1. Introduction
Proteins and lipids synthesized in the endoplasmic reticulum (ER) need to be transported to their sites of function. The Golgi complex (GC) has an extremely complicated structure, membrane continuity being one of the most important aspects of Golgi morphology [
1,
2].
Recently, we analyzed in detail the history of the development of hypotheses describing the mechanisms of transport through the GC [
3], for which there is currently no consensus. Four main models of intra-Golgi transport (IGT) compete: (1) the vesicular model; (2) the compartment (cisterna) maturation–progression model; (3) the diffusion model (DM); and (4) the kiss-and-run model (KARM), which exists as symmetric and asymmetric variants [
1,
3]. Recently, we started a direct comparison of the models of IGT under defined experimental conditions and already compared the KARM and the cisterna maturation–progression models [
2].
The DM was proposed in 1962 [
4]. In 1989, Pagano et al. [
5] showed that all membranes in a cell are connected and that, at any given moment, there will always be at least one continuous membrane bridge between the ER (and the nuclear envelope) and the plasma membrane (PM) passing through the GC. In 2004, we showed that, when synchronous cargo transport is restored through the GC, tubular connections are formed between Golgi cisternae [
6]. The connections were found in endocytosis stimulation and signaling [
7].
In 2008, Patterson et al. [
8] reported that, when the GC is filled with a cargo visible under a fluorescent microscope or the same but an invisible cargo, the exit of this cargo from the Golgi zone (GZ) is described as a mono-exponential curve (exponential decay). However, a statistical analysis of the correspondence of the obtained regression lines to the theoretical regression curves was not complete and should be improved. Furthermore, the situation when transport through GC was resumed after GC was completely without cargo was not checked. In 2014, we showed that cargo proteins are observed in the connections between Golgi cisternae, while the procollagen was absent there [
9]. At the same time, the speed of albumin movement from the cis-side of the stack to the trans-side was significantly higher than that of the temperature-sensitive (ts045) G-glycoprotein of vesicular stomatitis virus (tsVSVG) and procollagen (PC). At the same time, albumin was significantly enriched (an increase in its concentration per unit volume of cisternal contents). At that time, we believed that different cargo could use different models of transport. However, when inhibiting the function of coatomer I (COPI), the diffusion of tsVSVG was almost comparable to that of albumin. Moreover, not only glycosylation enzymes located in Golgi cisternae [
10,
11], but also proteins transferring monosaccharides into the lumen of Golgi cisternae had a lower concentration in vesicles situated around the GC than inside the cisternae per se [
11]. In addition, the synchronous movement of a large amount of cargo through the GC itself changes the structure of this GC [
2].
These observations suggested that there are at least a few membrane continuities between the ER, GC and the PM. These also suggest that direct membrane continuity plays a significant role in the post-Golgi transport. The DM claims that the GC represents a single membrane compartment (at least during the synchronous movement of a cargo) and cargo moves along it by simple diffusion. In order to be relevant, the DM should be based on the structures that are interconnected. The observations that do not support the DM are the following: (1) the concentrating of diffusible cargoes; (2) at each transport step, the SNARE proteins are important; (3) the rarity of connections; (4) the presence of stacks without connections during transport [
6]; and (5) the deviation from a negative exponential regression line during the evacuation of cargo from the Golgi zone. Thus, the DM has significant difficulties in explaining the increasing concentrations of cargo proteins (including mega-cargoes) during EGT and IGT (see below). Furthermore, the DM cannot explain the necessity for SNAREs.
There are several observations favoring the DM, namely, in transporting Golgi stacks and after the endocytosis stimulation [
7], intercisternal connections are formed [
6]. When ldl F cells were heated for 2 min at 40 °C and then placed at 32 °C for 5 min, Golgi stacks are preserved and the number of intercisternal connections increased [
11]. Tubular connections between Golgi cisternae have been observed even after quick freezing [
6,
7,
12,
13]. Griffiths et al. [
14] described the bending of Golgi cisternae. Intercisternal connections are formed when a cargo arrives at the Golgi because Ca
2+ is liberated from the Golgi compartments and the ER [
15,
16], leading to the fusion of COPI vesicles enriched in Qb SNAREs with Golgi cisternae and the restoration of the Golgi SNARE complex. These connections between Golgi cisternae are more abundant in transporting Golgi stacks and after the stimulation of cell signaling [
6,
7,
12,
17]. These intercisternal connections are permeable to small soluble cargoes, such as albumin [
9], lipids [
6,
18], and tsVSVG tagged with GFP (VFP) [
9]. However, they are impermeable for aggregates of procollagen I [
11]). Moreover, dicumarol destabilizes Golgi tubules and delays IGT [
19]), whereas, after the activation of protein kinase A, when the cisternae of the Golgi complex become interconnected, IGT is accelerated [
20]. This suggests an important role of these connections. Some lipids can be easily transported along the secretory pathway when the formation of vesicles is inhibited [
5,
10,
18]. When a large amount of VSVG was accumulated before the Golgi and then the transport block was released, VSVG quickly fills all medial Golgi cisternae [
8,
21,
22]. During IGT, the lengths of the Golgi cisternae remain equal, independent of the position of a cargo within the Golgi [
6,
22]. Moreover, the unification of the lengths of the Golgi cisternae after the arrival of large amounts of membrane cargoes was interpreted as evidence that lipids can freely diffuse along the entire Golgi stack [
6].
Patterson et al. [
8] reported that a cargo that exits the Golgi area exhibits exponential kinetics. The curve-fitting of the exit of cargoes from the Golgi zone indicates negative exponentials, which suggests that each cargo molecule has an almost equal chance to exit the Golgi zone. Such types of kinetics indicate that all compartments within the GC are interconnected. However, Patterson et al. [
8] did not perform careful statistical analysis to demonstrate that these curves were really negatively exponential (or correspond to the exponential decay). Furthermore, they also did not perform experiments using an empty GC. In living cells, spots filled with fluorescent cargoes can move through the pre-bleached Golgi ribbon, gradually losing their intensity [
23].
Herein, we assessed the power of DM to explain the experimental data. The main question we asked in the present study was whether the DM could be the main mechanism of transport through the GC (herein, we do not examine the maturation mechanism), at least during the synchronous movement of a cargo. We applied different types of chimeric cargoes with fluorescent tags, namely, PC tagged with GFP (PFP), which can form intra-cisternal aggregates; VFP as a membrane protein that can diffuse along membranes; and albumin tagged with GFP from its N-terminus (AFP) as soluble proteins that do not form aggregates and can diffuse freely within the lumen of the Golgi cisternae and ribbon. We have checked the data obtained by Patterson et al. [
8], conducting a statistical assessment of experiments similar to those and checked the situation that was not investigated by the authors, namely, the movement of a cargo through the previously emptied GC. In particular using different synchronization protocols (
Table 1), we tested whether the predictions that arise from the DM correspond to the experimental data and examine whether the DM could explain the specifically designed experimental observations. We proved that, when the GC is empty, the cargo exit from GZ fits to the piecewise nonlinear curve.
3. Discussion
Herein, we examined the ability of the DM to explain experimental results related to IGT. For this purpose, we used different methods to synchronize cargo transport through the Golgi complex and three different types of cargoes tagged with GFP, namely, a membrane protein (VSVG), a soluble protein (albumin), and a soluble protein that forms aggregates (procollagen). We did not use the RUSH system because, after the addition of biotin, its binding to cargo is irreversible [
22]. This issue is examined in a separate paper. Furthermore, we demonstrated once more (see [
26]; reviewed in [
1,
2,
3,
26,
27,
28,
29,
30,
31,
32,
33,
34,
35,
36,
37]) that these cargoes were depleted in round profiles (presumably COPI vesicles) and that COPI-coated buds contained lower concentration of anterograde cargoes than Golgi cisternae. Together with the discrepancy between the size of the vesicles and mega-cargoes, this argues against the DM.
Initially, we selected three routinely used cargoes visible in living cells and checked data obtained by Patterson et al. [
8]. Initially, we proved once more than these cargoes were excluded (at least partially) from Golgi vesicles. Additionally, we demonstrated that these cargoes had different diffusion mobility. Next, we analyzed the situation mentally and found several theoretical curved suitable for our analysis.
To explain why the exit of the almost non-diffusible PFP from GZ occurred according to exponential decay, whereas its exit from the GC was linear, we proposed a hypothesis able to explain why Patterson et al. [
8] demonstrated that the exponential decay (decline) is suitable for the analysis of the cargo exit from GZ when the GC is filled with a cargo. Next, we designed a mode suitable for the statistical analysis of the regression lines obtained for different cargoes and under different situations.
Since the computer simulation showed the possibility of using a negative exponential curve to describe the exit of various types of cargoes from GZ, we chose five theoretically possible curves for our analysis to compare them with the obtained regression lines. This set included a linear decrease in values, an exponential decrease in values, a curve consisting of an initial horizontal section that would be replaced by a negative exponential decrease, and a curve consisting of an initial horizontal section that would turn into a linear decrease in values.
Our analysis of the curves demonstrated that, when the GC is filled, the cargo exit curve was similar to the exponential decay, whereas, when the GC is empty, the kinetics of the cargo exit from GZ could be explained with the curve composed of the initial horizontal part followed by the exponential decay. However, when the cargo exit from GZ was examined using the outgoing wave protocol, we did not observe the equilibration of our cargoes within the Golgi cisternae in stacks. Additional analysis of the kinetics of the post-Golgi carriers revealed that a cargo did not equilibrate within the Golgi stack. Moreover, the exit of the cargoes from the GC per se fit mostly to the linear decline. All these data indicated that the DM is not suitable for their explanation.
The regression line describing the emptying of GZ from these cargos was dependent on the transport state of the GC. When the Golgi stacks and the Golgi zone were filled with any of our cargoes, the exit of the respective cargoes from the Golgi zone occurred according to a negatively exponential regression curve (exponential decay). In contrast, when the GC was empty, the kinetics of the cargo exit were composed of two parts, namely, an initial horizontal line followed by the exponential decay. Control experiments revealed that the temperature shift had minimal influence on the curves. The curve describing the exit of these cargoes from the Golgi stacks per se exhibited either linear decay when the GC was full of cargo or piecewise nonlinear regression when the first segment was horizontal, followed by the second segment being similar to exponential decay. This suggests that IGT does not depend on the rate of cargo diffusion.
Therefore, we additionally tested some predictions derived from the KARM. This allowed us to demonstrated that SNAREs are important for the ER–Golgi and IGT. Even transporting a stack in some moment did not have an intercisternal connection (
Movie S6), indicating that these connections are temporal. The stability of these connection is really important, because their destabilization blocked IGT. The stability of the connections also depended on COPI.
Under normal conditions, the post-Golgi carriers are accumulated in the post-Golgi zone [
2]. It is not possible to discriminate between GPCs and the GC at the level of light microscopy [
3]. Therefore, when the iFRAP or piFRAP protocols were used for the evaluation of the regression lines describing the emptying of the GC, in reality, these curves describe the exit of the cargo from the Golgi zone, which includes the GC and TGN and GPCs. Using Monte-Carlo computer simulations, we demonstrated that the emptying of the Golgi area according to the exponential decay might depend on the growth of microtubules or the hovering of GPCs in mini-stack system.
Importantly, it seems that the exit of cargoes from the TGN is a rate-limiting step in the transport of cargoes (our unpublished observations to be submitted). In order to understand why there is a delay in transport at the level of the post-Golgi compartment, it should be remembered that the delivery of post-Golgi carriers from the centrally located GC to the PM is carried out using kinesin moving the carrier through the microtubule (MT) [
38,
39]. At the same time, microtubules are constantly destroyed and grow again from the center of the MT organization. The carrier is delivered to the periphery only if the mature carrier has received kinesin from the TGN structures where kinesin is localized [
40] and if MT passes close to the carrier. The growth of MTs does not depend on the state of the GC. Therefore, if the dispatch system located at the post-Golgi compartment level is overloaded, then the growth of MTs will be a limiting factor for sending carriers to the periphery.
A similar situation arises in the case when microtubules are depolymerized. In such a situation, the post-GC carrier will fuse with the PM only if it is situated close to it, since structures with a diameter of more than 50 nm cannot diffuse in the cytosolic gel [
41]. Therefore, it is necessary to reorient GPC to a position close to the PM. That is why, if you add nocodazole in order to depolymerize microtubules immediately after the start of transport through the GC, you get a long delay in the delivery of carriers to the PM. In particular, for carriers containing procollagen, the delay can reach 4 h [
28]. Only after the central GC is completely fragmented and ministacks are located along the PM will the limiting factor ensure that the mono-exponential type of cargo leaving the Golgi stack will be associated with random temperature-dependence or be dependent on other factors, i.e., on the hovering of the ministacks or the PM. These approaches occur randomly and with a certain frequency and do not depend on cargo transport.
In general, there were two main discrepancies: (1) between the curves containing the exponential decay parts when the Golgi zones was examined and the curve containing linear decay parts when the GC per se was examined and (2) the emptying of the Golgi zone also being independent of the cargo diffusion mobility. This forced us to perform the Monte-Carlo computer-based simulation (modeling). To this end, we suggested that the exponential decay could be a result of microtubule growth and interaction between MT and GPC when MT hits GPC. Furthermore, we evaluated whether different sizes of and GPCs and different distances between centrosomes and the GPCs would affect the shape of the curves. After arising from the centrosome, microtubules come into contact with the carriers, thus giving them a signal or providing them with a mechanism to exit from the Golgi area. In cells with the central GC, post-Golgi carriers leave the Golgi zone only when they attach to microtubules (
Movies S4 and S5).
The ability to form intercisternal connections and the stability of these connections are important for the diffusion of our cargoes. However, for the concentration of diffusible cargo, these connections should be temporal [
30,
31]. The rationale of these experiments is the following. We showed previously that, when membrane fusion is blocked, the Golgi is converted into a huge number of 52 nm vesicles, whereas Golgi cisternae became invaginated [
29,
32]. Therefore, for the immobilization (“freezing”) of the Golgi morphology, we treated cells with the mixture of NEM and brefeldin A, whereas, for the destabilization of intercisternal connections, we used ONO and pyrrophenone [
32,
33,
34]. Previously, we showed that SNAREs are necessary for IGT and that, when a large amount of a cargo moves across the GC, this cargo reaches the last medial cisterna but never TMC [
2].
The following data do not support the DM: the independence of the cargo-exit kinetics from the ability of the cargoes to diffuse along the Golgi ribbon, the kinetics of the exit of these cargoes out of the empty Golgi, the linear kinetics of cargo exit from the Golgi stacks, the concentration of albumin inside the trans-most cisterna, and the concentration of cargo aggregates that cannot diffuse along thin inter-cisternal connections in the trans compartments of the Golgi complex during intra-Golgi transport.
Thus, all arguments (see Introduction) in favor of the DM could be explained in other ways. The kinetics of cargo exit from the GC per se and the Golgi zone depended on whether the GC or Golgi zone are filled with a cargo. The enrichment of PCI-containing immature GPCs in fibroblasts and lipid particles at the
trans-side of the Golgi in hepatocytes and enterocytes and the concentration of GFP-albumin at the
trans-side of the Golgi stack argue against the DM [
2,
37,
42,
43]. At steady state, most PCI and VSVG localize at the trans-side of the Golgi and within the Golgi-to-PM carriers [
2]. In organs, most PCI distensions within the Golgi area are not integrated into the Golgi cisternae but are localized externally to the stacks, apparently within the putative post-Golgi compartment or TGN [
25]. Furthermore, the transient existence of transporting stacks without inter-cisternal connections at defined times argues against the DM.
The kinetics of the exit of cargo from the GZ differed from that of the kinetics of the cargo exit from the GC per se and appeared to be linear. The deep penetration of VSVG across the Golgi stacks was not observed when a small amount was used [
2,
3]. Membrane fusion was necessary for the progression of a cargo across the Golgi stack. However, the rapid inhibition of εCOP accelerates the cis-to-trans passage (diffusion) of VSVG [
11].
The DM of IGT has several other problems: the protein, lipid, and ionic gradients across Golgi stacks; the presence of SNAREs within all steps of IGT; the secretory pathway concentration of albumin [
15]; regulatory secretion cargoes [
44]; and mega-cargoes not able to diffuse along narrow intercisternal connections [
2]. Albumin reaches the
trans-side of the GC faster than procollagen and VSVG [
9]. Already by 2 min after the release of the transport block, the concentration of albumin in the TGN became 9-fold higher than in the ER (see
Figure 1I by [
9]) and reaches 9–10-fold in 3–5 min. Furthermore, the tripeptide moves along the Golgi stack rather quickly [
45]. Intercisternal connections are permanent for albumin [
9] and therefore (if all cisternae the are interconnected) enrichment of albumin at the trans-side of the GC should not be observed. These data argue against the DM.
In order to inhibit the formation of intercisternal connections, we treated cells with BFA and NEM simultaneously or after the simultaneous microinjection of the αSNAP mutant and anti-ßCOP antibody [
29]. This blocks membrane fusion and prevents Golgi vesiculation. In order to destabilize ICs, we treated cells with PLA2 inhibitors, namely, pyrrophenone or ONO, which lead to the disappearance of ICs [
32]. In all these cases, IGT became slower, and the exchange of SNAREs was blocked. There are several other observations in favor of the important role of SNARE for IGT in situ. It is known that Rabs regulate membrane fusion [
46]). In
P. pastoris, calcium/calcium-permeable ion channels are important for IGT and the stacking of the Golgi cisternae [
47]. The importance of membrane fusion for IGT also argues against the DM.
Our data on the intra-Golgi transport of PFP at steady state confirmed results by Patterson et al. [
8]. In order to find an explanation, we estimated the curves according to which PFP exited from the Golgi per se. Thus, the obvious hypothesis would be that, in our experiments and in experiments by Patterson et al. [
8], the Golgi mass represented not only the GC per se but also some post-Golgi carriers. PCIII-GFP behaved similarly ([
24]; our unpublished observations). Patterson et al. [
8] observed the deep penetration of VSVG-GFP into Golgi stacks after the release of the 40 °C temperature block and the exit of PFP from the Golgi zone according to the exponential decay. The authors consider this zone to represent the GC per se. If so, this suggests that PCI-containing distensions freely diffuse along the united lumen of the Golgi cisternae. However, PFP cannot diffuse along connections between cisternae due to size limitations [
1,
9]. To resolve this contradiction, Patterson et al. [
8] proposed that (1) this mega-cargo (PFP), which diffuses slowly, could exit from any part of the Golgi stack, including the
cis-side, and thus, the notion of IGT, i.e., a directional transport from the
cis- to
trans-side of the Golgi, is an artefact of protocols used to study the intra-Golgi transport; and (2) there was no preferential exit of the cargoes based on their time of arrival, i.e., the cargoes that arrive early do not preferentially leave early. Patterson et al. [
8] suggested that this indicates that, in contrast to other cargoes, PFP leaves the GC immediately after its arrival at the GC even from a
cis-Golgi cisterna. However, Patterson et al. [
8] did not examine the GC, which was empty before the restoration of IGT. Bleaching per se does not eliminate cargo from the GC. Thus, the arrival of VFP was not blocked. They simply made this cargo invisible. Furthermore, the process of the GC filling with cargos could take a significant time, and, under such conditions, the exit kinetics could be different.
If we take into consideration that PFP arrives to the
cis-Golgi cisterna, this means that PFP left the Golgi from the
cis-cisternae of the Golgi stacks. However, previous electron microscopic data [
25] and our current observations suggest that procollagen I is transported through the cisternae of the Golgi stack in less than 20 min. Moreover, application of the cargo out-wave [
27] demonstrated that PFP first leaves the
cis-side of the Golgi complex and only then exits from the
trans-side. Recently, we demonstrated that the deep penetration of a cargo up to the last Golgi medial cisterna is determined by its amount [
2]. Our data demonstrated that the exit of VFP and PFP-containing distensions from the Golgi per se occurred according to a linear regression line. Furthermore, there is the accumulation of VFP at the trans-side of the Golgi at steady state [
2,
3]. Herein, we demonstrated that, when membrane fusion was blocked, there was no exit of cargo from the
cis-side of the GC and no progression of cargoes through Golgi stacks.
The DM could be improved if the idea by Griffiths [
48] that peristaltic movement might be involved in IGT would be assumed. However, the size of mega-cargoes and the absence of actin–myosin machines around intercisternal connections argue against this proposal. The simple diffusion along permanent connections between Golgi compartments cannot be an efficient mechanism for the concentration of cargoes at the trans-side of the GC. Of interest, the KARM easily explains the concentration of albumin, VSVG, mega-cargoes, and regulated secretory proteins along the
cis-to-
trans direction of the stacks [
3,
27,
35,
49,
50,
51]. However, this aspect was beyond the scope of our study.
Analysis of the graphs of the decrease in the intensity of the fluorescence of the VSVG-GFP in the area where the GC is located, shown in
Figure 1I, by Patterson et al. [
8]) revealed that the initial section of their graph has a practically linear shape and only then is replaced by the curve similar to the exponential decay. This type of curve corresponds more to a two-phase regression line composed of an initial linear section and its subsequent mono-exponential decrease. On the other hand, the regression line reflecting the corresponding decrease in ss-GFP fluorescence after an identical synchronization protocol almost perfectly corresponds to a decrease in the fluorescence of the mono-exponential type (
Figure 1E: ss-YFP by Patterson et al. [
8]). Unfortunately, the authors do not provide data on the statistical comparison of the correspondence of the presented regression lines to the types of curves indicated by us. Therefore, we cannot claim that our conclusion is more correct than the one made in the article. However, taking into account our own data, such an interpretation explains the above contradiction.
The fact is that, with the massive delivery of VSVG at the GC, the so-called cargo ribbon arises [
2]. If this is the case, then VSVG can diffuse very quickly at the last medial cisterna of the GC [
2,
8,
52,
53,
54]. These portions of cargo are located at the distal part of the medial GC and are sent from the GC in the initial period and in different types of cells with different intensities. This leads to a linear decrease in fluorescence in accordance with the maturation model of transport. In order to understand why Patterson et al. [
8] claim that regression line describing the emptying GZ after the piFRAP synchronization protocol, we examined this issue more attentively and divided our graphs into two parts and calculated R
2 and Chi
2 using the theoretical curve composed of the initial linear decay and then exponential decay. In the case of the piFRAP synchronization of VSVG-GFP, R squared was maximal, and the sum of R squared was minimal only after this assumption. In contrast, linear decay, exponential decay, and the complex curve consisting of a horizontal part and then exponential decay exhibited worse values. When we applied the piFARP synchronization protocol to PCI-GFP, the resulting regression line exhibited higher fitness to the curve composed of the initial horizontal plateau followed with exponential decay (
Table 5).
Summarizing herein, for the first time, the kinetics of the exit of various commonly used standard cargoes from the Golgi zone was studied under conditions when the synchronization of the cargo wave begins under conditions when the GC does not contain cargo. It is proven that the kinetics of the passage of various cargoes through the GC corresponds to a straight regression line. The observations that there is no balancing of cargo concentration between different cisternae are completely original. It is shown for the first time that transport through different CG compartments requires the SNARE function; it is established that the connections between different GC cisternae are not constant, which rejects the diffusion pure model and calls into question the universality of using a negative exponential curve for cargo exiting the GC zone. Our data argue against the DM.
4. Materials and Methods
4.1. Reagents
Unless otherwise stated, all of the chemicals and reagents were obtained from previously indicated sources [
55,
56] or from Sigma (Milan, Italy). FUGENE6 transfection reagent was from Roche (Monza, Italy). The following antibodies were used: polyclonal against GM130 (from M. A. De Matteis, Mario Negri Sud Institute, Italy); monoclonal against ERGIC53 (from H. P. Hauri, University of Basel, Switzerland); polyclonal against the luminal and cytosolic domains of galactosyl transferase (GalT; from E. Berger, University of Zurich, Switzerland); polyclonal against ßCOP (from J. Lippincott-Schwartz, National Institutes of Health, Bethesda, USA); polyclonal against ManII (from K. W. Moremen, University of Georgia, USA); polyclonal against the α1 chain C-terminal domain of PCI (from L. W. Fisher, National Institutes of Health, USA); monoclonal against the VSVG luminal domain (from J. Gruenberg, University of Geneva. Switzerland); polyclonal against the luminal domain of tsVSVG (from K. Simons, Max-Planck Institute, Germany); monoclonal against VSVG (P5D4; from Sigma-Aldrich, St. Louis, MI, USA); polyclonal against TGN46 (from S. Ponnambalam, Wellcome Trust Centre for Human Genetics, Headington, Oxford, UK); polyclonal against ßCOP (from Agilent/DAKO, Santa Clara, CA, USA); polyclonal against GFP (from Abcam, Cambridge, UK); and polyclonal conjugated with Alexa 488 and Alexa 546 against rabbit, mouse and sheep IgGs (from ThermoFisher Scientific, Waltham, MA, USA). Fab fragments of polyclonal antibodies against these IgGs were from Jackson ImmunoResearch (West Grove, PA, USA), nano-gold-conjugated Fab fragments of anti-rabbit IgG and Gold Enhancer were from Nanoprobes (Yaphank, NY, USA), and protein A conjugated with colloidal gold was from J. Slot (Utrecht University; The Netherlands). Pyrrophenone was from MedChemExpress (Princeton, NJ, USA; catalog no.: HY-111376).
4.2. Constructs
Reagents used in this study are presented in
Table 7. J. Lippincott-Schwartz (Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA) kindly provided the cDNA of GalT-GFP and VSVG-YFP. AFP [
9] and the procollagen III (PCIII)-GFP and PCI-GFP (PFP) constructs [
21,
24] were characterized previously. PCI tagged with GFP at its C-terminus did not work in our hands, and therefore two constructs were produced: the α1 and α2-chains of PCI both tagged with GFP at their N-terminus. Briefly, the leader sequence of collagen type I α2 was excised by PCR using the forward primer CGGCTAGCATGCTCAGCTTTGTGGAT and the reverse primer CGACCGGTTGGCATGTTGCTAGGCATAA and then restriction-cloned at the 5’ end of GFP in the pEGFPC3 vector (Clontech, Mountain View, CA, USA), using the NheI and AgeI sites. This modified vector was used for the sub-cloning between the HindIII and the BamHI sites of the remaining collagen type I α2 sequence, which was excised by PCR using the forward primer GCGAAGCTTCAATCTTTACAAGAGGAAACTGTAAG and the reverse primer GCGGGATCCTTATTTGAAACAGACTGGGCCAATGT. The same modified vector was used as for the sub-cloning of collagen type I α1, between the HindIII and PstI sites, after PCR-excision using the forward primer GCGAAGCTTCAAGAGGAAGGCCAAGTCGAGG and the reverse primer GCGCTGCAGTTACAGGAAGCAGACAGGGCCAACG.
4.3. Cells
Human fibroblasts were from M. De Luca (Istituto Dermatopatico dell’Immacolata, Rome, Italy). HeLa cells, NRK, and HepG2 cells (from the same sources as described previously) [
9,
57] and human embryonic kidney 293T cells (from ATCC [293T (ATCC
® CRL-3216™]) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 50 mg/mL penicillin, and streptomycin in a 5% CO
2 incubator. Cells were grown in A-DMEM/F12 (1:1), 5% fetal bovine serum, 4 mM GlutaMAX (all from Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (from Sigma-Aldrich). In each experiment, 6 pairs (control and experimental one) of dishes with cells were used, and each dish was fixed on a different day. We always used 32 °C and two conditions: (1) embryonic serum and (2) adult serum as a control.
In order to prevent Golgi vesiculation, we used brefeldin A together with NEM, as was described by [
29].
4.4. Designs of Experiments
Transfection of human fibroblasts with PFP was performed by electroporation (1.5 µg cDNA per 2 × 10
5 cells; V, 400 v; C, 870 µF) or as described previously [
8]. Cells were transfected with GFP-albumin, VFP, and PFP exactly as was described previously [
9]. Transfection of cells with VFP and GFP-albumin was carried out using electroporation, as described previously [
15]. The experiments based on the siRNA interference were organized as before [
57]. Transient transfections of cells were performed 16 h prior to experimental imaging. The α-SNAP mutant was injected into the cell, then the cell was transferred to ice for 10–15 min so that the antibodies diffused through the cytosol. Then the cells were transferred to a medium at a temperature of 37 °C, and 5 min after heating, they were prepared for analysis using immunofluorescence.
The infection of the cells with the 045 temperature-sensitive strain of VSV and their transfection with the different fusion proteins (only cells with low levels of transfection were examined) and the stimulation of PC and PFP synthesis in human fibroblasts were all performed as described previously [
9]. The synchronization of intra-Golgi transport was performed using different protocols derived from previous studies [
3,
6,
17,
26]. The synchronization protocols used were without or with cycloheximide (CHM; 150 µg/mL; to block protein synthesis in the ER) and are summarized below, with further details given in
Table 1 and
Figure S1. Briefly:
1. The pulse (40-15-40) protocols could be small (the mini-wave;
Table 1, 1A,B) or large (the maxi-wave;
Table 1, 2A,B). In both cases, the cells were transfected for VFP (HeLa cells) or PFP (human fibroblasts) (AFP is not suitable for these protocols) and kept at 40 °C for 16 h in the absence of ascorbic acid to accumulate VFP or PFP in the ER. Then, the cells were shifted to 15 °C for 15 min (
Table 1, 1A,B) or 2 h (
Table 1, 2A, B) and then were shifted back to 40 °C in the confocal microscope stage, when the video recording was started (sometimes the whole cell minus its Golgi complex was also bleached).
2. The pulse (40-32-40) protocol (
Table 1, 3A,B). HeLa cells were transfected for VFP and placed at 40 °C for 16 h, then shifted to 32 °C for 5 min, and then back to 40 °C in the confocal microscope stage. Finally, the video recording was started (sometimes the whole cell minus its Golgi complex was also bleached). The rationale of these protocols is to allow a defined (small or large) amount of a cargo to move through the GC.
3. The emptying pulse [32(CHM)-15-32(CHM)] protocols (
Table 1, 4A,B). The cells were transfected for one of the cargoes and placed at 32 °C for 16 h. Then the cells were treated with CHM for 3 h at 32 °C to empty the Golgi complex and the ER. The cells were then placed at 15 °C for 2 h, and the CHM was removed to initiate protein synthesis and the transport of the cargo to the pre-Golgi compartment. Finally, the cells were placed at 32 °C in the presence of CHM when the video recording was started (sometimes the whole cell minus its Golgi complex was also bleached). The rationale of this protocol is allowing a defined amount of any cargo to move through the GC.
4. The pulse (40-32-40) protocol (
Table 1). HeLa cells were transfected for VFP or PFP and placed at 40 °C for 16 h to accumulate VFP or PFP (also in the absence of ascorbic acid) in the ER. Then the cells were shifted to 32 °C for 5 min, and next, the cells were placed at 40 °C again. The rationale of this protocol is to allow a small amount of cargo (mostly tsVSVG and PC) to move through the GC.
5. The iFRAP-steady-state protocol (
Table 1, 5A). The cells were transfected for one of the cargoes and placed at 32 °C for 16 h. Then the whole cell minus its Golgi complex area was bleached, and the video recording was started. This is a repetition of Patterson et al.’s protocol. It would allow us to test the fitness to exponential decay statistically.
6. The piFRAP-steady-state protocol (
Table 1, 5B). The cells were transfected for one of the cargoes and placed at 32 °C for 16 h. Initially, the Golgi complex was bleached, and after 3 min, the whole cell minus its Golgi complex area was bleached again, and the video recording was started. This is a repetition of the Patterson et al. protocol. It would allow us to test the fitness to exponential decay statistically and compare this fitness with the regression line composed of a linear decay and an exponential decay.
7. The outgoing wave protocol (
Table 1, 6A). The cells were transfected for VFP or PFP and placed at 32 °C for 16 h. Then the cells were placed at 40 °C in the confocal microscope stage, and the video recording was started [
6,
9,
22]. This protocol would allow us to evaluate whether cargo would equilibrate its concentration within the Golgi stack.
4.5. Light Microscopy
The fluorescence microscopy analysis included time-lapse analysis, with the measurement of fluorescence recovery after photo-bleaching (FRAP) carried out using a confocal system (LSM510 META; Carl Zeiss, Oberkochen, Germany). The cells were fixed at the desired times using 4% paraformaldehyde and then processed for immunofluorescence. Cells on coverslips were analyzed with this confocal microscope with an objective 40× lens using the original manufacturer’s software. The GFP fluorescence was bleached by 50 pulses for a total time of 0.07 s at 90% laser power/100% transmission. The fluorescence intensity (
F) in the bleached area was monitored as a function of time after the bleaching by scanning at 90% laser power/0.5% transmission every 3 s. In our hands, under these conditions, the photo-bleaching was irreversible. The level of the co-localization of two markers was measured as described previously [
9,
39].
For FRAP analysis, HeLa cells were transfected with VFP and AFP, whereas human fibroblasts were transfected with PFP. Then, in the transfected cell, part of the Golgi mass was bleached within the indicated boxes indicated in Figures with the laser working at maximal intensity; images were acquired, and the ratios between the bleached areas and the areas out of the bleached boxes but within the Golgi mass were determined. Data were plotted, and the SD was estimated.
All live-cell imaging was performed on cells grown in MatTek chambers and maintained in a CO2-independent medium. The brightness and contrast of the fluorescent images were adjusted (Photoshop CS5.1), and all of the live confocal images and the wide-field images were Gaussian-filtered (rotationally symmetric low-pass filter). Only dots with intensity at least double the background were counted. For immunofluorescence and immune EM, we performed all of the necessary controls, including the control of the secondary antibodies and the positive and negative controls. When control cells are mentioned, these were the cells that were the required control of the experiment cells. These will have included irrelevant microinjection, control RNA oligonucleotides, and other such relevant controls.
The various cell treatments included 2.5 µM FLI-06, 0.3 and 5 µg/mL BFA, [
2], and 1 mM NEM, as described in [
2,
29].
4.6. Electron Microscopy
For electron microscopy (EM), the samples were prepared as described previously [
6,
9,
56,
57,
58,
59,
60]. All manipulations were carried out at room temperature (~21 °C) unless otherwise stated. After washing in distilled water, the cells were postfixed in 1% OsO
4 that contained 15 mg/mL K
4[Fe(CN)
6] and in 0.1 M sodium cacodylate buffer at room temperature for 1 h, then washed with distilled water, dehydrated through a graded series of ethanol, infiltrated with Epon 812 resin for 1 h, and polymerized at 60 °C for 24 h. Ultrathin sections were collected on carbon-coated grids with formvar support film (EMS, G2010-Cu, see
Table 7), post stained with uranyl acetate and lead citrate, and viewed under an electron microscope (Tecnai 20; FEI, Eindhoven, The Netherlands).
4.7. Preembedding Immuno-Electron Microscopy (Pre-IEM)
Pre-IEM was performed according to He et al. [
55,
61], with small modifications. Briefly, after the fixation of cells with glutaraldehyde (see above), samples were washed with the blocking buffered solution (four rinses over 30 min), incubated with primary antibody dissolved in blocking solution for 4 h at room temperature, rinsed with blocking buffer (four times over 30 min), and incubated with the species-specific Fab fragments of secondary antibody labeled with 1.4 nm nanogold in blocking solution overnight at room temperature. Then cells were additionally fixed with 1.6% glutaraldehyde in 0.1M sodium cocadylate buffer (pH 7.4) for 15 min, rinsed with HEPES buffer (50 mM HEPES with 200 mM sucrose, pH 5.8, four times over 30 min), washed 3 × 5 min with PBS including glycine (20 mM sodium phosphate, pH 7.4, 150 mM NaCl, 50 mM glycine) to remove aldehydes, rinsed (3 × 5 min) with PBS–BSA–Tween (PBS containing 1% BSA and 0.05% Tween 20), and washed (3 × 5 min) with Solution E (5 mM sodium phosphate, pH 5.5, 100 mM NaCl) from the gold enhancement kit (GoldEnhance-EM 2113; Nanoprobes, Inc. see
Table 7). Next, samples were placed in a mixture of manufacturer’s Solutions A and B at a 2:1 ratio (80 µL of A and 40 µL of B for 5 min and 200 µL of Solution E with 20% gum Arabic [Sigma–Aldrich. see
Table 7]), and then 80 µL of Solution C was added in order to develop gold for 7–15 min. The enhancement was conducted at 4 °C. Further, samples were transferred to the neutral fixer solution composed of 250 mM sodium thiosulfate and 20 mM HEPES at pH 7.4 to stop the enhancement (three rinses over 5 min), washed with buffer E for 3-5 min, incubated in 1% OsO
4 in 0.1 M sodium phosphate (pH 6.1) for 60 min, and rinsed with distilled H
2O. Finally, after standard dehydrations, cells were embedded into Epon (EMS).
4.8. CLEM
For the identification of cells transfected with AFP, PFP, PCIII-GFP, or VFP or after cell microinjection, we used CLEM based on vertical sectioning, as described in [
55,
56]. For CLEM and cryo-sectioning, the cells on Petri dishes were fixed in 4% paraformaldehyde and 0.05% glutaraldehyde. The analysis of samples by two-step correlative EM tomography was performed on 200 nm-thick sections, as described previously [
9,
37,
55]. CLEM, based on the analysis of the two-step tomographic reconstructions acquired under low (7800×) magnification with the consecutive reacquisition of the EM tomo box under high (29,000×) magnification and its re-examination, was used exactly as described [
61].
4.9. Cryosections
Cryo-sections of cells prepared according to the Tokuyasu method as described previously [
62] were immune-labeled with antibodies against albumin, GFP, PCI, VSVG, GM130, ERGIC53, GalT, and TGN38/46. For immune fluorescence, the dilution of Abs was used according to the manufacturer’s instruction. The EM dilution was 10-fold lower. Thawed cryo-sections with a thickness of 45–50 nm were labeled with an antibody (usually with the dilution 1:50) against antigens of interest and then stained with protein A conjugated with 10 nm gold particles. After contrasting with uranyl acetate, these were examined under electron microscopy (Tecnai 20; FEI/ThermoFisher Scientific, Eindhoven, The Netherland). For most of the antibodies, the dilutions used were 1:50-1:100. Block solution contained 0.1% cold-water fish-skin gelatin.
4.10. Electron Microscopy Tomography
Routine EM tomography and the two-step correlative EM tomography were performed as described in detail previously [
2,
30,
62].
4.11. Acquisition and Statistical Analysis of the Kinetics Data
The cells were transfected, and a cell without any features of degenerative changes and with the cargo situated in the expected organelle(s) was selected for observation. The region of interest was bleached with the repetitive irradiation of the cell with a high-intensity beam or images were acquired without bleaching. When necessary, a second round of bleaching was performed. For the purpose of the economy of computer memory, images were grabbed in the format of 256 × 256 pixels. After the acquisition of the stacks of images, background and acquisition bleaching correction were performed. Briefly, using the LSM510 software, the mean fluorescence intensity was measured within the FRAP region of interest (Ifr; region of interest where FRAP occurred), the reference region of interest (Irr; within the zone of each image that was present in all images), and the base region of interest (Ibr; outside the cell of interest). In many cases, due to the shifting of the cells along the cover slip and to small changes in the shape of the GC and the cell itself during the observations, the stable and precise contouring of the Golgi complex zone was not possible, and the region of interest had to be enlarged, which made the measurements less precise.
Then the decrease in fluorescence within the cell of interest was corrected, which occured during the bleaching and before the measurement of the FRAP. The means of the corrected reference region (Icrr) were obtained by adding to each mean of the reference region (Irr) acquired after the bleaching the difference (delta) between the mean intensity just before the bleaching (Irr-pre) and that immediately after the bleaching (Irr-after):
if variants before bleaching were used,
if variants after bleaching were used.
Next, the actual means of the intensities within the regions of interest were estimated for each time point, with the subtraction of the background and the introduction of the correction for bleaching:
Two randomly selected cells from each pair (6 pairs of independent control and experiment Petri dishes; n = 6) were analyzed in each case, according to the following procedures [
9]. All of the Golgi stacks were examined during the kinetics analysis. For each curve, the only variants included were those acquired every 6 s.
To convert the Y values from different datasets to a common scale, these data were normalized using the Prism software in such a way that the maximal mean of each curve was equated to 100%; namely, the mean fluorescence intensity at the time when the mean fluorescence within the region of interest was maximal (Imax) was defined as 100%. The fluorescence intensities for the other time points (In(t)) were estimated according to Equation (4):
To synchronize X with time, the X data were aligned versus the turning (bending) point. To determine this breakpoint, two approaches were used. According to the first approach, the point of inflection (the turning point; pivot point) was determined on the basis of the R2 estimation. To this end, the first two-thirds of the initial part of the curve (the plateau) was considered, and, using Excel software, the R02 for the linear trend line was estimated. Then, the length of this part of the curve was increased step-by-step by consecutively adding on the next time point to the considered part of the curve, and again R12, R22, R32, ..., Rn2 were estimated, and so on, for the linear trend line. Initially, this was close to 1.0. Then, when the presumed point of inflection was added, Rpt2 decreased. If the theoretical curve was examined after the addition of the next (i.e., after the presumed point of inflection) time point, R12 then started to increase, approaching 1.0 again. If the empirical curves were assessed, the peak of this decrease was sometimes less clear. Next, the results (i.e., the consequence of Rn2) were plotted as a curve, and the maximal change in R2 was estimated for each time point. If the experimental curve did not contain a visible point of inflection, as in the case of curves that fit exponential decay, the plot of Rn2 did not contain any visible negative peak. The time point after which there was the maximal decrease in R2 (here, Rn2 has its maximal slope) was defined as the point of inflection (the breakpoint) and used to aligned all of the curves in such a way that this moment was simultaneous for all of them. The second approach was based on the estimation of the time point when the Golgi mass started to fragment and the spots of fluorescent begin to ‘hover’.
Thus, to align the regression lines, we calculated regression lines for the initial observation period, that is, until the end of the sampling, and then calculated regression lines for the second part of the regression curve, when a significant drop in fluorescence intensity began. The intersection of the obtained curves was considered to be the starting point for the protein exit from the Golgi zone. After compensation for bleaching and the alignment of curves using the point of bending as the common points for all regression lines, we averaged 6 curves for each series of experiments. After the normalization of the curves along the Y-axis and the X-axis, statistical analysis was performed. Using Excel software, the mean curve for each synchronization protocol was estimated and plotted with its associated standard deviation.
The datasets were also checked in terms of whether the variability of the values around the curve followed a Gaussian distribution and whether the variations in all of the curves were approximately Gaussian. The data obtained for each time point were checked using the (alpha)2 statistic for the distribution of six variants, because six movies for each time point were examined. Checks were also made in terms of whether any imprecision in measuring X was very small compared to the variation in Y and whether the errors were independent. The deviation of each value from the curve was seen to be random and not correlated with the deviation of the previous or next point. Paired and unpaired Student’s t-tests were performed to determine the significance of the differences in the comparisons of the experimental groups. All of the data are expressed as means ± SD, and the differences are considered to be significant when p < 0.05. For the sake of simplicity, only the biologically important meaning of a p < 0.05 was used for the evaluation of the statistical significance.
The kinetics curves were examined statistically for goodness of fit to exponential decay (
Table 3 and
Table 4). The data were checked whether these fit to a one-phase exponential curve, such that:
where k is the rate constant. However, rough examination of the normalized curves revealed that they might represent piecewise nonlinear regression when the first segment is linear (i.e., a plateau) and the second segment is an exponential decay. Several approaches were used to fit this type of model with a nonlinear regression statistical algorithm.
To align the regression lines, we calculated regression lines for the initial observation period, that is, until the end of the sampling, and then calculated regression lines for the second part of the regression curve, when a significant drop in fluorescence intensity began. The intersection of the obtained curves was considered the starting point for the protein exit from the Golgi zone. After compensation for bleaching and the alignment of curves using the point of bending as the common points for all regression lines, we averaged 6 curves for each series of experiments.
For the evaluation of the shapes of the regression curves, the following were selected: (1) exponential decay and (2) plateau followed by exponential decay, with the consecutive analysis of variance conducted for the significance of regression. To determine whether the kinetics of cargo exit from the Golgi zone decayed exponentially, several approaches were used. Initially, it was assumed that the regression curve could be viewed as distributions, and initially two empirical distributions were compared with each other, as those obtained after the empty (E) and full (F) protocols of
Table 1, using Chi-squared (Chi
2) tests. Then, the theoretical exponential distributions were compared with the empirical ones, using Chi-squared tests. Additionally, to evaluate the goodness-of-fit of the experimental curves to the theoretical exponential curves, Chi-squared goodness-of-fit was used, based on the Pearson’s chi-squared statistic and the Smirnov–Kolmogorov test, as available within the SYSTAT12 software (Version 12). Finally, using Prism software, whether the empirical regression curves were significantly different from the following regression curves was evaluated on the basis of R
2 and Chi
2: linear regression, exponential decay, and plateau followed by exponential decay. The
p-values associated with the Smirnov–Kolmogorov, Fisher, and Chi-squared statistics were estimated. Furthermore, the parallelism of two curves of empirical regression was compared; namely, the curve obtained after the examination of the full Golgi complex and the curve obtained after the examination of the empty Golgi complex using Fisher statistics. The method described by Iznaga et al. [
63] for linear regression was used: the regression was calculated for each curve, and two curves determined by linear regression were examined on the basis of their slopes. To do this, Y was plotted as log-transformed data, so that linear regression was suitable. The null hypothesis, H0, stated that the curves were parallel, and the alternative hypothesis, H1, that the curves were not parallel. In all cases, H0 was rejected when the difference between the normal distribution and the observed distribution was insignificant (Fd < Fst; for
p < 005). The regression curve was considered the empirical distribution, and then using SYSTAT12 software (Version 12), the differences between the empirical and theoretical distributions were evaluated according to the Chi-squared statistic. A difference was considered significance when
p < 0.05. Typically, eight randomly selected cells from independent experiments were assessed, with >300 movies examined. Regression curves are shown, together with the 95% confidential intervals (the green zones near the regression curves in the relevant Figures).
In each set of experiments, we used 6 such pairs of MatTek dishes (control [i.e., microinjection of an irrelevant protein or antibody or transfection with an irrelevant oligos] and experimental). Two randomly selected cells within the very center of the Petri dishes were examined. In all experiments after seeding the cells, we used 6 pairs of samples composed of one randomly selected control and one randomly selected experimental Petri dish (or the very low edges of the rat). Every pair was further processed as a single sample under completely identical conditions. After embedding into Epon, we made vertical serial 1 µm sections through the cells of interest, and then, on these vertical sections, we examined the cross diameter of the nuclei. The section where the diameter was maximal was re-embedded, and serial ultrathin vertical sections were obtained. The section where the width of our nucleus was maximal, we considered the central section, and the vertical axis was generated through the nuclear center. Ultra-sectioning was organized in such a way when control and experimental samples were embedded in one section block [
64]. The control and experimental Petri dish were glued and cut as one sample. In each dish, two cells: one in the very center of the dish and another in the peripheral part of the dish, were randomly selected. Random representative images of these cells were examined. Two measurements (slices) were made in each cell. For quantification, we selected vertical sections of cells where 4 consecutive serial sections of a centriole were visible. Next, the normalized (or absolute) value for the experimental cup was calculated as a percentage of its control. These percentages were used as units (N = 6; biologically independent samples) for calculations of averages and standard deviations.
We judged the connections after the analysis of serial sections or EM tomo. Identification of procollagen I containing distensions was performed on the basis of their size on serial sections and taking into consideration the slight striation of their content. Labeling of VSVG was performed using E-nano-gold, Tokuyasu cryosections, and their gold labeling and IEM based on HRP-DAB/H
2O
2 reaction. Identification of the trans-side of the Golgi was performed on the basis of the presence at this side of clathrin-coated structures [
38].
Endosomes were labeled with WGA conjugated with HRP. When it was necessary to label the PM, cells were incubated on ice for 20 min, and then WGA-HRP was visible on the PM. When it was necessary to labeled most endosome, TMC cells after 20 min incubation with WAG on ice were placed at 37 °C for 15 min [
65]. When it was necessary to label all endosomes including TMC, the incubation time (at 37 °C) was increased to 30 min.
The discretized rotator was used for the estimation of the absolute volume [
64,
66]. Furthermore, we estimated the percentage of Golgi-PM carriers wherein at least two gold particles were observed as a specific labeling of GalT or Ykt6. Percentage, profile, and point counting was directly performed in the electron microscope Tecnai-20 (FEI [now ThermoFisher Scientific]). AnalySis software (ThermoFisher Scientific) was used for our measurements.
4.12. Statistical Analysis
Statistics were performed using GraphPad Prism 9.4.0., as described in [
2]. Briefly: The number of Petri dishes used for each analysis is indicated in the figure legends, selected by a power analysis to detect a 30% change with 10% error and 95% confidence. For the sake of simplicity, Student’s
t-tests, paired t-tests, and non-parametric Mann–Whitney U tests were used. In the majority of cases, we used a nonparametric Mann–Whitney U test. A difference was considered significant when
p < 0.05. For a comparison of 2 groups of continuous variables with normal distribution and equal variances, 2-tailed unpaired Student’s t tests (with additional Welch correction for unequal variances) were performed with a significance threshold of
p ≤ 0.05. In most cases, data are given as the mean ± standard deviations (SD). Values are mean ± SD of 6 variants (n = 6). In the text, the words “differ”, “smaller”, or “higher” indicate that two values are significantly (
p < 0.05) different [
67].