Amyloid Fibrils Produced by Streptococcus sanguinis Contribute to Biofilm Formation and Immune Evasion
Abstract
:1. Introduction
2. Results
2.1. Streptococcus sanguinis Strains Produce Amyloid Fibrils in Biofilms
2.2. Streptococcus sanguinis Strains Produce Amyloid-like Components in Culture Fluids and in Macrocolonies
2.3. EGCG Inhibits Biofilm Formation by S. sanguinis at Specific Concentrations
2.4. Amyloid Production Negatively Correlates with Binding to Serum Amyloid P Component (SAP), C3b Deposition and Opsonophagocytosis by PMNs among S. sanguinis Strains
2.5. Deletion of srtA Impairs Amyloid Formation during Different Forms of S. sanguinis Growth
2.6. Deletion of srtA Increases S. sanguinis Susceptibility to C3b Deposition, Affects Its Interaction with PMNs and Impairs Persistence in Human Blood
3. Discussion
4. Materials and Methods
4.1. Strains, Culture and Staining Conditions
4.2. Construction of the srtA Isogenic Mutants and Complemented Strain
4.3. Detection of Amyloid Fibrils in Biofilms by Cross-Polarized Light Microscopy and Fluorescence Microscopy
4.4. Macrocolony Phenotype
4.5. Preparation of Culture Supernatants
4.6. Quantitative Analysis of Amyloid through Spectrofluorimetry
4.7. Biofilm Formation Assays
4.8. C3b Deposition
4.9. PMN Isolation and Phagocytosis Assay
4.10. Microscopy Analysis of Bacterial Phagocytosis in Human Blood
4.11. Bacterial Persistence in Human Blood
4.12. Data Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kreth, J.; Giacaman, R.; Raghavan, R.; Merritt, J. The Road Less Traveled—Defining Molecular Commensalism with Streptococcus sanguinis. Mol. Oral Microbiol. 2017, 32, 181–196. [Google Scholar] [CrossRef] [PubMed]
- Zhu, B.; Macleod, L.C.; Kitten, T.; Xu, P. Streptococcus sanguinis Biofilm Formation & Interaction with Oral Pathogens. Future Microbiol. 2018, 13, 915–932. [Google Scholar] [PubMed]
- VON Reyn, C.F.; Levy, B.S.; Arbeit, R.D.; Friedland, G.; Crumpacker, C.S. Infective Endocarditis: An Analysis Based on Strict Case Definitions. Ann. Intern. Med. 1981, 94, 505–518. [Google Scholar] [CrossRef]
- Douglas, C.W.I.; Heath, J.; Hampton, K.K.; Preston, F.E. Identity of viridans streptococci isolated from cases of infective endocarditis. J. Med. Microbiol. 1993, 39, 179–182. [Google Scholar] [CrossRef] [PubMed]
- Kovuri, P.; Kumaran, S.S.; Chatterjee, T. Streptococcus sanguinis Endocarditis of Bicuspid Aortic Valve Presenting as Septic Arthritis of Lumbar Facet Joint. Cureus 2022, 14, e24189. [Google Scholar] [CrossRef] [PubMed]
- Nakano, K.; Inaba, H.; Nomura, R.; Nemoto, H.; Takeda, M.; Yoshioka, H.; Matsue, H.; Takahashi, T.; Taniguchi, K.; Amano, A.; et al. Detection of Cariogenic Streptococcus mutans in Extirpated Heart Valve and Atheromatous Plaque Specimens. J. Clin. Microbiol. 2006, 44, 3313–3317. [Google Scholar] [CrossRef]
- Xu, P.; Alves, J.M.; Kitten, T.; Brown, A.; Chen, Z.; Ozaki, L.S.; Manque, P.; Ge, X.; Serrano, M.G.; Puiu, D.; et al. Genome of the Opportunistic Pathogen Streptococcus sanguinis. J. Bacteriol. 2007, 189, 3166–3175. [Google Scholar] [CrossRef]
- Turner, L.S.; Kanamoto, T.; Unoki, T.; Munro, C.L.; Wu, H.; Kitten, T. Comprehensive Evaluation of Streptococcus sanguinis Cell Wall-Anchored Proteins in Early Infective Endocarditis. Infect. Immun. 2009, 77, 4966–4975. [Google Scholar] [CrossRef]
- Alves, L.A.; de Carli, T.R.; Harth-Chu, E.N.; Mariano, F.S.; Höfling, J.F.; Stipp, R.N.; Mattos-Graner, R.O. Oral streptococci show diversity in resistance to complement immunity. J. Med. Microbiol. 2019, 68, 600–608. [Google Scholar] [CrossRef]
- Salam, M.A.; Nakao, R.; Yonezawa, H.; Watanabe, H.; Senpuku, H. Human T-cell responses to oral streptococci in human PBMC-NOD/SCID mice. Oral Microbiol. Immunol. 2006, 21, 169–176. [Google Scholar] [CrossRef]
- Lee, Y.H.; Zimmerman, J.N.; Custodio, W.; Xiao, Y.; Basiri, T.; Hatibovic-Kofman, S.; Siqueira, W.L. Proteomic Evaluation of Acquired Enamel Pellicle during In Vivo Formation. PLoS ONE 2013, 8, e67919. [Google Scholar] [CrossRef] [PubMed]
- Díaz-Garrido, N.; Lozano, C.P.; Kreth, J.; Giacaman, R.A. Competition and Caries on Enamel of a Dual-Species Biofilm Model with Streptococcus mutans and Streptococcus sanguinis. Appl. Environ. Microbiol. 2020, 86, e01262-20. [Google Scholar] [CrossRef] [PubMed]
- Kreth, J.; Merritt, J.; Shi, W.; Qi, F. Competition and Coexistence between Streptococcus mutans and Streptococcus sanguinis in the Dental Biofilm. J. Bacteriol. 2005, 187, 7193–7203. [Google Scholar] [CrossRef] [PubMed]
- Kreth, J.; Vu, H.; Zhang, Y.; Herzberg, M.C. Characterization of Hydrogen Peroxide-Induced DNA Release by Streptococcus sanguinis and Streptococcus gordonii. J. Bacteriol. 2009, 191, 6281–6291. [Google Scholar] [CrossRef]
- Moraes, J.J.; Stipp, R.N.; Harth-Chu, E.N.; Camargo, T.M.; Höfling, J.F.; Mattos-Graner, R.O. Two-Component System VicRK Regulates Functions Associated with Establishment of Streptococcus sanguinis in Biofilms. Infect. Immun. 2014, 82, 4941–4951. [Google Scholar] [CrossRef]
- Yoshida, Y.; Konno, H.; Nagano, K.; Abiko, Y.; Nakamura, Y.; Tanaka, Y.; Yoshimura, F. The influence of a glucosyltransferase, encoded by gtfP, on biofilm formation by Streptococcus sanguinis in a dual-species model. APMIS 2014, 122, 951–960. [Google Scholar] [CrossRef]
- Alves, L.A.; Salvatierra, G.C.; Freitas, V.A.; Höfling, J.F.; Bastos, D.C.; Araujo, T.L.S.; Mattos-Graner, R.O. Diversity in Phenotypes Associated With Host Persistence and Systemic Virulence in Streptococcus sanguinis Strains. Front. Microbiol. 2022, 13, 875581. [Google Scholar] [CrossRef]
- Eisenberg, D.; Jucker, M. The Amyloid State of Proteins in Human Diseases. Cell 2012, 148, 1188–1203. [Google Scholar] [CrossRef]
- Levkovich, S.A.; Gazit, E.; Bar-Yosef, D.L. Two Decades of Studying Functional Amyloids in Microorganisms. Trends Microbiol. 2021, 29, 251–265. [Google Scholar] [CrossRef]
- Salinas, N.; Povolotsky, T.L.; Landau, M.; Kolodkin-Gal, I. Emerging Roles of Functional Bacterial Amyloids in Gene Regulation, Toxicity, and Immunomodulation. Microbiol. Mol. Biol. Rev. 2021, 85, e00062-20. [Google Scholar] [CrossRef]
- Mikhail Belousov Prokaryotic Amyloids in Interspecies Interactions. Encyclopedia. 2023, pp. 1–14. Available online: https://encyclopedia.pub/entry/2620 (accessed on 4 October 2023).
- Tursi, S.A.; Tükel, Ç. Curli-Containing Enteric Biofilms Inside and Out: Matrix Composition, Immune Recognition, and Disease Implications. Microbiol. Mol. Biol. Rev. 2018, 82, e00028-18. [Google Scholar] [CrossRef] [PubMed]
- Oli, M.W.; Otoo, H.N.; Crowley, P.J.; Heim, K.P.; Nascimento, M.M.; Ramsook, C.B.; Lipke, P.N.; Brady, L.J. Functional amyloid formation by Streptococcus mutans. Microbiology 2012, 158, 2903–2916. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Cao, Y.; Yu, L.; Tao, Y.; Zhou, Y.; Zhi, Q.; Lin, H. Characteristics and influencing factors of amyloid fibers in S. mutans biofilm. AMB Express 2019, 9, 31. [Google Scholar] [CrossRef] [PubMed]
- di Cologna, N.M.; Samaddar, S.; Valle, C.A.; Vargas, J.; Aviles-Reyes, A.; Morales, J.; Ganguly, T.; Pileggi, R.; Brady, L.J.; Lemos, J.A.; et al. Amyloid Aggregation of Streptococcus mutans Cnm Influences Its Collagen-Binding Activity. Appl. Environ. Microbiol. 2021, 87, e0114921. [Google Scholar] [CrossRef] [PubMed]
- Van Gerven, N.; Van der Verren, S.E.; Reiter, D.M.; Remaut, H. The Role of Functional Amyloids in Bacterial Virulence. J. Mol. Biol. 2018, 430, 3657–3684. [Google Scholar] [CrossRef]
- Barran-Berdon, A.L.; Ocampo, S.; Haider, M.; Morales-Aparicio, J.; Ottenberg, G.; Kendall, A.; Yarmola, E.; Mishra, S.; Long, J.R.; Hagen, S.J.; et al. Enhanced purification coupled with biophysical analyses shows cross-β structure as a core building block for Streptococcus mutans functional amyloids. Sci. Rep. 2020, 10, 5138. [Google Scholar] [CrossRef]
- Besingi, R.N.; Wenderska, I.B.; Senadheera, D.B.; Cvitkovitch, D.G.; Long, J.R.; Wen, Z.T.; Brady, L.J. Functional amyloids in Streptococcus mutans, their use as targets of biofilm inhibition and initial characterization of SMU_63c. Microbiology 2017, 163, 488–501. [Google Scholar] [CrossRef]
- Biesecker, S.G.; Nicastro, L.K.; Wilson, R.P.; Tükel, Ç. The Functional Amyloid Curli Protects Escherichia coli against Complement-Mediated Bactericidal Activity. Biomolecules 2018, 8, 5. [Google Scholar] [CrossRef]
- Claessen, D.; Rink, R.; De Jong, W.; Siebring, J.; De Vreugd, P.; Boersma, F.G.H.; Dijkhuizen, L.; Wösten, H.A.B. A Novel Class of Secreted Hydrophobic Proteins Is Involved in Aerial Hyphae Formation in Streptomyces coelicolor by Forming Amyloid-like Fibrils. Genes Dev. 2003, 17, 1714–1726. [Google Scholar] [CrossRef]
- Bokhove, M.; Claessen, D.; de Jong, W.; Dijkhuizen, L.; Boekema, E.J.; Oostergetel, G.T. Chaplins of Streptomyces coelicolor self-assemble into two distinct functional amyloids. J. Struct. Biol. 2013, 184, 301–309. [Google Scholar] [CrossRef]
- Baker, S.P.; Nulton, T.J.; Kitten, T. Genomic, Phenotypic, and Virulence Analysis of Streptococcus sanguinis Oral and Infective-Endocarditis Isolates. Infect. Immun. 2019, 87, e00703-18. [Google Scholar] [CrossRef] [PubMed]
- Branda, S.S.; Chu, F.; Kearns, D.B.; Losick, R.; Kolter, R. A major protein component of the Bacillus subtilis biofilm matrix. Mol. Microbiol. 2006, 59, 1229–1238. [Google Scholar] [CrossRef]
- Serra, D.O.; Richter, A.M.; Hengge, R.; Stahlhut, S.G.; Chattopadhyay, S.; Kisiela, D.I.; Hvidtfeldt, K.; Clegg, S.; Struve, C.; Sokurenko, E.V.; et al. Cellulose as an Architectural Element in Spatially Structured Escherichia coli Biofilms. J. Bacteriol. 2013, 195, 5540–5554. [Google Scholar] [CrossRef]
- Gunn, J.S.; Bakaletz, L.O.; Wozniak, D.J. What’s on the Outside Matters: The Role of the Extracellular Polymeric Substance of Gram-Negative Biofilms in Evading Host Immunity and as a Target for Therapeutic Intervention. J. Biol. Chem. 2016, 291, 12538–12546. [Google Scholar] [CrossRef] [PubMed]
- Payne, D.E.; Boles, B.R. Emerging interactions between matrix components during biofilm development. Curr. Genet. 2016, 62, 137–141. [Google Scholar] [CrossRef]
- Ge, X.; Kitten, T.; Chen, Z.; Lee, S.P.; Munro, C.L.; Xu, P. Identification of Streptococcus sanguinis Genes Required for Biofilm Formation and Examination of Their Role in Endocarditis Virulence. Infect. Immun. 2008, 76, 2551–2559. [Google Scholar] [CrossRef] [PubMed]
- Lemos, J.A.; Palmer, S.R.; Zeng, L.; Wen, Z.T.; Kajfasz, J.K.; Freires, I.A.; Abranches, J.; Brady, L.J. The Biology of Streptococcus mutans. Microbiol Spectr. 2019, 7, 1–25. [Google Scholar] [CrossRef]
- Taylor, A.I.P.; Staniforth, R.A. General Principles Underpinning Amyloid Structure. Front. Neurosci. 2022, 16, 878869. [Google Scholar] [CrossRef]
- Evans, M.L.; Chapman, M.R. Curli biogenesis: Order out of disorder. Biochim. Biophys. Acta BBA Mol. Cell Res. 2014, 1843, 1551–1558. [Google Scholar] [CrossRef] [PubMed]
- Yarmola, E.; Yarmola, E.; Ishkov, I.P.; Ishkov, I.P.; di Cologna, N.M.; di Cologna, N.M.; Menashe, M.; Menashe, M.; Whitener, R.L.; Whitener, R.L.; et al. Amyloid Aggregates Are Localized to the Nonadherent Detached Fraction of Aging Streptococcus mutans Biofilms. Microbiol. Spectr. 2022, 10, e0166122. [Google Scholar] [CrossRef] [PubMed]
- Lévesque, C.M.; Voronejskaia, E.; Huang, Y.-C.C.; Mair, R.W.; Ellen, R.P.; Cvitkovitch, D.G. Involvement of Sortase Anchoring of Cell Wall Proteins in Biofilm Formation by Streptococcus mutans. Infect. Immun. 2005, 73, 3773–3777. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, L.; Messias, B.; Pereira-Neves, A.; Azevedo, E.P.; Araújo, J.; Foguel, D.; Palhano, F.L. Green Tea Polyphenol Microparticles Based on the Oxidative Coupling of EGCG Inhibit Amyloid Aggregation/Cytotoxicity and Serve as a Platform for Drug Delivery. ACS Biomater. Sci. Eng. 2020, 6, 4414–4423. [Google Scholar] [CrossRef] [PubMed]
- Stenvang, M.; Dueholm, M.S.; Vad, B.S.; Seviour, T.W.; Zeng, G.; Geifman-Shochat, S.; Søndergaard, M.T.; Christiansen, G.; Meyer, R.L.; Kjelleberg, S.; et al. Epigallocatechin Gallate Remodels Overexpressed Functional Amyloids in Pseudomonas aeruginosa and Increases Biofilm Susceptibility to Antibiotic Treatment. J. Biol. Chem. 2016, 291, 26540–26553. [Google Scholar] [CrossRef] [PubMed]
- Renzetti, A.; Betts, J.W.; Fukumoto, K.; Rutherford, R.N. Antibacterial green tea catechins from a molecular perspective: Mechanisms of action and structure–activity relationships. Food Funct. 2020, 11, 9370–9396. [Google Scholar] [CrossRef] [PubMed]
- Matilla-Cuenca, L.; Taglialegna, A.; Gil, C.; Toledo-Arana, A.; Lasa, I.; Valle, J. Bacterial biofilm functionalization through Bap amyloid engineering. NPJ Biofilms Microbiomes 2022, 8, 62. [Google Scholar] [CrossRef]
- Fernandes, L.; Cardim-Pires, T.R.; Foguel, D.; Palhano, F.L. Green Tea Polyphenol Epigallocatechin-Gallate in Amyloid Aggregation and Neurodegenerative Diseases. Front. Neurosci. 2021, 15, 718188. [Google Scholar] [CrossRef]
- DeBeer, F.; Baltz, M.; Holford, S.; Feinstein, A.; Pepys, M. Fibronectin and C4-binding protein are selectively bound by aggregated amyloid P component. J. Exp. Med. 1981, 154, 1134–1149. [Google Scholar] [CrossRef]
- Olsén, A.; Jonsson, A.; Normark, S. Fibronectin binding mediated by a novel class of surface organelles on Escherichia coll. Nature 1989, 338, 652–655. [Google Scholar] [CrossRef]
- Kibbey, M.C.; Jucker, M.; Weeks, B.S.; Neve, R.L.; E Van Nostrand, W.; Kleinman, H.K. β-Amyloid precursor protein binds to the neurite-promoting IKVAV site of laminin. Proc. Natl. Acad. Sci. USA 1993, 90, 10150–10153. [Google Scholar] [CrossRef]
- Sjöbring, U.; Pohl, G.; Olsén, A. Plasminogen, absorbed by Escherichia coli expressing curli or by Salmonella enteritidis expressing thin aggregative fimbriae, can be activated by simultaneously captured tissue-type plasminogen activator (t-PA). Mol. Microbiol. 1994, 14, 443–452. [Google Scholar] [CrossRef]
- Rahman, M.M.; Lendel, C. Extracellular protein components of amyloid plaques and their roles in Alzheimer’s disease pathology. Mol. Neurodegener. 2021, 16, 59. [Google Scholar] [CrossRef] [PubMed]
- A Tennent, G.; Lovat, L.B.; Pepys, M.B. Serum amyloid P component prevents proteolysis of the amyloid fibrils of Alzheimer disease and systemic amyloidosis. Proc. Natl. Acad. Sci. USA 1995, 92, 4299–4303. [Google Scholar] [CrossRef] [PubMed]
- Klotz, S.A.; Lipke, P.N. The Paradoxical Effects of Serum Amyloid-P Component on Disseminated Candidiasis. Pathogens 2022, 11, 1304. [Google Scholar] [CrossRef] [PubMed]
- Xi, D.; Luo, T.; Xiong, H.; Liu, J.; Lu, H.; Li, M.; Hou, Y.; Guo, Z. SAP: Structure, Function, and Its Roles in Immune-Related Diseases. Int. J. Cardiol. 2015, 187, 20–22. [Google Scholar] [CrossRef] [PubMed]
- Yuste, J.; Botto, M.; Bottoms, S.E.; Brown, J.S. Serum Amyloid P Aids Complement-Mediated Immunity to Streptococcus pneumoniae. PLoS Pathog. 2007, 3, 30120. [Google Scholar] [CrossRef] [PubMed]
- Doni, A.; Parente, R.; Laface, I.; Magrini, E.; Cunha, C.; Colombo, F.S.; Lacerda, J.F.; Campos, A.; Mapelli, S.N.; Petroni, F.; et al. Serum Amyloid P Component Is an Essential Element of Resistance against Aspergillus fumigatus. Nat. Commun. 2021, 12, 3739. [Google Scholar] [CrossRef]
- Alves, L.A.; Naveed, H.; Franco, E.M.; Garcia, M.T.; Freitas, V.A.; Junqueira, J.C.; Bastos, D.C.; Araujo, T.L.S.; Chen, T.; Mattos-Graner, R.O. PepO and CppA modulate Streptococcus sanguinis susceptibility to complement immunity and virulence. Virulence 2023, 14, 2239519. [Google Scholar] [CrossRef]
- Alves, L.A.; Ganguly, T.; Harth-Chú, É.N.; Kajfasz, J.; Lemos, J.A.; Abranches, J.; Mattos-Graner, R.O. PepO is a target of the two-component systems VicRK and CovR required for systemic virulence of Streptococcus mutans. Virulence 2020, 11, 521–536. [Google Scholar] [CrossRef]
- Honda-Ogawa, M.; Sumitomo, T.; Mori, Y.; Hamd, D.T.; Ogawa, T.; Yamaguchi, M.; Nakata, M.; Kawabata, S. Streptococcus pyogenes Endopeptidase O Contributes to Evasion from Complement-Mediated Bacteriolysis via Binding to Human Complement Factor C1q. J. Biol. Chem. 2017, 292, 4244–4254. [Google Scholar] [CrossRef]
- Agarwal, V.; Riesbeck, K.; Fulde, M.; Bergmann, S.; Blom, A. Streptococcus pneumoniae: Endopeptidase O (PepO): A Novel C1q Binding Complement Inhibitor. Mol. Immunol. 2013, 56, 243. [Google Scholar] [CrossRef]
- Chen, G.F.; Xu, T.H.; Yan, Y.; Zhou, Y.R.; Jiang, Y.; Melcher, K.; Xu, H.E. Amyloid beta: Structure, Biology and Structure-Based Therapeutic Development. Acta Pharmacol. Sin. 2017, 38, 1205–1235. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, M.; Terao, Y.; Ogawa, T.; Takahashi, T.; Hamada, S.; Kawabata, S. Role of Streptococcus sanguinis Sortase A in Bacterial Colonization. Microbes Infect. 2006, 8, 2791–2796. [Google Scholar] [CrossRef] [PubMed]
- De Bont, C.M.; Boelens, W.C.; Pruijn, G.J.M. NETosis, Complement, and Coagulation: A Triangular Relationship. Cell. Mol. Immunol. 2019, 16, 19–27. [Google Scholar] [CrossRef]
- Liu, X.; Wang, Y.; Bauer, A.T.; Kirschfink, M.; Ding, P.; Gebhardt, C.; Borsig, L.; Tüting, T.; Renné, T.; Häffner, K.; et al. Neutrophils Activated by Membrane Attack Complexes Increase the Permeability of Melanoma Blood Vessels. Proc. Natl. Acad. Sci. USA 2022, 119, e2122716119. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; You, D.; Cui, J.; Yang, L.; Lin, L.; Chen, Y.; Xu, C.; Lian, G.; Wan, J. Reduced Neutrophil Extracellular Trap Formation During Ischemia Reperfusion Injury in C3 KO Mice: C3 Requirement for NETs Release. Front. Immunol. 2022, 13, 781273. [Google Scholar] [CrossRef]
- Raz, A.; Tanasescu, A.-M.; Zhao, A.M.; Serrano, A.; Alston, T.; Sol, A.; Bachrach, G.; Fischetti, V.A. Streptococcus pyogenes Sortase Mutants Are Highly Susceptible to Killing by Host Factors Due to Aberrant Envelope Physiology. PLoS ONE 2015, 10, e0140784. [Google Scholar] [CrossRef]
- Kilian, M.; Mikkelsen, L.; Henrichsen, J. Taxonomic Study of Viridans Streptococci: Description of Streptococcus gordonii Sp. Nov. and Emended Descriptions of Streptococcus sanguis (White and Niven 1946), Streptococcus oralis (Bridge and Sneath 1982), and Streptococcus mitis (Andrewes and Horder 1906). Int. J. Syst. Bacteriol. 1989, 39, 471–484. [Google Scholar] [CrossRef]
- Abranches, J.; Miller, J.H.; Martinez, A.R.; Simpson-Haidaris, P.J.; Burne, R.A.; Lemos, J.A. The Collagen-Binding Protein Cnm Is Required for Streptococcus mutans Adherence to and Intracellular Invasion of Human Coronary Artery Endothelial Cells. Infect. Immun. 2011, 79, 2277–2284. [Google Scholar] [CrossRef]
- Biswas, I.; Drake, L.; Biswas, S. Regulation of gbpC Expression in Streptococcus mutans. J. Bacteriol. 2007, 189, 6521–6531. [Google Scholar] [CrossRef]
- Camargo, T.M.; Stipp, R.N.; Alves, L.A.; Harth-Chu, E.N.; Höfling, J.F.; Mattos-Graner, R.O. Novel Two-Component System of Streptococcus sanguinis Affecting Functions Associated with Viability in Saliva and Biofilm Formation. Infect. Immun. 2018, 86, e00942-17. [Google Scholar] [CrossRef]
- Macrina, F.L.; Tobian, J.A.; Jones, K.R.; Evans, R.; Clewell, D.B. A Cloning Vector Able to Replicate in Escherichia coli and Streptococcus sanguis. Gene 1982, 19, 345–353. [Google Scholar] [CrossRef] [PubMed]
- Dunny, G.M.; Lee, L.N.; LeBlanc, D.J. Improved Electroporation and Cloning Vector System for Gram-Positive Bacteria. Appl. Environ. Microbiol. 1991, 57, 1194–1201. [Google Scholar] [CrossRef]
- Harth-Chu, E.N.; Alves, L.A.; Theobaldo, J.D.; Salomão, M.F.; Höfling, J.F.; King, W.F.; Smith, D.J.; Mattos-Graner, R.O. PcsB Expression Diversity Influences on Streptococcus mitis Phenotypes Associated with Host Persistence and Virulence. Front. Microbiol. 2019, 10, 2567. [Google Scholar] [CrossRef] [PubMed]
- Negrini, T.; Duque, C.; Vizoto, N.; Stipp Mariano, F.; Höfling, J.; Graner, E.; Mattos-Graner, R. Influence of VicRK and CovR on the Interactions of Streptococcus mutans with Phagocytes. Oral Dis. 2012, 18, 485–493. [Google Scholar] [CrossRef] [PubMed]
Strain | Site of Isolation and/or Relevant Characteristics | Source or Reference |
---|---|---|
Streptococcus sanguinis | ||
SK36 | Dental biofilm | ATCC [6] |
SK49 † | Dental biofilm | Mogens Kilian [69] |
SK72 † | Dental biofilm | Mogens Kilian [69] |
SK115 † | Dental biofilm | Mogens Kilian [69] |
SK169 † | Dental biofilm | Mogens Kilian [69] |
SK330 † | Oral cavity | Mogens Kilian [69] |
SK353 † | Oral cavity | Mogens Kilian [69] |
SK678 † | Blood | Mogens Kilian [69] |
SK1056 † | Blood | Mogens Kilian [69] |
SKsrtA | ∆ssa_1219::Ermr | This study |
SKsrtA | ∆srtA::Ermr; pDL278: ssa_1219; Specr | This study |
Streptococcus mutans | ||
UA159 | Oral isolate, caries-affected Child; serotype c | ATCC |
OMZ175 †† | Dental plaque; serotype f; cnm † | J. Abranches [70] |
Primer Name | Sequence (Forward/Reverse) | Product Size (bp) |
---|---|---|
Mutant construction and complementation | ||
ermE1-AscI ermE2-XhoI | TTGGCGCGCCTGGCGGAAACGTAAAAGAAG TTCTCGAGGGCTCCTTGGAAGCTGTCAGT | 979 |
P1 srtA (SSA_1219P1) P2 srtA (SSA_1219P2-AscI) | CCTATCCAATTACGGCAAGA TTGGCGCGCCCAAGGCTCCTAAGGATGTTC | 1430 |
P3 srtA (SSA_1219P3-XhoI) P4 srtA (SSA_1219P4) | TTCTCGAGGGAAACCTTGCTGACCTGATA TCGCTGGTCTGATGACTGTT | 755 |
C1 srtA (SSA_1219C1-SacI) C2 srtA (SSA_1219-BamHI) | TTGAGCTCGCCCATAATCTGCTCTTTCTG TTGGATCCAAGGCTATGGTAAGCGAACT | 1529 |
RT-qPCR | ||
16s-RT-F 16s-RT-R | GGAAACTGTTTAACTTGAGTGCA GGCCTAACACCTAGCACTCA | 202 |
srtA-RT-F | TATCAATGCTCAGTGGAAAGC | 132 |
srtA-RT-R | TTTCATCGTACCAGCACCATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Franco, E.M.; Alves, L.A.; Naveed, H.; Freitas, V.A.A.; Bastos, D.C.; Mattos-Graner, R.O. Amyloid Fibrils Produced by Streptococcus sanguinis Contribute to Biofilm Formation and Immune Evasion. Int. J. Mol. Sci. 2023, 24, 15686. https://doi.org/10.3390/ijms242115686
Franco EM, Alves LA, Naveed H, Freitas VAA, Bastos DC, Mattos-Graner RO. Amyloid Fibrils Produced by Streptococcus sanguinis Contribute to Biofilm Formation and Immune Evasion. International Journal of Molecular Sciences. 2023; 24(21):15686. https://doi.org/10.3390/ijms242115686
Chicago/Turabian StyleFranco, Eduardo M., Lívia A. Alves, Hassan Naveed, Victor A. A. Freitas, Débora C. Bastos, and Renata O. Mattos-Graner. 2023. "Amyloid Fibrils Produced by Streptococcus sanguinis Contribute to Biofilm Formation and Immune Evasion" International Journal of Molecular Sciences 24, no. 21: 15686. https://doi.org/10.3390/ijms242115686
APA StyleFranco, E. M., Alves, L. A., Naveed, H., Freitas, V. A. A., Bastos, D. C., & Mattos-Graner, R. O. (2023). Amyloid Fibrils Produced by Streptococcus sanguinis Contribute to Biofilm Formation and Immune Evasion. International Journal of Molecular Sciences, 24(21), 15686. https://doi.org/10.3390/ijms242115686