M3 Receptor Pathway Stimulates Rapid Transcription of the CB1 Receptor Activation through Calcium Signalling and the CNR1 Gene Promoter
Abstract
1. Introduction
2. Results
2.1. M3 Receptor Activation Primes CB1 Receptors in Human SH-SY5Y Neuroblastoma Cells
2.2. Enhanced CB1 Mediated Response in the Presence of ACh Is Due to the Release of Intracellular Ca2+
2.3. ACh-Primed Enhancement of the CB1-Mediated Response Is Modulated at the Transcriptional and Translational Level
2.4. CB1 Receptor Expression Modulated by M3 Receptor Stimulation Is Controlled by the CNR1 Promoter Locus
2.5. Genomic Annotation of the CNR1 Promoter Indicates That It Is Active in Neuroblastoma Cells, Binds Core Transcriptional Proteins and Contains Putative cAMP Response Element-Binding Protein (CREB) Binding Sites
2.6. The Promoter Region of CNR1 Is Sensitive to M3 Receptor Stimulation
2.7. CREB Activation in SH-SY5Y Cells following Pre-Stimulation of M3 Receptors
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.2. Electrophysiology
4.3. Western Immunoblotting
4.4. Quantitative Reverse-Transcription PCR
- CNR1 forward: 5′ CCTACCTGATGTTCTGGAT 3′
- CNR1 reverse: 5′ TGGATGATGATGCTCTTCT 3′
- TBP forward: 5′ TTAGTCCAATGATGCCTTATG 3′
- TBP reverse: 5′ CTGCCTTTGTTGCTCTTC 3′
4.5. Bioinformatics
4.6. Cloning
4.7. Luciferase Reporter Assays
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Berridge, M.J.; Lipp, P.; Bootman, M.D. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 2000, 1, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Mizuno, K.; Kurokawa, K.; Ohkuma, S. Regulatory Mechanisms and Pathophysiological Significance of IP3 Receptors and Ryanodine Receptors in Drug Dependence. J. Pharmacol. Sci. 2013, 123, 306–311. [Google Scholar] [CrossRef] [PubMed]
- Nakano, T.; Doi, T.; Yoshimoto, J.; Doya, K. A Kinetic Model of Dopamine- and Calcium-Dependent Striatal Synaptic Plasticity. PLoS Comput. Biol. 2010, 6, e1000670. [Google Scholar] [CrossRef] [PubMed]
- Bird, M.; Lawrence, A. Group I Metabotropic Glutamate Receptors: Involvement in Drug-Seeking and Drug-Induced Plasticity. CMP 2009, 2, 83–94. [Google Scholar] [CrossRef] [PubMed]
- Siciliano, C.A.; Tye, K.M. Leveraging calcium imaging to illuminate circuit dysfunction in addiction. Alcohol 2019, 74, 47–63. [Google Scholar] [CrossRef]
- Connor, M.; Henderson, G. δ- and μ-opioid receptor mobilization of intracellular calcium in SH-SY5Y human neuroblastoma cells. Br. J. Pharmacol. 1996, 117, 333–340. [Google Scholar] [CrossRef]
- Connor, M.A.; Keir, M.J.; Henderson, G. δ-opioid Receptor Mobilization of Intracellular Calcium in SH-SY5Y Cells: Lack of Evidence for δ-receptor Subtypes. Neuropharmacology 1997, 36, 125–133. [Google Scholar] [CrossRef]
- Samways, D.S.K.; Li, W.; Conway, S.J.; Holmes, A.B.; Bootman, M.D.; Henderson, G. Co-incident signalling between μ-opioid and M3 muscarinic receptors at the level of Ca2+ release from intracellular stores: Lack of evidence for Ins(1,4,5)P3 receptor sensitization. Biochem. J. 2003, 375, 713–720. [Google Scholar] [CrossRef]
- Lauckner, J.E.; Hille, B.; Mackie, K. The cannabinoid agonist WIN55,212-2 increases intracellular calcium via CB1 receptor coupling to Gq/11 G proteins. Proc. Natl. Acad. Sci. USA 2005, 102, 19144–19149. [Google Scholar] [CrossRef]
- Marini, P.; Moriello, A.S.; Cristino, L.; Palmery, M.; De Petrocellis, L.; Di Marzo, V. Cannabinoid CB1 receptor elevation of intracellular calcium in neuroblastoma SH-SY5Y cells: Interactions with muscarinic and δ-opioid receptors. Biochim. Biophys. Acta BBA-Mol. Cell Res. 2009, 1793, 1289–1303. [Google Scholar] [CrossRef]
- Jensen, K.P.; DeVito, E.E.; Yip, S.; Carroll, K.M.; Sofuoglu, M. The Cholinergic System as a Treatment Target for Opioid Use Disorder. CNS Drugs 2018, 32, 981–996. [Google Scholar] [CrossRef] [PubMed]
- Fiserová, M.; Consolo, S.; Krsiak, M. Chronic morphine induces long-lasting changes in acetylcholine release in rat nucleus accumbens core and shell: An in vivo microdialysis study. Psychopharmacology 1999, 142, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Grasing, K. A threshold model for opposing actions of acetylcholine on reward behavior: Molecular mechanisms and implications for treatment of substance abuse disorders. Behav. Brain Res. 2016, 312, 148–162. [Google Scholar] [CrossRef]
- Ramanathan, D.; Tuszynski, M.H.; Conner, J.M. The Basal Forebrain Cholinergic System Is Required Specifically for Behaviorally Mediated Cortical Map Plasticity. J. Neurosci. 2009, 29, 5992–6000. [Google Scholar] [CrossRef] [PubMed]
- Yamakawa, G.R.; Basu, P.; Cortese, F.; MacDonnell, J.; Whalley, D.; Smith, V.M.; Antle, M.C. The cholinergic forebrain arousal system acts directly on the circadian pacemaker. Proc. Natl. Acad. Sci. USA 2016, 113, 13498–13503. [Google Scholar] [CrossRef]
- Teles-Grilo Ruivo, L.M.; Baker, K.L.; Conway, M.W.; Kinsley, P.J.; Gilmour, G.; Phillips, K.G.; Isaac, J.T.R.; Lowry, J.P.; Mellor, J.R. Coordinated Acetylcholine Release in Prefrontal Cortex and Hippocampus Is Associated with Arousal and Reward on Distinct Timescales. Cell Rep. 2017, 18, 905–917. [Google Scholar] [CrossRef]
- Thompson, K.J.; Tobin, A.B. Crosstalk between the M1 muscarinic acetylcholine receptor and the endocannabinoid system: A relevance for Alzheimer’s disease? Cell. Signal. 2020, 70, 109545. [Google Scholar] [CrossRef]
- Cruzalegui, F.H.; Bading, H. Calcium-regulated protein kinase cascades and their transcription factor targets: CMLS. Cell. Mol. Life Sci. 2000, 57, 402–410. [Google Scholar] [CrossRef]
- West, A.E.; Chen, W.G.; Dalva, M.B.; Dolmetsch, R.E.; Kornhauser, J.M.; Shaywitz, A.J.; Takasu, M.A.; Tao, X.; Greenberg, M.E. Calcium regulation of neuronal gene expression. Proc. Natl. Acad. Sci. USA 2001, 98, 11024–11031. [Google Scholar] [CrossRef]
- Naranjo, J.R.; Mellström, B. Ca2+-dependent Transcriptional Control of Ca2+ Homeostasis. J. Biol. Chem. 2012, 287, 31674–31680. [Google Scholar] [CrossRef]
- Frazier, H.N.; Maimaiti, S.; Anderson, K.L.; Brewer, L.D.; Gant, J.C.; Porter, N.M.; Thibault, O. Calcium’s role as nuanced modulator of cellular physiology in the brain. Biochem. Biophys. Res. Commun. 2017, 483, 981–987. [Google Scholar] [CrossRef] [PubMed]
- Ibsen, M.S.; Connor, M.; Glass, M. Cannabinoid CB 1 and CB 2 Receptor Signaling and Bias. Cannabis Cannabinoid Res. 2017, 2, 48–60. [Google Scholar] [CrossRef] [PubMed]
- Heikkilä, J.; Jansson, C.; Åkerman, K.E.O. Differential coupling of muscarinic receptors to Ca2+ mobilization and cyclic AMP in SH-SY5Y and IMR 32 neuroblastoma cells. Eur. J. Pharmacol. Mol. Pharmacol. 1991, 208, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.-W.; Ishiguro, H.; Ohtsuki, T.; Hess, J.; Carillo, F.; Walther, D.; Onaivi, E.S.; Arinami, T.; Uhl, G.R. Human cannabinoid receptor 1: 5′ exons, candidate regulatory regions, polymorphisms, haplotypes and association with polysubstance abuse. Mol. Psychiatry 2004, 9, 916–931. [Google Scholar] [CrossRef] [PubMed]
- Rosethorne, E.M.; Nahorski, S.R.; Challiss, R.A.J. Regulation of cyclic AMP response-element binding-protein (CREB) by Gq/11-protein-coupled receptors in human SH-SY5Y neuroblastoma cells. Biochem. Pharmacol. 2008, 75, 942–955. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, H.; Suzuki, T.; Kamata, R.; Saito, S.; Sato, I.; Tsuda, S.; Matsusaka, N. Recent progress in the neurotoxicology of natural drugs associated with dependence or addiction, their endogenous agonists and receptors. J. Toxicol. Sci. 1999, 24, 1–16. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yeo, A.; Samways, D.S.K.; Fowler, C.E.; Gunn-Moore, F.; Henderson, G. Coincident signalling between the Gi/Go-coupled δ-opioid receptor and the Gq-coupled m3 muscarinic receptor at the level of intracellular free calcium in SH-SY5Y cells: Co-incident signalling between δ-opioid and m3 muscarinic receptors. J. Neurochem. 2001, 76, 1688–1700. [Google Scholar] [CrossRef]
- Hurley, M.J.; Mash, D.C.; Jenner, P. Expression of cannabinoid CB 1 receptor mRNA in basal ganglia of normal and parkinsonian human brain. J. Neural Transm. 2003, 110, 1279–1288. [Google Scholar] [CrossRef]
- McDonald, A.J. Expression of the type 1 cannabinoid receptor (CB1R) in CCK-immunoreactive axon terminals in the basolateral amygdala of the rhesus monkey (Macaca mulatta). Neurosci. Lett. 2021, 745, 135503. [Google Scholar] [CrossRef]
- Cheng, Z.; Phokaew, C.; Chou, Y.-L.; Lai, D.; Meyers, J.L.; Agrawal, A.; Farrer, L.A.; Kranzler, H.R.; Gelernter, J. A regulatory variant of CHRM3 is associated with cannabis-induced hallucinations in European Americans. Transl. Psychiatry 2019, 9, 309. [Google Scholar] [CrossRef]
- Li, X.; Zheng, Y.; Zhao, X.; Cui, R.; Li, X. Relationship between the role of muscarinic M3 receptors in morphine-induced conditioned place preference and the mesolimbic dopamine system. Neurosci. Lett. 2022, 786, 136774. [Google Scholar] [CrossRef] [PubMed]
- Avena, N.M.; Rada, P.V. Cholinergic modulation of food and drug satiety and withdrawal. Physiol. Behav. 2012, 106, 332–336. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.-J.; Chen, W.-W.; Zhang, X. Endocannabinoid system: Role in depression, reward and pain control (Review). Mol. Med. Rep. 2016, 14, 2899–2903. [Google Scholar] [CrossRef] [PubMed]
- Eglen, R.M. Muscarinic receptor subtypes in neuronal and non-neuronal cholinergic function. Auton. Autacoid Pharmacol. 2006, 26, 219–233. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Trebak, M.; Gill, D.L. Calcium signals tune the fidelity of transcriptional responses. Mol. Cell 2015, 58, 197–199. [Google Scholar] [CrossRef][Green Version]
- Tuusa, J.T.; Markkanen, P.M.H.; Apaja, P.M.; Hakalahti, A.E.; Petäjä-Repo, U.E. The Endoplasmic Reticulum Ca2+-pump SERCA2b Interacts with G Protein-coupled Receptors and Enhances their Expression at the Cell Surface. J. Mol. Biol. 2007, 371, 622–638. [Google Scholar] [CrossRef] [PubMed]
- Billups, D.; Billups, B.; Challiss, R.A.J.; Nahorski, S.R. Modulation of Gq-Protein-Coupled Inositol Trisphosphate and Ca2+ Signaling by the Membrane Potential. J. Neurosci. 2006, 26, 9983–9995. [Google Scholar] [CrossRef]
- Samanta, K.; Kar, P.; Mirams, G.R.; Parekh, A.B. Ca2+ Channel Re-localization to Plasma-Membrane Microdomains Strengthens Activation of Ca2+-Dependent Nuclear Gene Expression. Cell Rep. 2015, 12, 203–216. [Google Scholar] [CrossRef]
- Niemeyer, B.A. Changing calcium: CRAC channel (STIM and Orai) expression, splicing, and posttranslational modifiers. Am. J. Physiol.-Cell Physiol. 2016, 310, C701–C709. [Google Scholar] [CrossRef]
- Ruthenburg, A.J.; Allis, C.D.; Wysocka, J. Methylation of Lysine 4 on Histone H3: Intricacy of Writing and Reading a Single Epigenetic Mark. Mol. Cell 2007, 25, 15–30. [Google Scholar] [CrossRef]
- Zhang, T.; Cooper, S.; Brockdorff, N. The interplay of histone modifications—Writers that read. EMBO Rep. 2015, 16, 1467–1481. [Google Scholar] [CrossRef] [PubMed]
- Stein, A.B.; Jones, T.A.; Herron, T.J.; Patel, S.R.; Day, S.M.; Noujaim, S.F.; Milstein, M.L.; Klos, M.; Furspan, P.B.; Jalife, J.; et al. Loss of H3K4 methylation destabilizes gene expression patterns and physiological functions in adult murine cardiomyocytes. J. Clin. Investig. 2011, 121, 2641–2650. [Google Scholar] [CrossRef] [PubMed]
- Minarovits, J.; Banati, F.; Szenthe, K.; Niller, H.H. Epigenetic Regulation. In Patho-Epigenetics of Infectious Disease; Minarovits, J., Niller, H.H., Eds.; Advances in Experimental Medicine and Biology; Springer International Publishing: Cham, Germany, 2016; Volume 879, pp. 1–25. ISBN 978-3-319-24736-6. [Google Scholar]
- Chiang, Y.-C.; Lo, Y.-N.; Chen, J.-C. Crosstalk between Dopamine D 2 receptors and cannabinoid CB 1 receptors regulates CNR 1 promoter activity via ERK1/2 signaling. J. Neurochem. 2013, 127, 163–176. [Google Scholar] [CrossRef] [PubMed]
- Chang, W.; Nelson, C.; Parekh, A.B.; Chang, W.; Nelson, C.; Parekh, A.B. Ca2+ influx through CRAC channels activates cytosolic phospholipase A2, leukotriene C4 secretion, and expression of c-fos through ERK-dependent and independent pathways in mast cells. FASEB J. 2006, 20, 2381–2383. [Google Scholar] [CrossRef]
- Avlani, V.A.; Ma, W.; Mun, H.-C.; Leach, K.; Delbridge, L.; Christopoulos, A.; Conigrave, A.D. Calcium-sensing receptor-dependent activation of CREB phosphorylation in HEK293 cells and human parathyroid cells. Am. J. Physiol.-Endocrinol. Metab. 2013, 304, E1097–E1104. [Google Scholar] [CrossRef]
- Prell, T.; Lautenschläger, J.; Weidemann, L.; Ruhmer, J.; Witte, O.W.; Grosskreutz, J. Endoplasmic reticulum stress is accompanied by activation of NF-κB in amyotrophic lateral sclerosis. J. Neuroimmunol. 2014, 270, 29–36. [Google Scholar] [CrossRef]
- Ruiz-DeDiego, I.; Mellstrom, B.; Vallejo, M.; Naranjo, J.R.; Moratalla, R. Activation of DREAM (Downstream Regulatory Element Antagonistic Modulator), a Calcium-Binding Protein, Reduces L-DOPA-Induced Dyskinesias in Mice. Biol. Psychiatry 2015, 77, 95–105. [Google Scholar] [CrossRef]
- Hogan, P.G. Calcium–NFAT transcriptional signalling in T cell activation and T cell exhaustion. Cell Calcium 2017, 63, 66–69. [Google Scholar] [CrossRef]
- Bell, K.F.S.; Bent, R.J.; Meese-Tamuri, S.; Ali, A.; Forder, J.P.; Aarts, M.M. Calmodulin Kinase IV-dependent CREB activation is required for neuroprotection via NMDA receptor-PSD95 disruption. J. Neurochem. 2013, 126, 274–287. [Google Scholar] [CrossRef]
- Hirst, R.A.; Lambert, D.G. Adenylyl cyclase in SH-SY5Y human neuroblastoma cells is regulated by intra- and extracellular calcium. Biochem. Pharmacol. 1995, 49, 1633–1640. [Google Scholar] [CrossRef]
- Willoughby, D.; Cooper, D.M.F. Ca2+ stimulation of adenylyl cyclase generates dynamic oscillations in cyclic AMP. J. Cell Sci. 2006, 119, 828–836. [Google Scholar] [CrossRef] [PubMed]
- Shaywitz, A.J.; Greenberg, M.E. CREB: A Stimulus-Induced Transcription Factor Activated by A Diverse Array of Extracellular Signals. Annu. Rev. Biochem. 1999, 68, 821–861. [Google Scholar] [CrossRef] [PubMed]
- Chawla, S.; Bading, H. CREB/CBP and SRE-interacting transcriptional regulators are fast on-off switches: Duration of calcium transients specifies the magnitude of transcriptional responses: Decoding calcium signals by transcriptional regulators. J. Neurochem. 2008, 79, 849–858. [Google Scholar] [CrossRef] [PubMed]
- Nestler, E.J. Cellular basis of memory for addiction. Dialogues Clin. Neurosci. 2013, 15, 431–443. [Google Scholar] [CrossRef] [PubMed]
- D’Souza, D.C.; Cortes-Briones, J.A.; Ranganathan, M.; Thurnauer, H.; Creatura, G.; Surti, T.; Planeta, B.; Neumeister, A.; Pittman, B.; Normandin, M.D.; et al. Rapid Changes in Cannabinoid 1 Receptor Availability in Cannabis-Dependent Male Subjects After Abstinence From Cannabis. Biol. Psychiatry Cogn. Neurosci. Neuroimaging 2016, 1, 60–67. [Google Scholar] [CrossRef]
- Kellogg, R.; Mackie, K.; Straiker, A. Cannabinoid CB1 Receptor-Dependent Long-Term Depression in Autaptic Excitatory Neurons. J. Neurophysiol. 2009, 102, 1160–1171. [Google Scholar] [CrossRef]
- Chaves-Kirsten, G.P.; Mazucanti, C.H.Y.; Real, C.C.; Souza, B.M.; Britto, L.R.G.; Torrão, A.S. Temporal Changes of CB1 Cannabinoid Receptor in the Basal Ganglia as a Possible Structure-Specific Plasticity Process in 6-OHDA Lesioned Rats. PLoS ONE 2013, 8, e76874. [Google Scholar] [CrossRef]
- Aymoz, D.; Solé, C.; Pierre, J.; Schmitt, M.; de Nadal, E.; Posas, F.; Pelet, S. Timing of gene expression in a cell-fate decision system. Mol. Syst. Biol. 2018, 14, e8024. [Google Scholar] [CrossRef]
- Meenakshi, P.; Kumar, S.; Balaji, J. In vivo imaging of immediate early gene expression dynamics segregates neuronal ensemble of memories of dual events. Mol. Brain 2021, 14, 102. [Google Scholar] [CrossRef]
- Bahrami, S.; Drabløs, F. Gene regulation in the immediate-early response process. Adv. Biol. Regul. 2016, 62, 37–49. [Google Scholar] [CrossRef]
- Tan, J.; Yan, Y.; Wang, X.; Jiang, Y.; Xu, H.E. EZH2: Biology, disease, and structure-based drug discovery. Acta Pharmacol. Sin. 2014, 35, 161–174. [Google Scholar] [CrossRef] [PubMed]
- Blackledge, N.P.; Rose, N.R.; Klose, R.J. Targeting Polycomb systems to regulate gene expression: Modifications to a complex story. Nat. Rev. Mol. Cell Biol. 2015, 16, 643–649. [Google Scholar] [CrossRef] [PubMed]
- Hing, B.; Davidson, S.; Lear, M.; Breen, G.; Quinn, J.; McGuffin, P.; MacKenzie, A. A Polymorphism Associated with Depressive Disorders Differentially Regulates Brain Derived Neurotrophic Factor Promoter IV Activity. Biol. Psychiatry 2012, 71, 618–626. [Google Scholar] [CrossRef] [PubMed]
- Hamill, O.P.; Marty, A.; Neher, E.; Sakmann, B.; Sigworth, F.J. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflüg. Arch.-Eur. J. Physiol. 1981, 391, 85–100. [Google Scholar] [CrossRef] [PubMed]
- Hoshiyama, D.; Kuma, K.; Miyata, T. Extremely reduced evolutionary rate of TATA-box binding protein in higher vertebrates and its evolutionary implications. Gene 2001, 280, 169–173. [Google Scholar] [CrossRef] [PubMed]
- Ovcharenko, I.; Nobrega, M.A.; Loots, G.G.; Stubbs, L. ECR Browser: A tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res. 2004, 32, W280–W286. [Google Scholar] [CrossRef]
- Kent, W.J.; Sugnet, C.W.; Furey, T.S.; Roskin, K.M.; Pringle, T.H.; Zahler, A.M.; Haussler, D. The Human Genome Browser at UCSC. Genome Res. 2002, 12, 996–1006. [Google Scholar] [CrossRef]
- Rosenbloom, K.R.; Sloan, C.A.; Malladi, V.S.; Dreszer, T.R.; Learned, K.; Kirkup, V.M.; Wong, M.C.; Maddren, M.; Fang, R.; Heitner, S.G.; et al. ENCODE Data in the UCSC Genome Browser: Year 5 update. Nucleic Acids Res. 2012, 41, D56–D63. [Google Scholar] [CrossRef]
- Curtis, M.J.; Alexander, S.; Cirino, G.; Docherty, J.R.; George, C.H.; Giembycz, M.A.; Hoyer, D.; Insel, P.A.; Izzo, A.A.; Ji, Y.; et al. Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers: Editorial. Br. J. Pharmacol. 2018, 175, 987–993. [Google Scholar] [CrossRef]








Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marini, P.; Cowie, P.; Ayar, A.; Bewick, G.S.; Barrow, J.; Pertwee, R.G.; MacKenzie, A.; Tucci, P. M3 Receptor Pathway Stimulates Rapid Transcription of the CB1 Receptor Activation through Calcium Signalling and the CNR1 Gene Promoter. Int. J. Mol. Sci. 2023, 24, 1308. https://doi.org/10.3390/ijms24021308
Marini P, Cowie P, Ayar A, Bewick GS, Barrow J, Pertwee RG, MacKenzie A, Tucci P. M3 Receptor Pathway Stimulates Rapid Transcription of the CB1 Receptor Activation through Calcium Signalling and the CNR1 Gene Promoter. International Journal of Molecular Sciences. 2023; 24(2):1308. https://doi.org/10.3390/ijms24021308
Chicago/Turabian StyleMarini, Pietro, Philip Cowie, Ahmet Ayar, Guy S. Bewick, John Barrow, Roger G. Pertwee, Alasdair MacKenzie, and Paolo Tucci. 2023. "M3 Receptor Pathway Stimulates Rapid Transcription of the CB1 Receptor Activation through Calcium Signalling and the CNR1 Gene Promoter" International Journal of Molecular Sciences 24, no. 2: 1308. https://doi.org/10.3390/ijms24021308
APA StyleMarini, P., Cowie, P., Ayar, A., Bewick, G. S., Barrow, J., Pertwee, R. G., MacKenzie, A., & Tucci, P. (2023). M3 Receptor Pathway Stimulates Rapid Transcription of the CB1 Receptor Activation through Calcium Signalling and the CNR1 Gene Promoter. International Journal of Molecular Sciences, 24(2), 1308. https://doi.org/10.3390/ijms24021308

