Regulation of PGC-1α of the Mitochondrial Energy Metabolism Pathway in the Gills of Indian Medaka (Oryzias dancena) under Hypothermal Stress
Abstract
:1. Introduction
2. Results
2.1. ATP Content
2.2. Differential mRNA Expression of Related Genes between FW and SW Medaka Gills under Cold-Stress (18 °C) Environments
2.3. The Hierarchical Cluster Analysis of the Cold-Stress Groups
2.4. Differential mRNA Expression of Related Genes between FW and SW Medaka under Cold-Tolerance (15 °C) Environments
2.5. The Hierarchical Cluster Analysis of the Cold-Tolerance Groups
3. Discussion
4. Material and Methods
4.1. Experimental Fish and Environments
4.2. Determination of Cellular ATP Content in Fish Gills
4.3. Preparation of Total RNA Samples from Fish Gills
4.4. The cDNA (Complementary DNA) Preparation and qPCR Analysis
4.5. Statistical Analysis
4.6. Hierarchical Clustering Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Wright, R.K.; Cooper, E.L. Temperature effects on ectotherm immune responses. Dev. Comp. Immunol. 1981, 5, 117–122. [Google Scholar] [CrossRef]
- Scharsack, J.P.; Franke, F. Temperature effects on teleost immunity in the light of climate change. J. Fish Biol. 2022, 101, 780–796. [Google Scholar] [CrossRef]
- Brett, J.R.; Shelbourn, J.E.; Shoop, C.T. Growth Rate and Body Composition of Fingerling Sockeye Salmon, Oncorhynchus nerka, in relation to Temperature and Ration Size. J. Fish. Res. Board Can. 1969, 26, 2363–2394. [Google Scholar] [CrossRef]
- Brett, J.R. Energetic responses of salmon to temperature. A study of some thermal relations in the physiology and freshwater ecology of sockeye salmon (Oncorhynchus nerkd). Am. Zool. 1971, 11, 99–113. [Google Scholar] [CrossRef]
- Handeland, S.O.; Imsland, A.K.; Stefansson, S.O. The effect of temperature and fish size on growth, feed intake, food conversion efficiency and stomach evacuation rate of Atlantic salmon post-smolts. Aquaculture 2008, 283, 36–42. [Google Scholar] [CrossRef]
- Dadras, H.; Dzyuba, B.; Cosson, J.; Golpour, A.; Siddique, M.A.M.; Linhart, O. Effect of water temperature on the physiology of fish spermatozoon function: A brief review. Aquac. Res. 2016, 48, 729–740. [Google Scholar] [CrossRef]
- Guillen, A.C.; Borges, M.E.; Herrerias, T.; Kandalski, P.K.; Marins, E.d.A.; Viana, D.; de Souza, M.R.D.P.; Daloski, L.O.D.C.; Donatti, L. Effect of gradual temperature increase on the carbohydrate energy metabolism responses of the Antarctic fish Notothenia rossii. Mar. Environ. Res. 2019, 150, 104779. [Google Scholar] [CrossRef] [PubMed]
- Orioles, M.; Galeotti, M.; Saccà, E.; Bulfoni, M.; Corazzin, M.; Bianchi, S.; Torge, D.; Macchiarelli, G.; Magi, G.E.; Schmidt, J.G. Effect of temperature on transfer of Midichloria-like organism and development of red mark syndrome in rainbow trout (Oncorhynchus mykiss). Aquaculture 2022, 560, 738577. [Google Scholar] [CrossRef]
- Basu, N.; Todgham, A.; Ackerman, P.; Bibeau, M.; Nakano, K.; Schulte, P.; Iwama, G.K. Heat shock protein genes and their functional significance in fish. Gene 2002, 295, 173–183. [Google Scholar] [CrossRef]
- Fernandes, T.; McMeans, B.C. Coping with the cold: Energy storage strategies for surviving winter in freshwater fish. Ecography 2019, 42, 2037–2052. [Google Scholar] [CrossRef]
- Chang, C.-H.; Lin, J.-Y.; Lo, W.-Y.; Lee, T.-H. Hypothermal stress induced differential expression profiles of the immune response gene, warm-temperature-acclimation associated 65-kDa protein (Wap65), in the liver of fresh water and seawater milkfish, Chanos chanos. Fish Shellfish Immunol. 2017, 70, 174–184. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.-H.; Mayer, M.; Rivera-Ingraham, G.; Blondeau-Bidet, E.; Wu, W.-Y.; Lorin-Nebel, C.; Lee, T.-H. Effects of temperature and salinity on antioxidant responses in livers of temperate (Dicentrarchus labrax) and tropical (Chanos Chanos) marine euryhaline fish. J. Therm. Biol. 2021, 99, 103016. [Google Scholar] [CrossRef]
- Song, H.; Xu, D.; Tian, L.; Chen, R.; Wang, L.; Tan, P.; You, Q. Overwinter mortality in yellow drum (Nibea albiflora): Insights from growth and immune responses to cold and starvation stress. Fish Shellfish Immunol. 2019, 92, 341–347. [Google Scholar] [CrossRef] [PubMed]
- Kang, C.-K.; Chen, Y.-C.; Chang, C.-H.; Tsai, S.-C.; Lee, T.-H. Seawater-acclimation abates cold effects on Na+, K+-ATPase activity in gills of the juvenile milkfish, Chanos chanos. Aquaculture 2015, 446, 67–73. [Google Scholar] [CrossRef]
- Saber, T.H. Histological Adaptation to Thermal Changes in Gills of Common Carp Fishes Cyprinus carpio L. Rafidain J. Sci. 2011, 22, 46–55. [Google Scholar] [CrossRef]
- Rombough, P. The gill of fish larvae. Is it primarily a respiratory or an ionoregulatory structure? J. Fish Biol. 1999, 55, 186–204. [Google Scholar] [CrossRef]
- Curcio, V.; Macirella, R.; Sesti, S.; Ahmed, A.I.M.; Talarico, F.; Tagarelli, A.; Mezzasalma, M.; Brunelli, E. Morphological and Functional Alterations Induced by Two Ecologically Relevant Concentrations of Lead on Danio rerio Gills. Int. J. Mol. Sci. 2022, 23, 9165. [Google Scholar] [CrossRef]
- Awal, A.; Kuri, K.C.; Sarker, S. Effect of salinity on the oxygen consumption of Tilapia fingerlings. Daffodil Int. Univ. J. Sci. Technol. 1970, 7, 12–14. [Google Scholar] [CrossRef]
- Qin, H.; Yu, Z.; Zhu, Z.; Lin, Y.; Xia, J.; Jia, Y. The integrated analyses of metabolomics and transcriptomics in gill of GIFT tilapia in response to long term salinity challenge. Aquac. Fish. 2021, 7, 131–139. [Google Scholar] [CrossRef]
- Benedicenti, O.; Pottinger, T.G.; Collins, C.; Secombes, C.J. Effects of temperature on amoebic gill disease development: Does it play a role? J. Fish Dis. 2019, 42, 1241–1258. [Google Scholar] [CrossRef] [PubMed]
- Gibbons, T.C.; McBryan, T.L.; Schulte, P.M. Interactive effects of salinity and temperature acclimation on gill morphology and gene expression in threespine stickleback. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2018, 221, 55–62. [Google Scholar] [CrossRef]
- Nilsson, G.E.; Dymowska, A.; Stecyk, J.A. New insights into the plasticity of gill structure. Respir. Physiol. Neurobiol. 2012, 184, 214–222. [Google Scholar] [CrossRef] [PubMed]
- Arjona, F.J.; Vargas-Chacoff, L.; Ruiz-Jarabo, I.; del Río, M.P.M.; Mancera, J.M. Osmoregulatory response of Senegalese sole (Solea senegalensis) to changes in environmental salinity. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2007, 148, 413–421. [Google Scholar] [CrossRef] [PubMed]
- Sangiao-Alvarellos, S.; Arjona, F.J.; del Río, M.P.M.; Míguez, J.M.; Mancera, J.M.; Soengas, J.L. Time course of osmoregulatory and metabolic changes during osmotic acclimation in Sparus auratus. J. Exp. Biol. 2005, 208, 4291–4304. [Google Scholar] [CrossRef] [PubMed]
- Edwards, S.L.; Marshall, W.S. Principles and patterns of osmoregulation and euryhalinity in fishes. In Euryhaline Fishes, 1st ed.; McCormick, S.D., Farrell, A.P., Brauner, C.J., Eds.; Academic: Oxford, UK, 2013; Volume 32, pp. 1–44. [Google Scholar]
- Tseng, Y.-C.; Huang, C.-J.; Chang, J.C.-H.; Teng, W.-Y.; Baba, O.; Fann, M.-J.; Hwang, P.-P. Glycogen phosphorylase in glycogen-rich cells is involved in the energy supply for ion regulation in fish gill epithelia. Am. J. Physiol. Integr. Comp. Physiol. 2007, 293, R482–R491. [Google Scholar] [CrossRef]
- Weng, C.-F.; Chiang, C.-C.; Gong, H.-Y.; Chen, M.H.-C.; Lin, C.J.-F.; Huang, W.-T.; Cheng, C.-Y.; Hwang, P.-P.; Wu, J.-L. Acute changes in gill Na+-K+-ATPase and creatine kinase in response to salinity changes in the euryhaline teleost, tilapia (Oreochromis mossambicus). Physiol. Biochem. Zool. 2002, 75, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Leguen, I. Gills of the medaka (Oryzias latipes): A scanning electron microscopy study. J. Morphol. 2017, 279, 97–108. [Google Scholar] [CrossRef] [PubMed]
- Tseng, Y.-C.; Hwang, P.-P. Some insights into energy metabolism for osmoregulation in fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2008, 148, 419–429. [Google Scholar] [CrossRef]
- Cong, M.; Wu, H.; Cao, T.; Ji, C.; Lv, J. Effects of ammonia nitrogen on gill mitochondria in clam Ruditapes philippinarum. Environ. Toxicol. Pharmacol. 2018, 65, 46–52. [Google Scholar] [CrossRef]
- Wang, Z.; Yang, Z.; Liu, J.; Hao, Y.; Sun, B.; Wang, J. Potential Health Benefits of Whole Grains: Modulation of Mitochondrial Biogenesis and Energy Metabolism. J. Agric. Food Chem. 2021, 69, 14065–14074. [Google Scholar] [CrossRef]
- Palikaras, K.; Lionaki, E.; Tavernarakis, N. Balancing mitochondrial biogenesis and mitophagy to maintain energy metabolism homeostasis. Cell Death Differ. 2015, 22, 1399–1401. [Google Scholar] [CrossRef] [PubMed]
- LeMoine, C.M.R.; Genge, C.E.; Moyes, C.D. Role of the PGC-1 family in the metabolic adaptation of goldfish to diet and temperature. J. Exp. Biol. 2008, 211, 1448–1455. [Google Scholar] [CrossRef] [PubMed]
- Orczewska, J.I.; Hartleben, G.; O’Brien, K.M. The molecular basis of aerobic metabolic remodeling differs between oxidative muscle and liver of threespine sticklebacks in response to cold acclimation. Am. J. Physiol. Integr. Comp. Physiol. 2010, 299, R352–R364. [Google Scholar] [CrossRef] [PubMed]
- Arany, Z.; Novikov, M.; Chin, S.; Ma, Y.; Rosenzweig, A.; Spiegelman, B.M. Transverse aortic constriction leads to accelerated heart failure in mice lacking PPAR-gamma coactivator 1alpha. Proc. Natl. Acad. Sci. USA 2006, 103, 10086–10091. [Google Scholar] [CrossRef]
- Rossignoli, C.P.; Dechandt, C.R.; Souza, A.O.; Sampaio, I.H.; Vicentini, T.M.; Teodoro, B.G.; Neto, M.P.C.; Ferrari, G.D.; Couto-Lima, C.A.; Alberici, L.C. Effects of intermittent dietary supplementation with conjugated linoleic acid and fish oil (EPA/DHA) on body metabolism and mitochondrial energetics in mice. J. Nutr. Biochem. 2018, 60, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Northam, C.; LeMoine, C.M. Metabolic regulation by the PGC-1α and PGC-1β coactivators in larval zebrafish (Danio rerio). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2019, 234, 60–67. [Google Scholar] [CrossRef]
- Sun, Z.; Tan, X.; Liu, Q.; Ye, H.; Zou, C.; Xu, M.; Zhang, Y.; Ye, C. Physiological, immune responses and liver lipid metabolism of orange-spotted grouper (Epinephelus coioides) under cold stress. Aquaculture 2018, 498, 545–555. [Google Scholar] [CrossRef]
- Handschin, C.; Spiegelman, B.M. Peroxisome proliferator-activated receptor γ coactivator 1 coactivators, energy homeostasis, and metabolism. Endoc. Rev. 2006, 27, 728–735. [Google Scholar] [CrossRef] [PubMed]
- Kelly, D.P.; Scarpulla, R.C. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev. 2004, 18, 357–368. [Google Scholar] [CrossRef]
- Kong, S.; Cai, B.; Nie, Q. PGC-1α affects skeletal muscle and adipose tissue development by regulating mitochondrial biogenesis. Mol. Genet. Genom. 2022, 297, 621–633. [Google Scholar] [CrossRef] [PubMed]
- Fuentes, E.N.; Safian, D.; Einarsdottir, I.E.; Valdés, J.A.; Elorza, A.A.; Molina, A.; Björnsson, B.T. Nutritional status modulates plasma leptin, AMPK and TOR activation, and mitochondrial biogenesis: Implications for cell metabolism and growth in skeletal muscle of the fine flounder. Gen. Comp. Endocrinol. 2013, 186, 172–180. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.; Policar, T.; Song, X.; Rahimnejad, S. Molecular Characterization of PGC-1β (PPAR Gamma Coactivator 1β) and its Roles in Mitochondrial Biogenesis in Blunt Snout Bream (Megalobrama amblycephala). Int. J. Mol. Sci. 2020, 21, 1935. [Google Scholar] [CrossRef] [PubMed]
- Bremer, K.; Moyes, C.D. Origins of variation in muscle cytochrome c oxidase activity within and between fish species. J. Exp. Biol. 2011, 214, 1888–1895. [Google Scholar] [CrossRef] [PubMed]
- Philp, A.; Belew, M.Y.; Evans, A.; Pham, D.; Sivia, I.; Chen, A.; Schenk, S.; Baar, K.; Ballmann, C.; Tang, Y.; et al. The PGC-1α-related coactivator promotes mitochondrial and myogenic adaptations in C2C12 myotubes. Am. J. Physiol. Integr. Comp. Physiol. 2011, 301, R864–R872. [Google Scholar] [CrossRef] [PubMed]
- Scarpulla, R.C. Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochim. Biophys. Acta 2011, 1813, 1269–1278. [Google Scholar] [CrossRef]
- Vercauteren, K.; Gleyzer, N.; Scarpulla, R.C. PGC-1-related Coactivator Complexes with HCF-1 and NRF-2β in Mediating NRF-2(GABP)-dependent Respiratory Gene Expression. J. Biol. Chem. 2008, 283, 12102–12111. [Google Scholar] [CrossRef] [PubMed]
- Bermejo-Nogales, A.; Nederlof, M.; Benedito-Palos, L.; Ballester-Lozano, G.F.; Folkedal, O.; Olsen, R.E.; Sitjà-Bobadilla, A.; Pérez-Sánchez, J. Metabolic and transcriptional responses of gilthead sea bream (Sparus aurata L.) to environmental stress: New insights in fish mitochondrial phenotyping. Gen. Comp. Endocrinol. 2014, 205, 305–315. [Google Scholar] [CrossRef]
- Hogstrand, C.; Xu, Y.-C.; Zhao, T.; Zheng, H.; Luo, Z. Environmentally relevant concentrations of oxytetracycline and copper increased liver lipid deposition through inducing oxidative stress and mitochondria dysfunction in grass carp Ctenopharyngodon idella. Environ. Pollut. 2021, 283, 117079. [Google Scholar] [CrossRef]
- Diebold, I.; Hennigs, J.K.; Miyagawa, K.; Li, C.G.; Nickel, N.P.; Kaschwich, M.; Cao, A.; Wang, L.; Reddy, S.; Chen, P.-I.; et al. BMPR2 Preserves Mitochondrial Function and DNA during Reoxygenation to Promote Endothelial Cell Survival and Reverse Pulmonary Hypertension. Cell Metab. 2015, 21, 596–608. [Google Scholar] [CrossRef]
- Hayes, J.D.; Ebisine, K.; Sharma, R.S.; Chowdhry, S.; Dinkova-Kostova, A.T.; Sutherland, C. Regulation of the CNC-bZIP transcription factor Nrf2 by Keap1 and the axis between GSK-3 and β-TrCP. Curr. Opin. Toxicol. 2016, 1, 92–103. [Google Scholar] [CrossRef]
- McMahon, M.; Itoh, K.; Yamamoto, M.; Hayes, J.D. Keap1-dependent proteasomal degradation of transcription factor Nrf2 contributes to the negative regulation of antioxidant response element-driven gene expression. J. Biol. Chem. 2003, 278, 21592–21600. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Wang, H.; Hu, B.; Chen, X.; Zheng, M.; Liang, L.; Lyu, J.; Zeng, Q. Erratum—Transcription factor nuclear factor erythroid 2 p45-related factor 2 (NRF2) ameliorates sepsis-associated acute kidney injury by maintaining mitochondrial homeostasis and improving the mitochondrial function. Eur. J. Histochem. 2023, 67, 3794. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.L.; Wu, C.-W.; Chao, Y.-M.; Hung, C.-Y.; Chan, J.Y. Impaired Nrf2 regulation of mitochondrial biogenesis in rostral ventrolateral medulla on hypertension induced by systemic inflammation. Free. Radic. Biol. Med. 2016, 97, 58–74. [Google Scholar] [CrossRef] [PubMed]
- Suliman, H.B.; Carraway, M.S.; Tatro, L.G.; Piantadosi, C.A. A new activating role for CO in cardiac mitochondrial biogenesis. J. Cell Sci. 2007, 120, 299–308. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Cheng, C.-H.C.; Zhang, J.; Cao, L.; Chen, L.; Zhou, L.; Jin, Y.; Ye, H.; Deng, C.; Dai, Z.; et al. Transcriptomic and genomic evolution under constant cold in Antarctic notothenioid fish. Proc. Natl. Acad. Sci. USA 2008, 105, 12944–12949. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Wang, H.; Ge, J.; Li, L.; Luo, J.; He, K.; Yan, H.; Zhang, X.; Tahir, R.; Luo, W.; et al. Chronic hypoxia and Cu2+ exposure induce gill remodeling of largemouth bass through endoplasmic reticulum stress, mitochondrial damage and apoptosis. Aquat. Toxicol. 2023, 255, 106373. [Google Scholar] [CrossRef] [PubMed]
- Otten, A.B.C.; Kamps, R.; Lindsey, P.; Gerards, M.; Pendeville-Samain, H.; Muller, M.; van Tienen, F.H.J.; Smeets, H.J.M. Tfam knockdown results in reduction of mtDNA copy number, OXPHOS deficiency and abnormalities in zebrafish embryos. Front. Cell Dev. Biol. 2020, 8, 381. [Google Scholar] [CrossRef]
- Ishii, K.; Kobayashi, H.; Taguchi, K.; Guan, N.; Li, A.; Tong, C.; Davidoff, O.; Tran, P.V.; Sharma, M.; Chandel, N.S.; et al. Kidney epithelial targeted mitochondrial transcription factor A deficiency results in progressive mitochondrial depletion associated with severe cystic disease. Kidney Int. 2020, 99, 657–670. [Google Scholar] [CrossRef] [PubMed]
- Broughton, R.E.; Milam, J.E.; Roe, B.A. The Complete Sequence of the Zebrafish (Danio rerio) Mitochondrial genome and evolutionary patterns in vertebrate mitochondrial DNA. Genome Res. 2001, 11, 1958–1967. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.-H.; Yeh, T.-F.; Wei, H.-W.; Liu, I.-H. Temperature-induced embryonic diapause in blue-breasted quail (Coturnix chinensis) correlates with decreased mitochondrial-respiratory network and increased stress-response network. Poult. Sci. 2019, 98, 2977–2988. [Google Scholar] [CrossRef]
- Li, A.J.; Leung, P.T.; Bao, V.W.; Lui, G.C.; Leung, K.M. Temperature-dependent physiological and biochemical responses of the marine medaka Oryzias melastigma with consideration of both low and high thermal extremes. J. Therm. Biol. 2015, 54, 98–105. [Google Scholar] [CrossRef] [PubMed]
- Ranasinghe, N.; Lin, C.-H.; Lee, T.-H. Cholesterol Accumulation in Livers of Indian Medaka, Oryzias dancena, Acclimated to Fresh Water and Seawater. Front. Mar. Sci. 2022, 9, 891706. [Google Scholar] [CrossRef]
- Ranasinghe, N.; Lin, C.-H.; Lee, T.-H. Salinity and Temperature Effects on Cholesterol Accumulation through SIRT1/LXRα/SREBP1 Pathway in Livers of the Indian Medaka (Oryzias dancena). FASEB J. 2021, 35, S1. [Google Scholar] [CrossRef]
- Kim, B.-M.; Kim, J.; Choi, I.-Y.; Raisuddin, S.; Au, D.W.; Leung, K.M.; Wu, R.S.; Rhee, J.-S.; Lee, J.-S. Omics of the marine medaka (Oryzias melastigma) and its relevance to marine environmental research. Mar. Environ. Res. 2015, 113, 141–152. [Google Scholar] [CrossRef] [PubMed]
- Jackson, S.E. Hsp90: Structure and Function. In Molecular Chaperones; Springer: Berlin/Heidelberg, Germany, 2012; Volume 328, pp. 155–240. [Google Scholar] [CrossRef]
- Debnath, D.; Pal, A.; Sahu, N.; Baruah, K.; Yengkokpam, S.; Das, T.; Manush, S. Thermal tolerance and metabolic activity of yellowtail catfish Pangasius pangasius (Hamilton) advanced fingerlings with emphasis on their culture potential. Aquaculture 2006, 258, 606–610. [Google Scholar] [CrossRef]
- Sarma, K.; Pal, A.K.; Ayyappan, S.; Das, T.; Manush, S.M.; Debnath, D.; Baruah, K. Acclimation of Anabas testudineus (Bloch) to three test temperatures influences thermal tolerance and oxygen consumption. Fish Physiol. Biochem. 2008, 36, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Islam, J.; Kunzmann, A.; Bögner, M.; Meyer, A.; Thiele, R.; Slater, M.J. Metabolic and molecular stress responses of European seabass, Dicentrarchus labrax at low and high temperature extremes. Ecol. Indic. 2020, 112, 106118. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, D.L.; Yu, D.H.; Lv, C.H.; Luo, H.Y.; Wang, Z.Y. Molecular cloning and expression analysis of scd1 gene from large yellow croaker Larimichthys crocea under cold stress. Gene 2015, 568, 100–108. [Google Scholar] [CrossRef] [PubMed]
- Long, Y.; Song, G.; Yan, J.; He, X.; Li, Q.; Cui, Z. Transcriptomic characterization of cold acclimation in larval zebrafish. BMC Genom. 2013, 14, 612. [Google Scholar] [CrossRef]
- Herbing, I.H.v. Effects of temperature on larval fish swimming performance: The importance of physics to physiology. J. Fish Biol. 2002, 61, 865–876. [Google Scholar] [CrossRef]
- Guderley, H.; Johnston, I.A. Plasticity of Fish Muscle Mitochondria with Thermal Acclimation. J. Exp. Biol. 1996, 199, 1311–1317. [Google Scholar] [CrossRef]
- Clarke, A.; Johnston, N.M. Scaling of metabolic rate with body mass and temperature in teleost fish. J. Anim. Ecol. 1999, 68, 893–905. [Google Scholar] [CrossRef]
- Kennedy, B.E.; Madreiter, C.T.; Vishnu, N.; Malli, R.; Graier, W.F.; Karten, B. Adaptations of Energy Metabolism Associated with Increased Levels of Mitochondrial Cholesterol in Niemann-Pick Type C1-deficient Cells. J. Biol. Chem. 2014, 289, 16278–16289. [Google Scholar] [CrossRef]
- Wen, B.; Jin, S.-R.; Chen, Z.-Z.; Gao, J.-Z.; Wang, L.; Liu, Y.; Liu, H.-P. Plasticity of energy reserves and metabolic performance of discus fish (Symphysodon aequifasciatus) exposed to low-temperature stress. Aquaculture 2017, 481, 169–176. [Google Scholar] [CrossRef]
- Wen, B.; Jin, S.-R.; Chen, Z.-Z.; Gao, J.-Z. Physiological responses to cold stress in the gills of discus fish (Symphysodon aequifasciatus) revealed by conventional biochemical assays and GC-TOF-MS metabolomics. Sci. Total. Environ. 2018, 640–641, 1372–1381. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Liang, H.; Zhu, J.; Ren, M.; Ge, X. Transcriptome reveals insights into hepatic nutritional metabolism and gill immune responses adapted to cold stress in genetically improved farmed tilapia (GIFT: Oreochromis niloticus). Aquac. Rep. 2022, 26, 101297. [Google Scholar] [CrossRef]
- Schleger, I.C.; Pereira, D.M.C.; Resende, A.C.; Romão, S.; Herrerias, T.; Neundorf, A.K.A.; Sloty, A.M.; Guimarães, I.M.; de Souza, M.R.D.P.; Carster, G.P.; et al. Cold and warm waters: Energy metabolism and antioxidant defenses of the freshwater fish Astyanax lacustris (Characiformes: Characidae) under thermal stress. J. Comp. Physiol. B 2021, 192, 77–94. [Google Scholar] [CrossRef] [PubMed]
- Bœuf, G.; Payan, P. How should salinity influence fish growth? Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2001, 130, 411–423. [Google Scholar] [CrossRef]
- Xiong, Y.; Huang, M.; Zhou, Y.; Chen, X.; Yang, J.; Wang, F.; Dong, S. Growth, osmoregulation and energy budget of rainbow and steelhead trout under different salinity acclimation methods and the best transition size of steelhead trout. Aquac. Res. 2020, 51, 2369–2378. [Google Scholar] [CrossRef]
- Chang, C.-H.; Huang, J.-J.; Yeh, C.-Y.; Tang, C.-H.; Hwang, L.-Y.; Lee, T.-H. Salinity Effects on strategies of glycogen utilization in livers of euryhaline milkfish (Chanos chanos) under hypothermal stress. Front. Physiol. 2018, 9, 81. [Google Scholar] [CrossRef]
- Chang, C.-H.; Liu, C.-J.; Lu, W.-J.; Wu, L.-Y.; Lai, K.-J.; Lin, Y.-T.; Lee, T.-H. Hypothermal effects on energy supply for Ionocytes in gills of freshwater- and seawater-acclimated milkfish, Chanos chanos. Front. Mar. Sci. 2022, 9, 880103. [Google Scholar] [CrossRef]
- O’Brien, K.M. Mitochondrial biogenesis in cold-bodied fishes. J. Exp. Biol. 2011, 214, 275–285. [Google Scholar] [CrossRef] [PubMed]
- Bremer, K.; Kocha, K.; Snider, T.; Moyes, C. Sensing and responding to energetic stress: The role of the AMPK-PGC1α-NRF1 axis in control of mitochondrial biogenesis in fish. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2016, 199, 4–12. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Handschin, C.; Spiegelman, B.M. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab. 2005, 1, 361–370. [Google Scholar] [CrossRef]
- Suzuki, S.; Awai, K.; Ishihara, A.; Yamauchi, K. Cold temperature blocks thyroid hormone-induced changes in lipid and energy metabolism in the liver of Lithobates catesbeianus tadpoles. Cell Biosci. 2016, 6, 1–16. [Google Scholar] [CrossRef]
- Han, S.; Wei, S.; Chen, R.; Ni, M.; Chen, L. Tissue-Specific and Differential Cold Responses in the Domesticated Cold Tolerant Fugu. Fishes 2022, 7, 159. [Google Scholar] [CrossRef]
- Savagner, F.; Mirebeau, D.; Jacques, C.; Guyetant, S.; Morgan, C.; Franc, B.; Reynier, P.; Malthièry, Y. PGC-1-related coactivator and targets are upregulated in thyroid oncocytoma. Biochem. Biophys. Res. Commun. 2003, 310, 779–784. [Google Scholar] [CrossRef]
- Finck, B.N.; Kelly, D.P. PGC-1 coactivators: Inducible regulators of energy metabolism in health and disease. J. Clin. Investig. 2006, 116, 615–622. [Google Scholar] [CrossRef]
- Scarpulla, R.C.; Liu, R.; Jagannathan, R.; Sun, L.; Li, F.; Yang, P.; Lee, J.; Negi, V.; Perez-Garcia, E.M.; Shiva, S.; et al. Transcriptional Paradigms in Mammalian Mitochondrial Biogenesis and Function. Physiol. Rev. 2008, 88, 611–638. [Google Scholar] [CrossRef]
- Wu, P.; Chen, L.; Cheng, J.; Pan, Y.; Guo, X.; Chu, W.; Zhang, J.; Liu, X. MiRNAs-modulation of Nrf2 signaling networks in regulation oxidative stress of Chinese perch skeletal muscle after fasting treatment. Mar. Biotechnol. 2020, 22, 620–630. [Google Scholar] [CrossRef]
- Jiang, Z.; Li, X.; Dong, C. Effect of Feed Supplementation with Bacillus coagulans on Nrf Gene Family Expression in Common Carp (Cyprinus carpio) under Long-Term Exposure to Cd2+. Fishes 2022, 7, 48. [Google Scholar] [CrossRef]
- Coppi, L.; Ligorio, S.; Mitro, N.; Caruso, D.; De Fabiani, E.; Crestani, M. PGC1s and beyond: Disentangling the complex regulation of mitochondrial and cellular metabolism. Int. J. Mol. Sci. 2021, 22, 6913. [Google Scholar] [CrossRef]
- Larsson, N.-G.; Wang, J.; Wilhelmsson, H.; Oldfors, A.; Rustin, P.; Lewandoski, M.; Barsh, G.S.; Clayton, D.A. Mitochondrial transcription factor A is necessary for mtDNA maintance and embryogenesis in mice. Nat. Genet. 1998, 18, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Goto, A.; Matsushima, Y.; Kadowaki, T.; Kitagawa, Y. Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. Biochem. J. 2001, 354, 243–248. [Google Scholar] [CrossRef]
- Yang, J.; Grunsky, E.; Cheng, Q. A novel hierarchical clustering analysis method based on Kullback–Leibler divergence and application on dalaimiao geochemical exploration data. Comput. Geosci. 2018, 123, 10–19. [Google Scholar] [CrossRef]
- Inoue, L.A.K.A.; Moraes, G.; Iwama, G.K.; Afonso, L.O.B. Physiological stress responses in the warm-water fish matrinxã (Brycon amazonicus ) subjected to a sudden cold shock. Acta Amaz. 2008, 38, 603–609. [Google Scholar] [CrossRef]
- Liu, B.; Wang, M.; Xie, J.; Xu, P.; Ge, X.; He, Y.; Pan, L. Effects of acute cold stress on serum biochemical and immune parameters and liver HSP70 gene expression in GIFT strain of Nile tilapia (Oreochromis niloticus). Acta Ecol. Sin. 2011, 31, 4866–4873. [Google Scholar]
- Islam, H.; Edgett, B.A.; Gurd, B.J. Coordination of mitochondrial biogenesis by PGC-1α in human skeletal muscle: A re-evaluation. Metabolism 2018, 79, 42–51. [Google Scholar] [CrossRef]
- Pörtner, H.O.; Langenbuch, M.; Michaelidis, B. Synergistic effects of temperature extremes, hypoxia, and increases in CO2 on marine animals: From earth history to global change. J. Geophys. Res. Oceans 2005, 110, C9. [Google Scholar] [CrossRef]
- Pörtner, H.; Mark, F.; Bock, C. Oxygen limited thermal tolerance in fish?: Answers obtained by nuclear magnetic resonance techniques. Respir. Physiol. Neurobiol. 2004, 141, 243–260. [Google Scholar] [CrossRef]
- Pörtner, H.O.; Peck, M.A. Climate change effects on fishes and fisheries: Towards a cause-and-effect understanding. J. Fish Biol. 2010, 77, 1745–1779. [Google Scholar] [CrossRef] [PubMed]
- Andrade, D.V.; Gavira, R.S.B.; Tattersall, G.J. Thermogenesis in ectothermic vertebrates. Temperature 2015, 2, 454. [Google Scholar] [CrossRef]
- Kyprianou, T.-D.; Pörtner, H.O.; Anestis, A.; Kostoglou, B.; Feidantsis, K.; Michaelidis, B. Metabolic and molecular stress responses of gilthead seam bream Sparus aurata during exposure to low ambient temperature: An analysis of mechanisms underlying the winter syndrome. J. Comp. Physiol. B 2010, 180, 1005–1018. [Google Scholar] [CrossRef] [PubMed]
- Mendonça, P.C.; Gamperl, A.K. The effects of acute changes in temperature and oxygen availability on cardiac performance in winter flounder (Pseudopleuronectes americanus). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2010, 155, 245–252. [Google Scholar] [CrossRef] [PubMed]
- Pörtner, H.-O. Oxygen- and capacity-limitation of thermal tolerance: A matrix for integrating climate-related stressor effects in marine ecosystems. J. Exp. Biol. 2010, 213, 881–893. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Bromage, T.G.; Zhao, Q.; Xu, B.H.; Gao, W.L.; Tian, H.F.; Tang, H.J.; Liu, D.W.; Zhao, X.Q. Functional evolution of leptin of ochotona curzoniae in adaptive thermogenesis driven by cold environmental stress. PLoS ONE 2011, 6, e19833. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Jin, D.; Zhang, Y.; Wright, W.; Bazuine, M.; Brockman, D.A.; Bernlohr, D.A.; Chen, X. lipocalin-2 deficiency impairs thermogenesis and potentiates diet-Induced insulin resistance in mice. Diabetes 2010, 59, 1376–1385. [Google Scholar] [CrossRef]
- Brand, M. Uncoupling to survive? The role of mitochondrial inefficiency in ageing. Exp. Gerontol. 2000, 35, 811–820. [Google Scholar] [CrossRef]
- Little, A. Thyroid hormone regulation of thermal acclimation in ectotherms: Physiological mechanisms and ecoevolutionary implications. Mol. Cell. Endocrinol. 2021, 530, 111285. [Google Scholar] [CrossRef]
- de Souza-Teixeira, F.; Alonso-Molero, J.; Ayán, C.; Vilorio-Marques, L.; Molina, A.J.; González-Donquiles, C.; Dávila-Batista, V.; Fernández-Villa, T.; de Paz, J.A.; Martín, V. PGC-1α as a biomarker of physical activity-protective effect on colorectal cancerPGC-1α in the physical activity–protective effect on CRC. Cancer Prev. Res. 2018, 11, 523–534. [Google Scholar] [CrossRef] [PubMed]
- Umam, K.; Chuang, H.-J.; Chiu, L.; Yang, W.-K.; Wang, Y.-C.; Wu, W.-Y.; Lee, T.-H. Potential osmoprotective roles of branchial heat shock proteins towards Na+, K+-ATPase in milkfish (Chanos chanos) exposed to hypotonic stress. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2020, 248, 110749. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Seo, J.; Shneiderman, B. Interactively exploring hierarchical clustering results [gene identification]. Computer 2002, 35, 80–86. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′ to 3′) | Amplicon Size (bp) | Reference Number | Primer Concentration | |
---|---|---|---|---|---|
pgc-1α | F: | ACCTACCGCTATACTTGTGAC | 130 | XM_024287565.2 | 250 nM. |
R: | AAGTCTGTGTAATGGGATTTGC | ||||
prc | F: | CAGTAGAGACTAAAGACGAGGAG | 138 | XM_024297615.2 | 250 nM. |
R: | CTGCCCTTCTGATTAGACAGC | ||||
Nrf2 | F: | GCAAGTGGATGAAACGATGGA | 102 | XM_036212722.1 | 250 nM. |
R: | GGGAGTATTCTGGATTAACTGGT | ||||
Tfam | F: | GGAGGAGTCTGTTCAGCAACCAG | 124 | XM_024298155.2 | 250 nM |
R: | GAGGTCTTCTCGTCCGATCTCCA | ||||
nd5 | F: | CCACCCACGATTTAATTCACTC | 110 | NC_012976.1 | 250 nM |
R: | TAATAGTCCCGCTAAGATACTTCC | ||||
β-actin | F: | CCATTGAGCACGGTATTGTCA | 102 | XM_024296129.1 | 250 nM |
R: | GCAACACGCAGCTCGTTGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ranasinghe, N.; Chen, W.-Z.; Hu, Y.-C.; Gamage, L.; Lee, T.-H.; Ho, C.-W. Regulation of PGC-1α of the Mitochondrial Energy Metabolism Pathway in the Gills of Indian Medaka (Oryzias dancena) under Hypothermal Stress. Int. J. Mol. Sci. 2023, 24, 16187. https://doi.org/10.3390/ijms242216187
Ranasinghe N, Chen W-Z, Hu Y-C, Gamage L, Lee T-H, Ho C-W. Regulation of PGC-1α of the Mitochondrial Energy Metabolism Pathway in the Gills of Indian Medaka (Oryzias dancena) under Hypothermal Stress. International Journal of Molecular Sciences. 2023; 24(22):16187. https://doi.org/10.3390/ijms242216187
Chicago/Turabian StyleRanasinghe, Naveen, Wei-Zhu Chen, Yau-Chung Hu, Lahiru Gamage, Tsung-Han Lee, and Chuan-Wen Ho. 2023. "Regulation of PGC-1α of the Mitochondrial Energy Metabolism Pathway in the Gills of Indian Medaka (Oryzias dancena) under Hypothermal Stress" International Journal of Molecular Sciences 24, no. 22: 16187. https://doi.org/10.3390/ijms242216187