4.6. ELISA
4.7. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
4.8. NO Production Assay
4.9. Immunoblot Analysis
4.10. Caspase-11 and LPS Binding Inhibition Assay
4.11. In Vivo Sepsis Model
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Janeway, C.A., Jr.; Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yi, Y.S. Functional crosstalk between non-canonical caspase-11 and canonical NLRP3 inflammasomes during infection-mediated inflammation. Immunology 2020, 159, 142–155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yi, Y.S.; Kim, H.G.; Kim, J.H.; Yang, W.S.; Kim, E.; Jeong, D.; Park, J.G.; Aziz, N.; Kim, S.; Parameswaran, N.; et al. Syk-MyD88 Axis Is a Critical Determinant of Inflammatory-Response in Activated Macrophages. Front. Immunol. 2021, 12, 767366. [Google Scholar] [CrossRef] [PubMed]
- Christgen, S.; Kanneganti, T.D. Inflammasomes and the fine line between defense and disease. Curr. Opin. Immunol. 2020, 62, 39–44. [Google Scholar] [CrossRef]
- Yi, Y.S. Caspase-11 non-canonical inflammasome: A critical sensor of intracellular lipopolysaccharide in macrophage-mediated inflammatory responses. Immunology 2017, 152, 207–217. [Google Scholar] [CrossRef] [Green Version]
- Yi, Y.S. Potential benefits of ginseng against COVID-19 by targeting inflammasomes. J Ginseng Res 2022, 46, 722–730. [Google Scholar] [CrossRef] [PubMed]
- Yi, Y.S. Dual roles of the caspase-11 non-canonical inflammasome in inflammatory bowel disease. Int. Immunopharmacol. 2022, 108, 108739. [Google Scholar] [CrossRef] [PubMed]
- Yi, Y.S. Regulatory Roles of Caspase-11 Non-Canonical Inflammasome in Inflammatory Liver Diseases. Int. J. Mol. Sci. 2022, 23, 4986. [Google Scholar] [CrossRef]
- Yi, Y.S. Caspase-11 Non-Canonical Inflammasome: Emerging Activator and Regulator of Infection-Mediated Inflammatory Responses. Int. J. Mol. Sci. 2020, 21, 2736. [Google Scholar] [CrossRef] [Green Version]
- Yi, Y.S. Regulatory Roles of the Caspase-11 Non-Canonical Inflammasome in Inflammatory Diseases. Immune Netw. 2018, 18, e41. [Google Scholar] [CrossRef]
- Ding, J.; Shao, F. SnapShot: The Noncanonical Inflammasome. Cell 2017, 168, 544–544.e1. [Google Scholar] [CrossRef] [PubMed]
- Xue, Y.; Enosi Tuipulotu, D.; Tan, W.H.; Kay, C.; Man, S.M. Emerging Activators and Regulators of Inflammasomes and Pyroptosis. Trends Immunol. 2019, 40, 1035–1052. [Google Scholar] [CrossRef] [PubMed]
- Ratan, Z.A.; Haidere, M.F.; Hong, Y.H.; Park, S.H.; Lee, J.O.; Lee, J.; Cho, J.Y. Pharmacological potential of ginseng and its major component ginsenosides. J. Ginseng Res. 2021, 45, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Yi, Y.S.; Kim, M.Y.; Cho, J.Y. Role of ginsenosides, the main active components of Panax ginseng, in inflammatory responses and diseases. J. Ginseng Res. 2017, 41, 435–443. [Google Scholar] [CrossRef] [Green Version]
- Yi, Y.S. New mechanisms of ginseng saponin-mediated anti-inflammatory action via targeting canonical inflammasome signaling pathways. J. Ethnopharmacol. 2021, 278, 114292. [Google Scholar] [CrossRef] [PubMed]
- Min, J.H.; Cho, H.J.; Yi, Y.S. A novel mechanism of Korean Red Ginseng-mediated anti-inflammatory action via targeting caspase-11 non-canonical inflammasome in macrophages. J. Ginseng Res. 2022, 46, 675–682. [Google Scholar] [CrossRef]
- He, H.; Sun, Y.P.; Zheng, L.; Yue, Z.G. Steroidal saponins from Paris polyphylla induce apoptotic cell death and autophagy in A549 human lung cancer cells. Asian Pac. J. Cancer Prev. 2015, 16, 1169–1173. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.O.; Yang, Y.; Tao, Y.; Yi, Y.S.; Cho, J.Y. Korean Red Ginseng saponin fraction exerts anti-inflammatory effects by targeting the NF-kappaB and AP-1 pathways. J. Ginseng Res. 2022, 46, 489–495. [Google Scholar] [CrossRef]
- Lee, B.L.; Stowe, I.B.; Gupta, A.; Kornfeld, O.S.; Roose-Girma, M.; Anderson, K.; Warming, S.; Zhang, J.; Lee, W.P.; Kayagaki, N. Caspase-11 auto-proteolysis is crucial for noncanonical inflammasome activation. J. Exp. Med. 2018, 215, 2279–2288. [Google Scholar] [CrossRef]
- Kayagaki, N.; Wong, M.T.; Stowe, I.B.; Ramani, S.R.; Gonzalez, L.C.; Akashi-Takamura, S.; Miyake, K.; Zhang, J.; Lee, W.P.; Muszynski, A.; et al. Noncanonical inflammasome activation by intracellular LPS independent of TLR4. Science 2013, 341, 1246–1249. [Google Scholar] [CrossRef]
- Hagar, J.A.; Powell, D.A.; Aachoui, Y.; Ernst, R.K.; Miao, E.A. Cytoplasmic LPS activates caspase-11: Implications in TLR4-independent endotoxic shock. Science 2013, 341, 1250–1253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Guevara, I.; Iwanejko, J.; Dembinska-Kiec, A.; Pankiewicz, J.; Wanat, A.; Anna, P.; Golabek, I.; Bartus, S.; Malczewska-Malec, M.; Szczudlik, A. Determination of nitrite/nitrate in human biological material by the simple Griess reaction. Clin. Chim. Acta 1998, 274, 177–188. [Google Scholar] [CrossRef] [PubMed]
Saponins (Ginsenosides) | Amounts (mg/g) | Amounts (%) |
---|---|---|
Ginsenoside Rb1 | 108.15 | 28.26 |
Ginsenoside Rc | 44.84 | 11.72 |
Ginsenoside Rb2 | 40.60 | 10.61 |
Ginsenoside Rg3s | 34.14 | 8.92 |
Ginsenoside Re | 29.60 | 7.74 |
Ginsenoside Rg1 | 24.72 | 6.46 |
Ginsenoside Rg2s | 23.07 | 6.03 |
Ginsenoside Rh1 | 21.42 | 5.60 |
Ginsenoside Rf | 21.42 | 5.60 |
Ginsenoside Rd | 20.08 | 5.25 |
Ginsenoside Rg3r | 14.61 | 3.82 |
Total | 382.65 | 100 |
Target | Sequence (5′ to 3′) | |
---|---|---|
IL-1β | For | GTGAAATGCCACCTTTTGACAGTG |
Rev | CCTGCCTGAAGCTCTTGTTG | |
IL-18 | For | CAGCCTGTGTTCGAGGATATG |
Rev | TCACAGCCAGTCCTCTTACT | |
iNOS | For | GCCACCAACAATGGCAACAT |
Rev | TCGATGCACAACTGGGTGAA | |
GAPDH | For | CAATGAATACGGCTACAGCAAC |
Rev | AGGGAGATGCTCAGTGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cho, H.-J.; Kim, E.; Yi, Y.-S. Korean Red Ginseng Saponins Play an Anti-Inflammatory Role by Targeting Caspase-11 Non-Canonical Inflammasome in Macrophages. Int. J. Mol. Sci. 2023, 24, 1077. https://doi.org/10.3390/ijms24021077
Cho H-J, Kim E, Yi Y-S. Korean Red Ginseng Saponins Play an Anti-Inflammatory Role by Targeting Caspase-11 Non-Canonical Inflammasome in Macrophages. International Journal of Molecular Sciences. 2023; 24(2):1077. https://doi.org/10.3390/ijms24021077
Chicago/Turabian StyleCho, Hui-Jin, Eojin Kim, and Young-Su Yi. 2023. "Korean Red Ginseng Saponins Play an Anti-Inflammatory Role by Targeting Caspase-11 Non-Canonical Inflammasome in Macrophages" International Journal of Molecular Sciences 24, no. 2: 1077. https://doi.org/10.3390/ijms24021077
APA StyleCho, H.-J., Kim, E., & Yi, Y.-S. (2023). Korean Red Ginseng Saponins Play an Anti-Inflammatory Role by Targeting Caspase-11 Non-Canonical Inflammasome in Macrophages. International Journal of Molecular Sciences, 24(2), 1077. https://doi.org/10.3390/ijms24021077