Next Article in Journal
A Network Pharmacology Prediction and Molecular Docking-Based Strategy to Explore the Potential Pharmacological Mechanism of Astragalus membranaceus for Glioma
Previous Article in Journal
Garcinia cambogia Extract Increased Hepatic Levels of Lipolysis-Stimulated Lipoprotein Receptor and Lipids in Mice on Normal Diet
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 22
10.3390/ijms242216305
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis)

by
Chao Ding
1,
Junzhao Gao
2,
Shiya Zhang
2,
Ning Jiang
2,
Dongtao Su
1,
Xinzheng Huang
3,* and
Zhao Zhang
2,*
1
Shanxi Center for Testing of Functional Agro-Products, Shanxi Agricultural University, Taiyuan 030031, China
2
Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture, China Agricultural University, Beijing 100107, China
3
Department of Entomology, MOA Key Lab of Pest Monitoring and Green Management, College of Plant Protection, China Agricultural University, Beijing 100193, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(22), 16305; https://doi.org/10.3390/ijms242216305
Submission received: 15 September 2023 / Revised: 5 November 2023 / Accepted: 10 November 2023 / Published: 14 November 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:
The basic/helix–loop–helix (bHLH) family is a major family of transcription factors in plants. Although it has been reported that bHLH plays a defensive role against pathogen infection in plants, there is no comprehensive study on the bHLH-related defence response in rose (Rosa sp.). In this study, a genome-wide analysis of bHLH family genes (RcbHLHs) in rose was carried out, including their phylogenetic relationships, gene structure, chromosome localization and collinearity analysis. Via phylogenetic analysis, a total of 121 RcbHLH genes in the rose genome were divided into 21 sub-groups. These RcbHLHs are unevenly distributed in all 7 chromosomes of rose. The occurrence of gene duplication events indicates that whole-genome duplication and segmental duplication may play a key role in gene duplication. Ratios of non-synonymous to synonymous mutation frequency (Ka/Ks) analysis showed that the replicated RcbHLH genes mainly underwent purification selection, and their functional differentiation was limited. Gene expression analysis showed that 46 RcbHLHs were differentially expressed in rose petals upon B. cinerea infection. It is speculated that these RcbHLHs are candidate genes that regulate the response of rose plants to B. cinerea infection. Virus-induced gene silencing (VIGS) confirmed that RcbHLH112 in rose is a susceptibility factor for infection with B. cinerea. This study provides useful information for further study of the functions of the rose bHLH gene family.

1. Introduction

Transcription factors have been extensively studied in plant growth, development, metabolism and stress response due to their important roles in transcriptional regulation [1]. Transcription factors usually consist of at least DNA-binding domains, transcriptional regulatory domains, oligomerisation sites and nuclear localisation signals [2]. The bHLH gene family is one of the most important transcription factor families in plants. Since the discovery of basic/helix–loop–helix (bHLH) motifs [3] with the ability to bind DNA, members of the bHLH protein superfamily have been found to have more and more functions in the basic physiology and development of animals and plants [4,5,6,7,8]. The bHLH domain consists of about 60 amino acids and has two regions with different functions, i.e., the basic domain and the HLH domain. The basic domain is located at the N-terminus of the bHLH domain and acts as a DNA-binding motif. It consists of about 15 amino acids, usually including 6 basic residues. The HLH region contains two amphiphilic alpha helices and a variable-length linker. Two amphiphilic alpha helices of bHLH proteins can interact to form homodimers or heterodimers [9,10]. Some bHLH proteins have been shown to bind to sequences containing a common core element called the E-box (5′-CANNTG-3′). In addition, nucleotides flanking the core elements may also play a role in binding specificity [11].
bHLH transcription factors are involved in the regulation of various plant processes, including growth, development and response to biotic and abiotic stresses. The function of bHLHs in disease resistance has been characterized in Arabidopsis and many other crops. For example, the wheat bHLH transcription factor gene TabHLH060 increases the susceptibility of transgenic Arabidopsis to Pseudomonas aeruginosa [12]. In tomato, SlybHLH131 increases resistance to yellow leaf curl virus by controlling cell death [13]. Overexpression of jasmonate-responsive OsbHLH034 in rice results in the induction of bacterial blight resistance via an increase in lignin biosynthesis [14]. In addition, bHLHs are also associated with abiotic stress in plants. For example, MdbHLH130 is the drought response bHLH protein in apple that confers drought tolerance in transgenic tobacco [15]. Overexpression of a bHLH gene from Tamarix hispida in Arabidopsis can improve salt and drought tolerance by increasing osmotic potential and reducing the accumulation of reactive oxygen species [16]. In Arabidopsis, bHLH122 is important for drought and osmotic stress resistance and repressing ABA catabolism [17].
Recent research has shown that plant bHLHs can act as a susceptibility gene, negatively regulating plant disease resistance. Zhang and co-authors found that loss of function of the bHLH transcription factor Nrd1 in tomato enhances resistance to Pseudomonas syringae. The mutant plants showed increased immunity due to the suppression of a defence gene, Agp1, by Nrd1. This enhanced immunity is independent of the activation of other immunity-associated genes, indicating that Nrd1 plays a specific role in regulating Agp1 expression and susceptibility to Pseudomonas syringae in tomato [18].
Roses (Rosa sp.) are commercially the most important ornamental plant, generating tens of billions of dollars in value each year [19]. Grey mould disease of roses caused by Botrytis cinerea causes huge losses. There are no reports on the involvement of bHLH transcription factors in rose grey mould resistance. To better understand the involvement of the bHLH genes in rose resistance against B. cinerea, we performed a genome-wide analysis of the bHLH family in rose. We further performed RNA-Seq analysis and showed that a large number of genes encoding bHLH transcription factors were significantly upregulated upon B. cinerea infection, implying that they were involved in the resistance of rose to B. cinerea [20]. Importantly, virus-induced gene silencing (VIGS) further confirmed that RcbHLH112 plays an important role in resistance to B. cinerea as a susceptibility gene.

2. Results

2.1. Identification of RcbHLH Genes in Rose

In the process of identifying bHLH family genes in the rose genome, we used the bHLH Hidden Markov Model (HMM) file (PF00010) to perform a Hmmsearch search in the rose genome database, and a total of 136 candidate RcbHLH proteins were obtained. MEME (https://meme-suite.org/meme/) (accessed on 11 July 2022) and Pfam database comparison further confirmed that the extracted protein domain was consistent with the characteristics of the family, and finally 121 RcbHLH gene members were identified in the rose genome, as these 121 protein sequences had a domain profile consistent with a typical bHLH transcription factor. All RcbHLH family genes can be mapped to chromosomes and named RcbHLH1 to RcbHLH121 according to their order on chromosomes (Figure 1).
There is a significant difference in the protein size of these RcbHLHs. Among the 121 RcbHLHs, RcbHLH25 has the longest amino acid sequence with 1275 amino acids, while the shortest RcbHLH85 has only 151 amino acids. The average length of RcbHLH protein is 385 aa. The details of all RcbHLH genes are listed in Table 1.

2.2. Chromosomal Locations, Whole-Genome Duplication and Microsynteny

The 121 RcbHLH genes identified are unevenly distributed across 7 rose chromosomes (Figure 1). Chromosome 6 has the most RcbHLH genes with 23. There are 20 RcbHLH genes on chromosomes 2 and 7. Chromosome 3 has the fewest RcbHLH genes, only 9. Meanwhile, 12.37% and 13.22% of RcbHLH genes are located in the upper and middle parts of chromosomes 2 and 7, respectively; 9. 92% of the RcbHLH genes are located in the upper and middle parts of chromosome 5; 9.09% and 10.74% of the genes are distributed in the middle and lower parts of chromosomes 1 and 4, respectively; and 19.01% of the RcbHLH genes are distributed on chromosome 6.
Tandem and segmental duplication play an important role in the expansion of gene families and the generation of new gene functions. On further examination of the repetitive events, we found that there were 16 gene pairs in this family, all of which were whole-genome duplication (WGD) or segmental duplication, while there were gene pairs on different chromosomes, indicating that these genes were paralogous genes. The microsynteny of these RcbHLH genes is shown in Figure 2.
To investigate the selective constraints between duplicated RcbHLH genes, the ratios of non-synonymous mutation frequency (Ka) to synonymous mutation frequency (Ks) of 16 gene pairs were calculated (Table 2). In general, Ka/Ks > 1 is consistent with positive selection, whereas Ka/Ks < 1 indicates purifying selection. The Ka/Ks ratio of all 16 repetitive gene pairs is less than 1 (Table 2), indicating limited functionally divergent purifying selection during the evolutionary history of the repetitive RcbHLH genes.

2.3. Phylogenetic and Exon-Intron Structural Analysis of Rose bHLH Genes

We used the neighbour-joining method (NJ) method to reconstruct the phylogeny of all RcbHLH genes and constructed a phylogenetic tree. The results of the follow-up analysis of the exon–intron structure are consistent with those of the phylogenetic analysis (Figure 3). Most genes clustered in the same group have similar genetic structures, especially in terms of the number of introns, such as RcbHLH10, RcbHLH26 and RcbHLH120. However, there were some exceptions. For example, RcbHLH58 and RcbHLH105 contain different numbers of introns. In addition, their intron length is very variable, ranging from tens to thousands of nucleotides. These results indicate that there is a highly conservative structure in the RcbHLH subfamily and that there is sequence diversity between different RcbHLH groups.
In addition, there is increasing evidence that bHLH transcription factors play a key role in disease resistance in various plant species (Table 3). To assess the evolutionary relationship between RcbHLHs and AtbHLHs genes, we constructed a composite phylogenetic tree (Figure 4). According to The Arabidopsis Information Resources (TAIR) (http://www.arabidopsis.org/) (accessed on 11 July 2022), there are 158 AtbHLH genes in Arabidopsis. These members can be divided into 21 different groups. The results confirmed the previously proposed classification of the bHLH family. The subfamily VIII (a+b+c) contains 31 proteins, and the subfamily IVb contains 3 proteins. The bootstrap values of some branches in the phylogenetic tree are low, which may be due to the short bHLH domain and relatively little information other than highly conserved information.

2.4. Expression of RcbHLH Genes in Response to B. cinerea Infection

A growing body of evidence from different plant species indicates that plant bHLH transcription factors play an important role in pathogen response. To investigate the role of bHLH genes in B. cinerea resistance in rose, we analysed transcriptome data from rose petals inoculated with the pathogen at 30 and 48 hpi. The 30 hpi time point represents the early response to infection, whereas the 48 hpi time point corresponds to the late response (Table 4). The log2Ratio transformed expression profiles were obtained from the RNA-seq dataset [20]. A total of 21 RcbHLH genes (RcbHLH17, RcbHLH21, RcbHLH29, RcbHLH34, RcbHLH40, RcbHLH44, RcbHLH46, RcbHLH59, RcbHLH62, RcbHLH67, RcbHLH72, RcbHLH75, RcbHLH80, RcbHLH90, RcbHLH99, RcbHLH101, RcbHLH106, RcbHLH108, RcbHLH111, RcbHLH112 and RcbHLH115) were upregulated, suggesting that they may be the key regulators of B. cinerea infection and influence the disease resistance of rose. To further verify the expression profile of RNA-seq, the expression of 4 RcbHLHs was analysed by RT-qPCR. The results of the RT-qPCR analysis were consistent with those of the transcriptome analysis (Figure 5).

2.5. RcbHLH112 Is a Susceptibility Gene to B. cinerea in Rose

To further investigate the potential role of B. cinerea-induced RcbHLH genes in pathogen resistance, we used VIGS to knock down the expression of RcbHLH112 in rose petals. The reason for selecting RcbHLH112 for this VIGS study was that RcbHLH112 is one of the most upregulated RcbHLHs after B. cinerea infection (Table 4). To silence RcbHLH112 in rose petals, we cloned the 256 bp fragment of RcbHLH112 into the tobacco rattle virus (TRV2) vector to generate TRV-RcbHLH112. Agrobacterium tumefaciens carrying TRV-RcbHLH112 and TRV1 were co-infiltrated into rose petals to produce rose petals with RcbHLH112 silencing. The infiltrated rose petals were then inoculated with B. cinerea. Compared with the control petals (TRV-GFP) inoculated with TRV with a GFP sequence, petals inoculated with TRV-RcbHLH112 showed attenuation of disease symptoms, with a significant reduction in the size of the lesion (Figure 6A,B). In addition, we used RT-qPCR to verify the silencing efficiency of VIGS (Figure 6C). These results show that RcbHLH112 is a susceptibility factor for rose resistance against B. cinerea and that its silencing increases resistance to B. cinerea in rose.

3. Discussion

The bHLH genes play important roles in plant growth, development and defence. In this study, we comprehensively analysed the RcbHLH family, including phylogeny, gene structure, chromosome localization, gene duplication events, sequence characteristics and expression profile analysis. We demonstrated that RcbHLH112 is involved in the regulation of resistance to B. cinerea in rose.
It was found that the number of RcbHLH genes in rose (121) was lower than that in Arabidopsis (158), rice (167), potato (124) and maize (208) [26,27,28], indicating that the bHLH gene has expanded to different degrees in different plants. Gene replication plays a very important role in gene family expansion. In this study, 16 replication events were identified in 56 RcbHLHs, all of which involved segmental duplication. The Ka/Ks ratio of the 16 RcbHLH repeats indicates that the RcbHLH gene family is under purifying selection, suggesting a highly conserved evolution. The phylogenetic relationship of bHLH between rose and Arabidopsis showed that most evolutionary branches contained different numbers of AtbHLH and RcbHLH proteins, indicating that the two species showed conservative evolution. These results suggest that the species-specific bHLH gene was lost in rose or gained in the Arabidopsis phylogeny after divergence from the most recent common ancestor.
The role of RcbHLH in B. cinerea resistance is still unclear. In this study, we constructed a phylogenetic tree of known resistance-related bHLHs and found that the bHLHs involved in disease resistance were distributed in groups Ia, Ib, IVb, IVc and Ⅲ(d+e+f). According to the expression in response to B. cinerea infection, we identified 21 RcbHLHs that could be involved in B. cinerea resistance in rose petals. Interestingly, most of the RcbHLH genes induced by B. cinerea are associated with segmental duplication events. The RcbHLH112 belonging to Ib was on the same evolutionary branch as the B. cinerea resistance-related bHLH found in many different species and was significantly induced by B. cinerea at 30 hpi and 48 hpi. Therefore, RcbHLH112 should be considered as an important candidate gene involved in the regulation of disease resistance in rose. The results of VIGS in rose petals showed that silencing of RcbHLH112 improved resistance to B. cinerea, indicating that it is a susceptibility factor of rose in B. cinerea infection process.

4. Materials and Methods

4.1. Identification and Characteristics of the bHLH Genes in Rose Genome

The complete genome data were downloaded from the Rosa chinensis ‘Old Blush’ genome website https://lipm-browsers.toulouse.inra.fr/pub/RchiOBHm-V2/ (accessed on 5 July 2022) for local alignment and analysis. To identify the non-redundant bHLH genes in the rose genome, first, the common protein sequence of the bHLH Hidden Markov Model (HMM) (PF00010) was downloaded from the Pfam website (http://pfam.xfam.org) (accessed on 11 July 2022). Then, using the HMM profile as a query, the rose genome was searched using the hmmblast function and all sequences were identified as containing bHLH domains with an E-value of <1 × 10−3 in rose. Finally, the protein and DNA sequences of the above rose bHLH members were extracted using the TBTools tool, and all candidate RcbHLHs were verified using the functional structure identified by MEME (https://meme-suite.org/meme/) (accessed on 11 July 2022) and the Pfam database to determine the final family members.

4.2. Mapping bHLH Genes on Rose Chromosomes

The physical locations of 121 genes were extracted from the genomic gff3 annotation file of rose. Mapchart 2.2 software was used to visualise the distribution of bHLH genes on 7 rose chromosomes [29].

4.3. Phylogenetic Analyses and Structure Analysis

A total of 158 Arabidopsis bHLH protein sequences were collected from TAIR (http://www.arabidopsis.org/) (accessed on 11 July 2022). The bHLH protein sequences of Arabidopsis thaliana and rose were compared using ClustalW. The bHLH sequence alignments were used for phylogenetic analysis. The phylogenetic tree was constructed using MEGA6 software, calculating the advance distance via p-distance, estimating the amino acid substitution at each site, performing 1000 bootstrap sampling steps and constructing the phylogenetic tree via the NJ method [30]. The gene structure map and functional structure map of RcbHLH were completed using TBtools [31].

4.4. Collinearity Analyses and Calculation of Ratios of Non-Synonymous (Ka) to Synonymous (Ks) Nucleotide Substitution

We used TBtools to analyse the collinearity of bHLH members and calculate the ratio of Ka/Ks [32].

4.5. Expression of RcbHLHs in Response to B. cinerea

The RNA-Seq data of rose petals infected with B. cinerea can be obtained from the National Center for Biotechnology Information (NCBI) database, accession number PRJNA414570. Clean sequencing reads were mapped to the rose reference genome. Reads per kb per million reads (RPKM) were used to obtain gene expression level. The gene expression level of RcbHLH was calculated as reads per kb per million reads. Differential expression analysis based on Log2 fold change was analysed using DEseq2. To verify the results of RNA-Seq, quantitative PCR (qPCR) was used to analyse the expression of 4 RcbHLH genes. Therefore, total RNA was extracted from rose petals 30 and 48 h after inoculation using the hot borate method [33]. First-strand cDNA was synthesised using HiScript II Q Select RT SuperMix (Vazyme) in 20 μL reaction volume, and 1 μg DNase-treated RNA was used. SYBR Green Master Mix (Takara, Dalian, China) was used for the qPCR reaction, and detection was performed on a StepOnePlus real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). RcUBI2 was used as an internal control. Expression was analysed via the delta–delta–CT method. All primers used for qPCR are listed in Table 5.

4.6. VIGS and B. cinerea Inoculation Assays

To generate the TRV-RcbHLH112 constructor, the 256 bp fragment of RcbHLH112 was amplified using a pair of primers, RcbHLH112-F(5’-GGGGGACAAGTTTGTACAAAAAAGCAGGCTTCTGAGGAAGAAGGAGCCGAAG-3’) and RcbHLH112-R(5’-GGGGGACCACTTTGTACAAGAAAGCTGGGTCCTCAGCTTAGCCTTGTGGAGT-3’).
The VIGS process involved taking individual petals from the outermost whorls of the rose at the second stage of flowering. A 15 mm disc was then cut from the centre of each petal. Agrobacterium tumefaciens cultures containing constructs expressing TRV1 and TRV2 were mixed 1:1 and infiltrated into the petal disc under vacuum [34]. On day 6 after infection, the petal disc was inoculated with B. cinerea. A minimum of 48 petal discs were used for genes, and VIGS was repeated at least three times. After inoculation with B. cinerea, Student’s t-test was performed to determine the significance of lesion size.

5. Conclusions

In this study, a genome-wide analysis of the RcbHLH family genes was performed, including phylogenetic relationship, collinearity and expression analysis. A total of 121 non-redundant bHLH family members were identified. These RcbHLH family genes were classified into 21 groups based on phylogeny and conserved domains. Expression analysis showed that the transcriptional regulation of some RcbHLH family genes was induced by B. cinerea infection in rose petals. Furthermore, plant bHLHs involved in disease resistance tended to cluster on the same branch of the phylogenetic tree. Based on these analyses, we used VIGS to further demonstrate that RcbHLH112 is a susceptibility factor of rose in B. cinerea infection process. The information provided by these results can promote further functional analysis of the RcbHLH gene in rose.

Author Contributions

C.D., X.H. and Z.Z. conceived and designed the experiments. C.D., J.G., S.Z., D.S. and Z.Z. analysed the data and wrote the paper. X.H., S.Z. and N.J. performed the experiments. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Special Project for Science and Technology Cooperation and Exchange of Shanxi Province (Grant No. 202204041101017) to Chao Ding and Zhao Zhang. The funders played no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

Institutional Review Board Statement

Not applicable. Our research did not involve any human or animal subjects, material or data. The plant materials used in this study were provided by the China Agricultural University and are freely available for research purposes, following institutional, national and international guidelines.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analysed during the current study has been included within supplemental data. The plant materials are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Abbreviations

hpihours post inoculation;
bHLHbasic/helix–loop–helix;
Ka/KsRatios of non-synonymous to synonymous mutation frequencies;
ABAabscisic acid;
VIGSvirus-induced gene silencing;
HMMHidden Markov Model;
WGDwhole-genome duplication;
Kanon-synonymous mutation frequency;
Kssynonymous mutation frequency;
NJneighbour-joining method;
TAIRThe Arabidopsis Information Resources;
TRV2tobacco rattle virus;
NCBINational Center for Biotechnology Information;
RPKMreads per kb per million reads.

References

  1. Dou, L.; Zhang, X.; Pang, C.; Song, M.; Wei, H.; Fan, S.; Yu, S. Genome-wide analysis of the WRKY gene family in cotton. Mol. Genet. Genom. 2014, 289, 1103–1121. [Google Scholar] [CrossRef] [PubMed]
  2. Cao, Y.; Han, Y.; Li, D.; Lin, Y.; Cai, Y. MYB Transcription Factors in Chinese Pear (Pyrus bretschneideri Rehd.): Genome-Wide Identification, Classification, and Expression Profiling during Fruit Development. Front. Plant Sci. 2016, 7, 577. [Google Scholar] [CrossRef] [PubMed]
  3. Murre, C.; McCaw, P.S.; Vaessin, H.; Caudy, M.; Jan, L.; Jan, Y.; Cabrera, C.V.; Buskin, J.N.; Hauschka, S.D.; Lassar, A.B.; et al. Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 1989, 58, 537–544. [Google Scholar] [CrossRef]
  4. Ledent, V.; Vervoort, M. The basic helix-loop-helix protein family: Comparative genomics and phylogenetic analysis. Genome Res. 2001, 11, 754–770. [Google Scholar] [CrossRef] [PubMed]
  5. Toledo-Ortiz, G.; Huq, E.; Quail, P.H. The Arabidopsis basic/helix-loop-helix transcription factor family. Plant Cell 2003, 15, 1749–1770. [Google Scholar] [CrossRef]
  6. Skinner, M.K.; Rawls, A.; Wilson-Rawls, J.; Roalson, E.H. Basic helix-loop-helix transcription factor gene family phylogenetics and nomenclature. Differentiation 2010, 80, 1–8. [Google Scholar] [CrossRef]
  7. Mateo, J.L.; Berg, D.L.v.D.; Haeussler, M.; Drechsel, D.; Gaber, Z.B.; Castro, D.S.; Robson, P.; Lu, Q.R.; Crawford, G.E.; Flicek, P.; et al. Characterization of the neural stem cell gene regulatory network identifies OLIG2 as a multifunctional regulator of self-renewal. Genome Res. 2015, 25, 41–56. [Google Scholar] [CrossRef]
  8. Imayoshi, I.; Kageyama, R. bHLH factors in self-renewal, multipotency, and fate choice of neural progenitor cells. Neuron 2014, 82, 9–23. [Google Scholar] [CrossRef] [PubMed]
  9. Ellenberger, T.; Fass, D.; Arnaud, M.; Harrison, S.C. Crystal structure of transcription factor E47: E-box recognition by a basic region helix-loop-helix dimer. Genes Dev. 1994, 8, 970–980. [Google Scholar] [CrossRef]
  10. Nesi, N.; Debeaujon, I.; Jond, C.; Pelletier, G.; Caboche, M.; Lepiniec, L. The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 2000, 12, 1863–1878. [Google Scholar] [CrossRef]
  11. Massari, M.E.; Murre, C. Helix-loop-helix proteins: Regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 2000, 20, 429–440. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, F.; Lin, R.; Feng, J.; Qiu, D.; Chen, W.; Xu, S. Wheat bHLH transcription factor gene, TabHLH060, enhances susceptibility of transgenic Arabidopsis thaliana to Pseudomonas syringae. Physiol. Mol. Plant Pathol. 2015, 90, 123–130. [Google Scholar] [CrossRef]
  13. Wang, J.; Hu, Z.; Zhao, T.; Yang, Y.; Chen, T.; Yang, M.; Yu, W.; Zhang, B. Genome-wide analysis of bHLH transcription factor and involvement in the infection by yellow leaf curl virus in tomato (Solanum lycopersicum). BMC Genom. 2015, 16, 39. [Google Scholar] [CrossRef] [PubMed]
  14. Onohata, T.; Gomi, K. Overexpression of jasmonate-responsive OsbHLH034 in rice results in the induction of bacterial blight resistance via an increase in lignin biosynthesis. Plant Cell Rep. 2020, 39, 1175–1184. [Google Scholar] [CrossRef] [PubMed]
  15. Zhao, Q.; Fan, Z.; Qiu, L.; Che, Q.; Wang, T.; Li, Y.; Wang, Y. MdbHLH130, an Apple bHLH Transcription Factor, Confers Water Stress Resistance by Regulating Stomatal Closure and ROS Homeostasis in Transgenic Tobacco. Front. Plant Sci. 2020, 11, 543696. [Google Scholar] [CrossRef]
  16. Ji, X.; Nie, X.; Liu, Y.; Zheng, L.; Zhao, H.; Zhang, B.; Huo, L.; Wang, Y. A bHLH gene from Tamarix hispida improves abiotic stress tolerance by enhancing osmotic potential and decreasing reactive oxygen species accumulation. Tree Physiol. 2016, 36, 193–207. [Google Scholar] [CrossRef] [PubMed]
  17. Liu, W.; Tai, H.; Li, S.; Gao, W.; Zhao, M.; Xie, C.; Li, W. bHLH122 is important for drought and osmotic stress resistance in Arabidopsis and in the repression of ABA catabolism. New Phytol. 2014, 201, 1192–1204. [Google Scholar] [CrossRef]
  18. Zhang, N.; Hecht, C.; Sun, X.; Fei, Z.; Martin, G.B. Loss of function of the bHLH transcription factor Nrd1 in tomato enhances resistance to Pseudomonas syringae. Plant Physiol. 2022, 190, 1334–1348. [Google Scholar] [CrossRef]
  19. Liorzou, M.; Pernet, A.; Li, S.; Chastellier, A.; Thouroude, T.; Michel, G.; Malécot, V.; Gaillard, S.; Briée, C.; Foucher, F.; et al. Nineteenth century French rose (Rosa sp.) germplasm shows a shift over time from a European to an Asian genetic background. J. Exp. Bot. 2016, 67, 4711–4725. [Google Scholar] [CrossRef]
  20. Liu, X.; Cao, X.; Shi, S.; Zhao, N.; Li, D.; Fang, P.; Chen, X.; Qi, W.; Zhang, Z. Comparative RNA-Seq analysis reveals a critical role for brassinosteroids in rose (Rosa hybrida) petal defense against Botrytis cinerea infection. BMC Genet. 2018, 19, 62. [Google Scholar] [CrossRef]
  21. Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [PubMed]
  22. Li, X.; Yang, R.; Chen, H. The Arabidopsis thaliana Mediator subunit MED8 regulates plant immunity to Botrytis Cinerea through interacting with the basic helix-loop-helix (bHLH) transcription factor FAMA. PLoS ONE 2018, 13, e0193458. [Google Scholar] [CrossRef] [PubMed]
  23. Lorenzo, O.; Chico, J.M.; Saénchez-Serrano, J.J.; Solano, R. JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 2004, 16, 1938–1950. [Google Scholar] [CrossRef]
  24. Huang, H.; Gao, H.; Liu, B.; Fan, M.; Wang, J.; Wang, C.; Tian, H.; Wang, L.; Xie, C.; Wu, D.; et al. bHLH13 Regulates Jasmonate-Mediated Defense Responses and Growth. Evol. Bioinform. 2018, 14, 1176934318790265. [Google Scholar] [CrossRef] [PubMed]
  25. He, Q.; Lu, H.; Guo, H.; Wang, Y.; Zhao, P.; Li, Y.; Wang, F.; Xu, J.; Mo, X.; Mao, C. OsbHLH6 interacts with OsSPX4 and regulates the phosphate starvation response in rice. Plant J. 2021, 105, 649–667. [Google Scholar] [CrossRef] [PubMed]
  26. Li, X.; Duan, X.; Jiang, H.; Sun, Y.; Tang, Y.; Yuan, Z.; Guo, J.; Liang, W.; Chen, L.; Yin, J.; et al. Genome-wide analysis of basic/helix-loop-helix transcription factor family in rice and Arabidopsis. Plant Physiol. 2006, 141, 1167–1184. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, R.; Zhao, P.; Kong, N.; Lu, R.; Pei, Y.; Huang, C.; Ma, H.; Chen, Q. Genome-Wide Identification and Characterization of the Potato bHLH Transcription Factor Family. Genes 2018, 9, 54. [Google Scholar] [CrossRef] [PubMed]
  28. Zhang, T.; Lv, W.; Zhang, H.; Ma, L.; Li, P.; Ge, L.; Li, G. Genome-wide analysis of the basic Helix-Loop-Helix (bHLH) transcription factor family in maize. BMC Plant Biol. 2018, 18, 235. [Google Scholar] [CrossRef]
  29. Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
  30. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
  31. Chen, C.; Xia, R.; Chen, H.; He, Y. TBtools, a toolkit for biologists integrating various HTS-data handling tools with a user-friendly interface. bioRxiv 2018, 1, 289660. [Google Scholar]
  32. Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.-H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  33. Wu, L.; Ma, N.; Jia, Y.; Zhang, Y.; Feng, M.; Jiang, C.-Z.; Ma, C.; Gao, J. An Ethylene-Induced Regulatory Module Delays Flower Senescence by Regulating Cytokinin Content. Plant Physiol. 2017, 173, 853–862. [Google Scholar] [CrossRef]
  34. Liu, Y.; Schiff, M.; Dinesh-Kumar, S.P. Virus-induced gene silencing in tomato. Plant J. 2002, 31, 777–786. [Google Scholar] [CrossRef]
Ijms 24 16305 g001
Figure 1. Chromosome localization of rose bHLH family members. The physical distribution of each RcbHLH gene is listed on the seven chromosomes of Rose chinensis.
Figure 1. Chromosome localization of rose bHLH family members. The physical distribution of each RcbHLH gene is listed on the seven chromosomes of Rose chinensis.
Ijms 24 16305 g001
Ijms 24 16305 g002
Figure 2. Microsyntenic analyses of the rose bHLH transcription factors in the Rose chinensis genome. Circular visualization of rose bHLH transcription factors is mapped onto different chromosomes using Circos [21]. The red lines indicate rose bHLH genes with a syntenic relationship. The grey lines represent all syntenic blocks in the genome of Rose chinensis.
Figure 2. Microsyntenic analyses of the rose bHLH transcription factors in the Rose chinensis genome. Circular visualization of rose bHLH transcription factors is mapped onto different chromosomes using Circos [21]. The red lines indicate rose bHLH genes with a syntenic relationship. The grey lines represent all syntenic blocks in the genome of Rose chinensis.
Ijms 24 16305 g002
Ijms 24 16305 g003
Figure 3. Phylogenetic analyses, DNA structures and protein motifs of the bHLH gene family in rose. Complete alignments of all rose bHLH proteins were used to construct a phylogenetic tree using the neighbour-joining method. The left represents gene structures. The green boxes, yellow boxes and grey lines in the exon–intron structure diagram represent UTRs, exons and introns, respectively. The right represents protein motifs in the bHLH members. The colourful boxes delineate different motifs (unit: aa). The scale on the bottom is provided as a reference.
Figure 3. Phylogenetic analyses, DNA structures and protein motifs of the bHLH gene family in rose. Complete alignments of all rose bHLH proteins were used to construct a phylogenetic tree using the neighbour-joining method. The left represents gene structures. The green boxes, yellow boxes and grey lines in the exon–intron structure diagram represent UTRs, exons and introns, respectively. The right represents protein motifs in the bHLH members. The colourful boxes delineate different motifs (unit: aa). The scale on the bottom is provided as a reference.
Ijms 24 16305 g003
Ijms 24 16305 g004
Figure 4. Phylogenetic analyses of the rose bHLH transcription factors. Composite phylogenetic tree of rose and Arabidopsis bHLH transcription factors. The bootstrap values are indicated on the nodes of the branches.
Figure 4. Phylogenetic analyses of the rose bHLH transcription factors. Composite phylogenetic tree of rose and Arabidopsis bHLH transcription factors. The bootstrap values are indicated on the nodes of the branches.
Ijms 24 16305 g004
Ijms 24 16305 g005
Figure 5. Validation of RNA-Seq results using qRT-PCR. RhUbi was used as an internal control. Expression profile data of four RcbHLH genes at 30 hpi and 48 hpi after B. cinerea inoculation were obtained using qRT-PCR. Values are the means of three replicates ± SD. The primers used are listed in Table 5.
Figure 5. Validation of RNA-Seq results using qRT-PCR. RhUbi was used as an internal control. Expression profile data of four RcbHLH genes at 30 hpi and 48 hpi after B. cinerea inoculation were obtained using qRT-PCR. Values are the means of three replicates ± SD. The primers used are listed in Table 5.
Ijms 24 16305 g005
Ijms 24 16305 g006
Figure 6. Functional analysis of rose bHLH transcription factor gene RcbHLH112. (A) Compromised B. cinerea resistance upon silencing of RcbHLH112 at 60 hpi post inoculation. A recombinant tobacco rattle virus (TRV) targeting RcbHLH112 (TRV-RcbHLH112) was used for the gene silencing, and a TRV with GFP sequence (TRV-GFP) was used as the control. (B) Quantification of B. cinerea disease lesions on TRV-RcbHLH112- and TRV-GFP-inoculated rose petal discs. The graph shows the lesion size from three biological replicates (n = 48) with the standard deviation. (C) Expression of RcbHLH112 relative to that in the control at 6 days post silencing, before the infection with B. cinerea (0 hpi). All statistical analyses were performed using Student’s t-test; *** p < 0.001.
Figure 6. Functional analysis of rose bHLH transcription factor gene RcbHLH112. (A) Compromised B. cinerea resistance upon silencing of RcbHLH112 at 60 hpi post inoculation. A recombinant tobacco rattle virus (TRV) targeting RcbHLH112 (TRV-RcbHLH112) was used for the gene silencing, and a TRV with GFP sequence (TRV-GFP) was used as the control. (B) Quantification of B. cinerea disease lesions on TRV-RcbHLH112- and TRV-GFP-inoculated rose petal discs. The graph shows the lesion size from three biological replicates (n = 48) with the standard deviation. (C) Expression of RcbHLH112 relative to that in the control at 6 days post silencing, before the infection with B. cinerea (0 hpi). All statistical analyses were performed using Student’s t-test; *** p < 0.001.
Ijms 24 16305 g006
Table 1. Members of the RcbHLH gene family as predicted in R. chinensis genome sequence.
Table 1. Members of the RcbHLH gene family as predicted in R. chinensis genome sequence.
Gene Accession Number 1Chr. 2Position 3IntronExtronCDS (bp)Amino AcidsClade
RcbHLH1RchiOBHm_Chr1g031489112,173,916781296432Ⅸ
RcbHLH2RchiOBHm_Chr1g032152119,045,54312708236Ⅰb
RcbHLH3RchiOBHm_Chr1g0337011128,673,606231371457Ⅱ
RcbHLH4RchiOBHm_Chr1g0348781141,770,117561404468Ⅶ
RcbHLH5RchiOBHm_Chr1g0355211147,903,940781944648Ⅲ(d+e+f)
RcbHLH6RchiOBHm_Chr1g0360001151,822,366121851617Ⅲ(d+e+f)
RcbHLH7RchiOBHm_Chr1g0360811152,697,497011464488Ⅲ(d+e+f)
RcbHLH8RchiOBHm_Chr1g0361191153,198,215341254418Ⅰa
RcbHLH9RchiOBHm_Chr1g0368211158,410,23212708236Ⅰb
RcbHLH10RchiOBHm_Chr1g0370561160,070,11612795265Ⅴb
RcbHLH11RchiOBHm_Chr1g0376001163,269,74212918306Ⅰb
RcbHLH12RchiOBHm_Chr1g0376011163,276,16512570190Ⅰb
RcbHLH13RchiOBHm_Chr1g0376061163,317,04212711237Ⅰb
RcbHLH14RchiOBHm_Chr1g0380101165,866,341231098366Ⅰa
RcbHLH15RchiOBHm_Chr2g008591121,182,817671263421Ⅺ
RcbHLH16RchiOBHm_Chr2g009124124,891,265671158386Ⅹ
RcbHLH17RchiOBHm_Chr2g009357126,833,754671743581Ⅳd
RcbHLH18RchiOBHm_Chr2g009609128,997,567671293431Ⅺ
RcbHLH19RchiOBHm_Chr2g0099391211,611,83245954318Ⅳb
RcbHLH20RchiOBHm_Chr2g0105811217,067,75201753251Ⅷ(a+b+c)
RcbHLH21RchiOBHm_Chr2g0105931217,187,821781128376Ⅶ
RcbHLH22RchiOBHm_Chr2g0109611220,986,271341056352Ⅳa
RcbHLH23RchiOBHm_Chr2g0109621221,006,834451062354Ⅳa
RcbHLH24RchiOBHm_Chr2g0109941221,287,305341101367Ⅲ(a+b+c)
RcbHLH25RchiOBHm_Chr2g0111201222,786,8952338251275Orphan
RcbHLH26RchiOBHm_Chr2g0111351222,988,39112624208Ⅴb
RcbHLH27RchiOBHm_Chr2g0112221224,091,95923996332Ⅰa
RcbHLH28RchiOBHm_Chr2g0120331233,053,64801849283Ⅷ(a+b+c)
RcbHLH29RchiOBHm_Chr2g0126861241,432,99423678226Ⅰb
RcbHLH30RchiOBHm_Chr2g0139261256,883,003891026342Ⅹ
RcbHLH31RchiOBHm_Chr2g0141851259,398,516011308436Ⅷ(a+b+c)
RcbHLH32RchiOBHm_Chr2g0152511269,890,195891617539Ⅶ
RcbHLH33RchiOBHm_Chr2g0160481276,321,48501912304Ⅷ(a+b+c)
RcbHLH34RchiOBHm_Chr2g0176421288,244,910341503501Ⅲ(a+b+c)
RcbHLH35RchiOBHm_Chr3g045111132,350,38667999333Ⅺ
RcbHLH36RchiOBHm_Chr3g045421134,346,874231020340Ⅰa
RcbHLH37RchiOBHm_Chr3g045729136,478,56912591197ⅩⅥ
RcbHLH38RchiOBHm_Chr3g045870137,313,238892184728Ⅶ
RcbHLH39RchiOBHm_Chr3g0462431310,114,22301768256Ⅷ(a+b+c)
RcbHLH40RchiOBHm_Chr3g0465361312,152,4149102079693ⅩⅢ
RcbHLH41RchiOBHm_Chr3g0480621326,445,394561032344Ⅸ
RcbHLH42RchiOBHm_Chr3g0480751326,579,491671077359Ⅻ
RcbHLH43RchiOBHm_Chr3g0493491340,682,13845891297Ⅷ(a+b+c)
RcbHLH44RchiOBHm_Chr4g039031145,608,79423792264Ⅳd
RcbHLH45RchiOBHm_Chr4g039240147,811,07334678226Ⅳa
RcbHLH46RchiOBHm_Chr4g0399211416,381,85445735245Ⅲ(a+b+c)
RcbHLH47RchiOBHm_Chr4g0403251422,342,02156465155Ⅻ
RcbHLH48RchiOBHm_Chr4g0405961426,941,40956501167Ⅹ
RcbHLH49RchiOBHm_Chr4g0409001432,037,594561302434Ⅸ
RcbHLH50RchiOBHm_Chr4g0412071435,820,711781662554Ⅻ
RcbHLH51RchiOBHm_Chr4g0415421440,124,051451341447Ⅰa
RcbHLH52RchiOBHm_Chr4g0418301443,688,76323609203Ⅰa
RcbHLH53RchiOBHm_Chr4g0425781451,377,28401681227ⅩⅥ
RcbHLH54RchiOBHm_Chr4g0429161453,995,80767558186Ⅻ
RcbHLH55RchiOBHm_Chr4g0434901458,544,64856720240Ⅻ
RcbHLH56RchiOBHm_Chr4g0435901459,312,260341062354Ⅴb
RcbHLH57RchiOBHm_Chr4g0437041460,257,934891647549Ⅻ
RcbHLH58RchiOBHm_Chr4g0437281460,431,122671008336Ⅴa
RcbHLH59RchiOBHm_Chr4g0443741464,773,328781464488Ⅲ(a+b+c)
RcbHLH60RchiOBHm_Chr4g0445091465,659,10656825275Ⅻ
RcbHLH61RchiOBHm_Chr4g0445691466,107,770671578526Ⅹ
RcbHLH62RchiOBHm_Chr5g000447152,901,73245747249Ⅳa
RcbHLH63RchiOBHm_Chr5g000479153,144,46034816272Ⅲ(a+b+c)
RcbHLH64RchiOBHm_Chr5g000483153,190,712781329443Ⅹ
RcbHLH65RchiOBHm_Chr5g000858155,519,63734573191Ⅰb
RcbHLH66RchiOBHm_Chr5g000860155,547,11523495165Ⅰb
RcbHLH67RchiOBHm_Chr5g001063157,014,42912789263Ⅴb
RcbHLH68RchiOBHm_Chr5g001341159,054,88801741247ⅩⅣ
RcbHLH69RchiOBHm_Chr5g0018101512,626,83212861287Ⅷ(a+b+c)
RcbHLH70RchiOBHm_Chr5g0024601518,681,60412711237Ⅷ(a+b+c)
RcbHLH71RchiOBHm_Chr5g0025741519,690,29734633211Ⅲ(a+b+c)
RcbHLH72RchiOBHm_Chr5g0036871531,168,132671356452Ⅹ
RcbHLH73RchiOBHm_Chr5g0037201531,555,06345699233Ⅳa
RcbHLH74RchiOBHm_Chr5g0048491545,475,2829102886962ⅩⅢ
RcbHLH75RchiOBHm_Chr5g0053301555,574,87212792264Ⅴb
RcbHLH76RchiOBHm_Chr5g0056871560,661,17634987329Ⅲ(a+b+c)
RcbHLH77RchiOBHm_Chr5g0056881560,670,256341101367Ⅲ(a+b+c)
RcbHLH78RchiOBHm_Chr5g0077341583,273,897671314438Ⅸ
RcbHLH79RchiOBHm_Chr6g024518161,110,505561020340Ⅳb
RcbHLH80RchiOBHm_Chr6g024625161,988,32123975325Ⅳa
RcbHLH81RchiOBHm_Chr6g025364168,755,304451017339Ⅷ(a+b+c)
RcbHLH82RchiOBHm_Chr6g025473169,664,16945855285Ⅹ
RcbHLH83RchiOBHm_Chr6g0257881613,317,333231095365ⅩⅣ
RcbHLH84RchiOBHm_Chr6g0264701620,040,197781272424Ⅻ
RcbHLH85RchiOBHm_Chr6g0268091624,936,75712453151Ⅲ(d+e+f)
RcbHLH86RchiOBHm_Chr6g0270891628,916,67023732244Ⅰb
RcbHLH87RchiOBHm_Chr6g0271001629,045,898232796932Orphan
RcbHLH88RchiOBHm_Chr6g0278441641,562,004891653551Ⅲ(a+b+c)
RcbHLH89RchiOBHm_Chr6g0278471641,578,713781890630Ⅲ(a+b+c)
RcbHLH90RchiOBHm_Chr6g0283511646,738,527671650550Ⅻ
RcbHLH91RchiOBHm_Chr6g0285491648,833,566781533511Ⅶ
RcbHLH92RchiOBHm_Chr6g0288541651,800,98910112190730ⅩⅢ
RcbHLH93RchiOBHm_Chr6g0288981652,186,951121434478Ⅲ(d+e+f)
RcbHLH94RchiOBHm_Chr6g0289601652,628,90456882294Ⅺ
RcbHLH95RchiOBHm_Chr6g0291161654,342,571562109703Ⅲ(d+e+f)
RcbHLH96RchiOBHm_Chr6g0301601661,956,169671434478Ⅹ
RcbHLH97RchiOBHm_Chr6g0308101666,214,82501750250Ⅷ(a+b+c)
RcbHLH98RchiOBHm_Chr6g0308241666,322,44912633211ⅩⅣ
RcbHLH99RchiOBHm_Chr6g0308251666,326,408561002334Ⅶ
RcbHLH100RchiOBHm_Chr6g0309431667,137,708341137379Ⅷ(a+b+c)
RcbHLH101RchiOBHm_Chr6g0310101667,513,823891293431Ⅻ
RcbHLH102RchiOBHm_Chr7g018012172,158,76356816272Ⅻ
RcbHLH103RchiOBHm_Chr7g018100172,715,71045750250Ⅳb
RcbHLH104RchiOBHm_Chr7g018234173,630,748451092364Ⅶ
RcbHLH105RchiOBHm_Chr7g018378174,545,99411121701567Ⅴa
RcbHLH106RchiOBHm_Chr7g018555175,672,70656855285Ⅻ
RcbHLH107RchiOBHm_Chr7g018654176,438,4169102337779ⅩⅢ
RcbHLH108RchiOBHm_Chr7g018714176,933,397121407469Ⅲ(d+e+f)
RcbHLH109RchiOBHm_Chr7g018726177,027,943121350450Ⅲ(d+e+f)
RcbHLH110RchiOBHm_Chr7g018892178,298,561341593531Ⅲ(a+b+c)
RcbHLH111RchiOBHm_Chr7g018902178,415,832781041347Ⅻ
RcbHLH112RchiOBHm_Chr7g0193761712,029,12523573191Ⅰb
RcbHLH113RchiOBHm_Chr7g0197531715,472,708781920640Ⅲ(d+e+f)
RcbHLH114RchiOBHm_Chr7g0199961717,925,10612765255Ⅰb
RcbHLH115RchiOBHm_Chr7g0209751727,192,104012082694Ⅲ(d+e+f)
RcbHLH116RchiOBHm_Chr7g0210101727,730,55823963321Ⅰa
RcbHLH117RchiOBHm_Chr7g0212241729,570,891121392464Ⅲ(d+e+f)
RcbHLH118RchiOBHm_Chr7g0227911751,177,36745672224Ⅸ
RcbHLH119RchiOBHm_Chr7g0233161757,581,440341068356Ⅲ(a+b+c)
RcbHLH120RchiOBHm_Chr7g0236841761,576,44512645215Ⅴb
RcbHLH121RchiOBHm_Chr7g0237511762,551,696121083361ⅩⅢ
1 Available at https://lipm-browsers.toulouse.inra.fr/pub/RchiOBHm-V2/ (accessed on 5 July 2022 ). 2 Chromosome. 3 Starting position (b).
Table 2. Duplication analysis of the RcbHLH gene family.
Table 2. Duplication analysis of the RcbHLH gene family.
Sequence 1Sequence 2KaKsKa/KsEffective
Len		Average
S-Sites		Average
N-Sites
RcbHLH7RcbHLH1090.443081NaNNaN1275291.6667983.3333
RcbHLH11RcbHLH1140.462303NaNNaN597133.8333463.1667
RcbHLH20RcbHLH970.3284312.6876390.1222636140496
RcbHLH21RcbHLH990.487121.7742780.274545885202.0833682.9167
RcbHLH24RcbHLH1190.2878381.6203010.1776451032222.1667809.8333
RcbHLH25RcbHLH870.4575112.8407340.1610542733555.58332177.417
RcbHLH26RcbHLH1200.598981.7984210.333059555133.8333421.1667
RcbHLH29RcbHLH650.4554574.1259440.110389537122.5414.5
RcbHLH34RcbHLH1100.3708492.1850430.1697221443325.91671117.083
RcbHLH37RcbHLH530.3924811.6398230.239344588153.5833434.4167
RcbHLH54RcbHLH1110.438746NaNNaN552122.75429.25
RcbHLH55RcbHLH1060.4353831.7275250.252027681142.3333538.6667
RcbHLH58RcbHLH1050.3670222.171150.169045981223758
RcbHLH60RcbHLH1020.2050171.256520.163163753174.1667578.8333
RcbHLH62RcbHLH730.2309571.1560310.199784693159.3333533.6667
RcbHLH64RcbHLH720.3699981.7209240.2151137258.75878.25
Table 3. Plant bHLH family genes involved in disease resistance.
Table 3. Plant bHLH family genes involved in disease resistance.
Gene NameGene IDSpeciesPathogensReferences
SlybHLH131Solyc06g051550.2.1Solanum lycopersicumTomato yellow leaf curl virus[13]
FAMAAT3G24140Arabidopsis thalianaBotrytis cinerea[22]
AtMYC2At1g32640Arabidopsis thalianaBotrytis cinerea[23]
AtbHLH13At1g01260Arabidopsis thalianaBotrytis cinerea[24]
OsbHLH6Os04g23550Oryza sativaMagnaporthe oryzae[25]
OsbHLH034Os02g49480Oryza sativaXanthomonas oryzae pv. oryzae[14]
Table 4. Expression patterns of RcbHLH genes under infection of B. cinerea.
Table 4. Expression patterns of RcbHLH genes under infection of B. cinerea.
Gene 2Accession NumberGrouplog2Ratio
30 hpi		log2Ratio
48 hpi
RcbHLH4RchiOBHm_Chr1g0348781Ⅶ−1.02302−1.36247
RcbHLH8RchiOBHm_Chr1g0361191Ⅰa−1.05954−1.91491
RcbHLH16RchiOBHm_Chr2g0091241Ⅹ0−1.13271
RcbHLH17RchiOBHm_Chr2g0093571Ⅳd3.075354.92649
RcbHLH21RchiOBHm_Chr2g0105931Ⅶ01.03517
RcbHLH29 *RchiOBHm_Chr2g0126861Ⅰb06.04668
RcbHLH32RchiOBHm_Chr2g0152511Ⅶ0−16.01
RcbHLH34RchiOBHm_Chr2g0176421Ⅲ(a+b+c)1.070311.74663
RcbHLH37RchiOBHm_Chr3g0457291ⅩⅥ−1.36188--
RcbHLH39RchiOBHm_Chr3g0462431Ⅷ(a+b+c)−1.48345--
RcbHLH40RchiOBHm_Chr3g0465361ⅩⅢ1.402292.20545
RcbHLH42RchiOBHm_Chr3g0480751Ⅻ0−1.48859
RcbHLH44RchiOBHm_Chr4g0390311Ⅳd2.85784.76511
RcbHLH46RchiOBHm_Chr4g0399211Ⅲ(a+b+c)1.253463.44205
RcbHLH50RchiOBHm_Chr4g0412071Ⅻ−1.46896−1.77088
RcbHLH53RchiOBHm_Chr4g0425781ⅩⅥ0−1.61078
RcbHLH55RchiOBHm_Chr4g0434901Ⅻ0−2.09156
RcbHLH57RchiOBHm_Chr4g0437041Ⅻ1.04454--
RcbHLH59RchiOBHm_Chr4g0443741Ⅲ(a+b+c)01.92286
RcbHLH60 *RchiOBHm_Chr4g0445091Ⅻ−1.22975−4.12905
RcbHLH62RchiOBHm_Chr5g0004471Ⅳa02.03271
RcbHLH67RchiOBHm_Chr5g0010631Ⅴb1.174781.30658
RcbHLH72RchiOBHm_Chr5g0036871Ⅹ02.48493
RcbHLH75RchiOBHm_Chr5g0053301Ⅴb−2.3709−1.67965
RcbHLH78RchiOBHm_Chr5g0077341Ⅸ−1.05564−1.12357
RcbHLH80 *RchiOBHm_Chr6g0246251Ⅳa−3.29702−2.05486
RcbHLH84RchiOBHm_Chr6g0264701Ⅻ0−1.21958
RcbHLH90RchiOBHm_Chr6g0283511Ⅻ1.643152.09937
RcbHLH91RchiOBHm_Chr6g0285491Ⅶ0−1.17746
RcbHLH92RchiOBHm_Chr6g0288541ⅩⅢ0−1.37089
RcbHLH94RchiOBHm_Chr6g0289601Ⅺ0−1.06842
RcbHLH99RchiOBHm_Chr6g0308251Ⅶ1.315292.89317
RcbHLH101RchiOBHm_Chr6g0310101Ⅻ01.23509
RcbHLH102RchiOBHm_Chr7g0180121Ⅻ0−1.80483
RcbHLH104RchiOBHm_Chr7g0182341Ⅶ0−1.28473
RcbHLH105RchiOBHm_Chr7g0183781Ⅴa−1.38441--
RcbHLH106RchiOBHm_Chr7g0185551Ⅻ01.81513
RcbHLH108RchiOBHm_Chr7g0187141Ⅲ(d+e+f)02.74536
RcbHLH109RchiOBHm_Chr7g0187261Ⅲ(d+e+f)−3.56492--
RcbHLH110RchiOBHm_Chr7g0188921Ⅲ(a+b+c)0−1.77728
RcbHLH111RchiOBHm_Chr7g0189021Ⅻ1.341342.0827
RcbHLH112 *RchiOBHm_Chr7g0193761Ⅰb1.227234.82187
RcbHLH115RchiOBHm_Chr7g0209751Ⅲ(d+e+f)01.34433
RcbHLH116RchiOBHm_Chr7g0210101Ⅰa0−3.38838
RcbHLH118RchiOBHm_Chr7g0227911Ⅸ0−1.0994
RcbHLH121RchiOBHm_Chr7g0237511ⅩⅢ0−1.02865
The log2 transformed expression profiles were obtained from the RNA-seq dataset [20]. 2 RcbHLHs upregulated are shown in bold. The genes validated by qPCR were marked with asterisks.
Table 5. List of primers used in this study.
Table 5. List of primers used in this study.
Gene NameAccession NumberPrimer Sequence (5′-3′)Amplicon LengthTaTmAmplification Efficiency
RcbHLH29RchiOBHm_Chr2g0126861F: GGTTCCACCCTAGAGGTTGTT110 bp60 °C81.692.005
R: CTGCACGGACTAGGTGAAGT
RcbHLH60RchiOBHm_Chr4g0445091F: CGATGAGTTTGGACCACCGA116 bp60 °C84.11.972
R: CCTCAGCTTTGGCCTCAAGA
RcbHLH80RchiOBHm_Chr6g0246251F: ACACAAACCAAGTGGGGGTT102 bp60 °C85.271.968
R: GTTCCCTGACTGGCCTTCAA
RcbHLH112RchiOBHm_Chr7g0193761F: CGATCTTGCAGCCTCCTACA120 bp60 °C82.432.024
R: CAACCTTGATCCGACCACCA
RcUBI2RchiOBHm_Chr1g0359561F: GCCCTGGTGCGTTCCCAACTG82 bp60 °C82.432.024
R: CCTGCGTGTCTGTCCGCATTG
Ta: amplification temperature; Tm: melting temperature.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ding, C.; Gao, J.; Zhang, S.; Jiang, N.; Su, D.; Huang, X.; Zhang, Z. The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis). Int. J. Mol. Sci. 2023, 24, 16305. https://doi.org/10.3390/ijms242216305

AMA Style

Ding C, Gao J, Zhang S, Jiang N, Su D, Huang X, Zhang Z. The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis). International Journal of Molecular Sciences. 2023; 24(22):16305. https://doi.org/10.3390/ijms242216305

Chicago/Turabian Style

Ding, Chao, Junzhao Gao, Shiya Zhang, Ning Jiang, Dongtao Su, Xinzheng Huang, and Zhao Zhang. 2023. "The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis)" International Journal of Molecular Sciences 24, no. 22: 16305. https://doi.org/10.3390/ijms242216305

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop