The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis)
Abstract
:1. Introduction
2. Results
2.1. Identification of RcbHLH Genes in Rose
2.2. Chromosomal Locations, Whole-Genome Duplication and Microsynteny
2.3. Phylogenetic and Exon-Intron Structural Analysis of Rose bHLH Genes
2.4. Expression of RcbHLH Genes in Response to B. cinerea Infection
2.5. RcbHLH112 Is a Susceptibility Gene to B. cinerea in Rose
3. Discussion
4. Materials and Methods
4.1. Identification and Characteristics of the bHLH Genes in Rose Genome
4.2. Mapping bHLH Genes on Rose Chromosomes
4.3. Phylogenetic Analyses and Structure Analysis
4.4. Collinearity Analyses and Calculation of Ratios of Non-Synonymous (Ka) to Synonymous (Ks) Nucleotide Substitution
4.5. Expression of RcbHLHs in Response to B. cinerea
4.6. VIGS and B. cinerea Inoculation Assays
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
hpi | hours post inoculation; |
bHLH | basic/helix–loop–helix; |
Ka/Ks | Ratios of non-synonymous to synonymous mutation frequencies; |
ABA | abscisic acid; |
VIGS | virus-induced gene silencing; |
HMM | Hidden Markov Model; |
WGD | whole-genome duplication; |
Ka | non-synonymous mutation frequency; |
Ks | synonymous mutation frequency; |
NJ | neighbour-joining method; |
TAIR | The Arabidopsis Information Resources; |
TRV2 | tobacco rattle virus; |
NCBI | National Center for Biotechnology Information; |
RPKM | reads per kb per million reads. |
References
- Dou, L.; Zhang, X.; Pang, C.; Song, M.; Wei, H.; Fan, S.; Yu, S. Genome-wide analysis of the WRKY gene family in cotton. Mol. Genet. Genom. 2014, 289, 1103–1121. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Han, Y.; Li, D.; Lin, Y.; Cai, Y. MYB Transcription Factors in Chinese Pear (Pyrus bretschneideri Rehd.): Genome-Wide Identification, Classification, and Expression Profiling during Fruit Development. Front. Plant Sci. 2016, 7, 577. [Google Scholar] [CrossRef] [PubMed]
- Murre, C.; McCaw, P.S.; Vaessin, H.; Caudy, M.; Jan, L.; Jan, Y.; Cabrera, C.V.; Buskin, J.N.; Hauschka, S.D.; Lassar, A.B.; et al. Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 1989, 58, 537–544. [Google Scholar] [CrossRef]
- Ledent, V.; Vervoort, M. The basic helix-loop-helix protein family: Comparative genomics and phylogenetic analysis. Genome Res. 2001, 11, 754–770. [Google Scholar] [CrossRef] [PubMed]
- Toledo-Ortiz, G.; Huq, E.; Quail, P.H. The Arabidopsis basic/helix-loop-helix transcription factor family. Plant Cell 2003, 15, 1749–1770. [Google Scholar] [CrossRef]
- Skinner, M.K.; Rawls, A.; Wilson-Rawls, J.; Roalson, E.H. Basic helix-loop-helix transcription factor gene family phylogenetics and nomenclature. Differentiation 2010, 80, 1–8. [Google Scholar] [CrossRef]
- Mateo, J.L.; Berg, D.L.v.D.; Haeussler, M.; Drechsel, D.; Gaber, Z.B.; Castro, D.S.; Robson, P.; Lu, Q.R.; Crawford, G.E.; Flicek, P.; et al. Characterization of the neural stem cell gene regulatory network identifies OLIG2 as a multifunctional regulator of self-renewal. Genome Res. 2015, 25, 41–56. [Google Scholar] [CrossRef]
- Imayoshi, I.; Kageyama, R. bHLH factors in self-renewal, multipotency, and fate choice of neural progenitor cells. Neuron 2014, 82, 9–23. [Google Scholar] [CrossRef] [PubMed]
- Ellenberger, T.; Fass, D.; Arnaud, M.; Harrison, S.C. Crystal structure of transcription factor E47: E-box recognition by a basic region helix-loop-helix dimer. Genes Dev. 1994, 8, 970–980. [Google Scholar] [CrossRef]
- Nesi, N.; Debeaujon, I.; Jond, C.; Pelletier, G.; Caboche, M.; Lepiniec, L. The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 2000, 12, 1863–1878. [Google Scholar] [CrossRef]
- Massari, M.E.; Murre, C. Helix-loop-helix proteins: Regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 2000, 20, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Lin, R.; Feng, J.; Qiu, D.; Chen, W.; Xu, S. Wheat bHLH transcription factor gene, TabHLH060, enhances susceptibility of transgenic Arabidopsis thaliana to Pseudomonas syringae. Physiol. Mol. Plant Pathol. 2015, 90, 123–130. [Google Scholar] [CrossRef]
- Wang, J.; Hu, Z.; Zhao, T.; Yang, Y.; Chen, T.; Yang, M.; Yu, W.; Zhang, B. Genome-wide analysis of bHLH transcription factor and involvement in the infection by yellow leaf curl virus in tomato (Solanum lycopersicum). BMC Genom. 2015, 16, 39. [Google Scholar] [CrossRef] [PubMed]
- Onohata, T.; Gomi, K. Overexpression of jasmonate-responsive OsbHLH034 in rice results in the induction of bacterial blight resistance via an increase in lignin biosynthesis. Plant Cell Rep. 2020, 39, 1175–1184. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Fan, Z.; Qiu, L.; Che, Q.; Wang, T.; Li, Y.; Wang, Y. MdbHLH130, an Apple bHLH Transcription Factor, Confers Water Stress Resistance by Regulating Stomatal Closure and ROS Homeostasis in Transgenic Tobacco. Front. Plant Sci. 2020, 11, 543696. [Google Scholar] [CrossRef]
- Ji, X.; Nie, X.; Liu, Y.; Zheng, L.; Zhao, H.; Zhang, B.; Huo, L.; Wang, Y. A bHLH gene from Tamarix hispida improves abiotic stress tolerance by enhancing osmotic potential and decreasing reactive oxygen species accumulation. Tree Physiol. 2016, 36, 193–207. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Tai, H.; Li, S.; Gao, W.; Zhao, M.; Xie, C.; Li, W. bHLH122 is important for drought and osmotic stress resistance in Arabidopsis and in the repression of ABA catabolism. New Phytol. 2014, 201, 1192–1204. [Google Scholar] [CrossRef]
- Zhang, N.; Hecht, C.; Sun, X.; Fei, Z.; Martin, G.B. Loss of function of the bHLH transcription factor Nrd1 in tomato enhances resistance to Pseudomonas syringae. Plant Physiol. 2022, 190, 1334–1348. [Google Scholar] [CrossRef]
- Liorzou, M.; Pernet, A.; Li, S.; Chastellier, A.; Thouroude, T.; Michel, G.; Malécot, V.; Gaillard, S.; Briée, C.; Foucher, F.; et al. Nineteenth century French rose (Rosa sp.) germplasm shows a shift over time from a European to an Asian genetic background. J. Exp. Bot. 2016, 67, 4711–4725. [Google Scholar] [CrossRef]
- Liu, X.; Cao, X.; Shi, S.; Zhao, N.; Li, D.; Fang, P.; Chen, X.; Qi, W.; Zhang, Z. Comparative RNA-Seq analysis reveals a critical role for brassinosteroids in rose (Rosa hybrida) petal defense against Botrytis cinerea infection. BMC Genet. 2018, 19, 62. [Google Scholar] [CrossRef]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Yang, R.; Chen, H. The Arabidopsis thaliana Mediator subunit MED8 regulates plant immunity to Botrytis Cinerea through interacting with the basic helix-loop-helix (bHLH) transcription factor FAMA. PLoS ONE 2018, 13, e0193458. [Google Scholar] [CrossRef] [PubMed]
- Lorenzo, O.; Chico, J.M.; Saénchez-Serrano, J.J.; Solano, R. JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 2004, 16, 1938–1950. [Google Scholar] [CrossRef]
- Huang, H.; Gao, H.; Liu, B.; Fan, M.; Wang, J.; Wang, C.; Tian, H.; Wang, L.; Xie, C.; Wu, D.; et al. bHLH13 Regulates Jasmonate-Mediated Defense Responses and Growth. Evol. Bioinform. 2018, 14, 1176934318790265. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Lu, H.; Guo, H.; Wang, Y.; Zhao, P.; Li, Y.; Wang, F.; Xu, J.; Mo, X.; Mao, C. OsbHLH6 interacts with OsSPX4 and regulates the phosphate starvation response in rice. Plant J. 2021, 105, 649–667. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Duan, X.; Jiang, H.; Sun, Y.; Tang, Y.; Yuan, Z.; Guo, J.; Liang, W.; Chen, L.; Yin, J.; et al. Genome-wide analysis of basic/helix-loop-helix transcription factor family in rice and Arabidopsis. Plant Physiol. 2006, 141, 1167–1184. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Zhao, P.; Kong, N.; Lu, R.; Pei, Y.; Huang, C.; Ma, H.; Chen, Q. Genome-Wide Identification and Characterization of the Potato bHLH Transcription Factor Family. Genes 2018, 9, 54. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Lv, W.; Zhang, H.; Ma, L.; Li, P.; Ge, L.; Li, G. Genome-wide analysis of the basic Helix-Loop-Helix (bHLH) transcription factor family in maize. BMC Plant Biol. 2018, 18, 235. [Google Scholar] [CrossRef]
- Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
- Chen, C.; Xia, R.; Chen, H.; He, Y. TBtools, a toolkit for biologists integrating various HTS-data handling tools with a user-friendly interface. bioRxiv 2018, 1, 289660. [Google Scholar]
- Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.-H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
- Wu, L.; Ma, N.; Jia, Y.; Zhang, Y.; Feng, M.; Jiang, C.-Z.; Ma, C.; Gao, J. An Ethylene-Induced Regulatory Module Delays Flower Senescence by Regulating Cytokinin Content. Plant Physiol. 2017, 173, 853–862. [Google Scholar] [CrossRef]
- Liu, Y.; Schiff, M.; Dinesh-Kumar, S.P. Virus-induced gene silencing in tomato. Plant J. 2002, 31, 777–786. [Google Scholar] [CrossRef]
Gene | Accession Number 1 | Chr. 2 | Position 3 | Intron | Extron | CDS (bp) | Amino Acids | Clade |
---|---|---|---|---|---|---|---|---|
RcbHLH1 | RchiOBHm_Chr1g0314891 | 1 | 2,173,916 | 7 | 8 | 1296 | 432 | Ⅸ |
RcbHLH2 | RchiOBHm_Chr1g0321521 | 1 | 9,045,543 | 1 | 2 | 708 | 236 | Ⅰb |
RcbHLH3 | RchiOBHm_Chr1g0337011 | 1 | 28,673,606 | 2 | 3 | 1371 | 457 | Ⅱ |
RcbHLH4 | RchiOBHm_Chr1g0348781 | 1 | 41,770,117 | 5 | 6 | 1404 | 468 | Ⅶ |
RcbHLH5 | RchiOBHm_Chr1g0355211 | 1 | 47,903,940 | 7 | 8 | 1944 | 648 | Ⅲ(d+e+f) |
RcbHLH6 | RchiOBHm_Chr1g0360001 | 1 | 51,822,366 | 1 | 2 | 1851 | 617 | Ⅲ(d+e+f) |
RcbHLH7 | RchiOBHm_Chr1g0360811 | 1 | 52,697,497 | 0 | 1 | 1464 | 488 | Ⅲ(d+e+f) |
RcbHLH8 | RchiOBHm_Chr1g0361191 | 1 | 53,198,215 | 3 | 4 | 1254 | 418 | Ⅰa |
RcbHLH9 | RchiOBHm_Chr1g0368211 | 1 | 58,410,232 | 1 | 2 | 708 | 236 | Ⅰb |
RcbHLH10 | RchiOBHm_Chr1g0370561 | 1 | 60,070,116 | 1 | 2 | 795 | 265 | Ⅴb |
RcbHLH11 | RchiOBHm_Chr1g0376001 | 1 | 63,269,742 | 1 | 2 | 918 | 306 | Ⅰb |
RcbHLH12 | RchiOBHm_Chr1g0376011 | 1 | 63,276,165 | 1 | 2 | 570 | 190 | Ⅰb |
RcbHLH13 | RchiOBHm_Chr1g0376061 | 1 | 63,317,042 | 1 | 2 | 711 | 237 | Ⅰb |
RcbHLH14 | RchiOBHm_Chr1g0380101 | 1 | 65,866,341 | 2 | 3 | 1098 | 366 | Ⅰa |
RcbHLH15 | RchiOBHm_Chr2g0085911 | 2 | 1,182,817 | 6 | 7 | 1263 | 421 | Ⅺ |
RcbHLH16 | RchiOBHm_Chr2g0091241 | 2 | 4,891,265 | 6 | 7 | 1158 | 386 | Ⅹ |
RcbHLH17 | RchiOBHm_Chr2g0093571 | 2 | 6,833,754 | 6 | 7 | 1743 | 581 | Ⅳd |
RcbHLH18 | RchiOBHm_Chr2g0096091 | 2 | 8,997,567 | 6 | 7 | 1293 | 431 | Ⅺ |
RcbHLH19 | RchiOBHm_Chr2g0099391 | 2 | 11,611,832 | 4 | 5 | 954 | 318 | Ⅳb |
RcbHLH20 | RchiOBHm_Chr2g0105811 | 2 | 17,067,752 | 0 | 1 | 753 | 251 | Ⅷ(a+b+c) |
RcbHLH21 | RchiOBHm_Chr2g0105931 | 2 | 17,187,821 | 7 | 8 | 1128 | 376 | Ⅶ |
RcbHLH22 | RchiOBHm_Chr2g0109611 | 2 | 20,986,271 | 3 | 4 | 1056 | 352 | Ⅳa |
RcbHLH23 | RchiOBHm_Chr2g0109621 | 2 | 21,006,834 | 4 | 5 | 1062 | 354 | Ⅳa |
RcbHLH24 | RchiOBHm_Chr2g0109941 | 2 | 21,287,305 | 3 | 4 | 1101 | 367 | Ⅲ(a+b+c) |
RcbHLH25 | RchiOBHm_Chr2g0111201 | 2 | 22,786,895 | 2 | 3 | 3825 | 1275 | Orphan |
RcbHLH26 | RchiOBHm_Chr2g0111351 | 2 | 22,988,391 | 1 | 2 | 624 | 208 | Ⅴb |
RcbHLH27 | RchiOBHm_Chr2g0112221 | 2 | 24,091,959 | 2 | 3 | 996 | 332 | Ⅰa |
RcbHLH28 | RchiOBHm_Chr2g0120331 | 2 | 33,053,648 | 0 | 1 | 849 | 283 | Ⅷ(a+b+c) |
RcbHLH29 | RchiOBHm_Chr2g0126861 | 2 | 41,432,994 | 2 | 3 | 678 | 226 | Ⅰb |
RcbHLH30 | RchiOBHm_Chr2g0139261 | 2 | 56,883,003 | 8 | 9 | 1026 | 342 | Ⅹ |
RcbHLH31 | RchiOBHm_Chr2g0141851 | 2 | 59,398,516 | 0 | 1 | 1308 | 436 | Ⅷ(a+b+c) |
RcbHLH32 | RchiOBHm_Chr2g0152511 | 2 | 69,890,195 | 8 | 9 | 1617 | 539 | Ⅶ |
RcbHLH33 | RchiOBHm_Chr2g0160481 | 2 | 76,321,485 | 0 | 1 | 912 | 304 | Ⅷ(a+b+c) |
RcbHLH34 | RchiOBHm_Chr2g0176421 | 2 | 88,244,910 | 3 | 4 | 1503 | 501 | Ⅲ(a+b+c) |
RcbHLH35 | RchiOBHm_Chr3g0451111 | 3 | 2,350,386 | 6 | 7 | 999 | 333 | Ⅺ |
RcbHLH36 | RchiOBHm_Chr3g0454211 | 3 | 4,346,874 | 2 | 3 | 1020 | 340 | Ⅰa |
RcbHLH37 | RchiOBHm_Chr3g0457291 | 3 | 6,478,569 | 1 | 2 | 591 | 197 | ⅩⅥ |
RcbHLH38 | RchiOBHm_Chr3g0458701 | 3 | 7,313,238 | 8 | 9 | 2184 | 728 | Ⅶ |
RcbHLH39 | RchiOBHm_Chr3g0462431 | 3 | 10,114,223 | 0 | 1 | 768 | 256 | Ⅷ(a+b+c) |
RcbHLH40 | RchiOBHm_Chr3g0465361 | 3 | 12,152,414 | 9 | 10 | 2079 | 693 | ⅩⅢ |
RcbHLH41 | RchiOBHm_Chr3g0480621 | 3 | 26,445,394 | 5 | 6 | 1032 | 344 | Ⅸ |
RcbHLH42 | RchiOBHm_Chr3g0480751 | 3 | 26,579,491 | 6 | 7 | 1077 | 359 | Ⅻ |
RcbHLH43 | RchiOBHm_Chr3g0493491 | 3 | 40,682,138 | 4 | 5 | 891 | 297 | Ⅷ(a+b+c) |
RcbHLH44 | RchiOBHm_Chr4g0390311 | 4 | 5,608,794 | 2 | 3 | 792 | 264 | Ⅳd |
RcbHLH45 | RchiOBHm_Chr4g0392401 | 4 | 7,811,073 | 3 | 4 | 678 | 226 | Ⅳa |
RcbHLH46 | RchiOBHm_Chr4g0399211 | 4 | 16,381,854 | 4 | 5 | 735 | 245 | Ⅲ(a+b+c) |
RcbHLH47 | RchiOBHm_Chr4g0403251 | 4 | 22,342,021 | 5 | 6 | 465 | 155 | Ⅻ |
RcbHLH48 | RchiOBHm_Chr4g0405961 | 4 | 26,941,409 | 5 | 6 | 501 | 167 | Ⅹ |
RcbHLH49 | RchiOBHm_Chr4g0409001 | 4 | 32,037,594 | 5 | 6 | 1302 | 434 | Ⅸ |
RcbHLH50 | RchiOBHm_Chr4g0412071 | 4 | 35,820,711 | 7 | 8 | 1662 | 554 | Ⅻ |
RcbHLH51 | RchiOBHm_Chr4g0415421 | 4 | 40,124,051 | 4 | 5 | 1341 | 447 | Ⅰa |
RcbHLH52 | RchiOBHm_Chr4g0418301 | 4 | 43,688,763 | 2 | 3 | 609 | 203 | Ⅰa |
RcbHLH53 | RchiOBHm_Chr4g0425781 | 4 | 51,377,284 | 0 | 1 | 681 | 227 | ⅩⅥ |
RcbHLH54 | RchiOBHm_Chr4g0429161 | 4 | 53,995,807 | 6 | 7 | 558 | 186 | Ⅻ |
RcbHLH55 | RchiOBHm_Chr4g0434901 | 4 | 58,544,648 | 5 | 6 | 720 | 240 | Ⅻ |
RcbHLH56 | RchiOBHm_Chr4g0435901 | 4 | 59,312,260 | 3 | 4 | 1062 | 354 | Ⅴb |
RcbHLH57 | RchiOBHm_Chr4g0437041 | 4 | 60,257,934 | 8 | 9 | 1647 | 549 | Ⅻ |
RcbHLH58 | RchiOBHm_Chr4g0437281 | 4 | 60,431,122 | 6 | 7 | 1008 | 336 | Ⅴa |
RcbHLH59 | RchiOBHm_Chr4g0443741 | 4 | 64,773,328 | 7 | 8 | 1464 | 488 | Ⅲ(a+b+c) |
RcbHLH60 | RchiOBHm_Chr4g0445091 | 4 | 65,659,106 | 5 | 6 | 825 | 275 | Ⅻ |
RcbHLH61 | RchiOBHm_Chr4g0445691 | 4 | 66,107,770 | 6 | 7 | 1578 | 526 | Ⅹ |
RcbHLH62 | RchiOBHm_Chr5g0004471 | 5 | 2,901,732 | 4 | 5 | 747 | 249 | Ⅳa |
RcbHLH63 | RchiOBHm_Chr5g0004791 | 5 | 3,144,460 | 3 | 4 | 816 | 272 | Ⅲ(a+b+c) |
RcbHLH64 | RchiOBHm_Chr5g0004831 | 5 | 3,190,712 | 7 | 8 | 1329 | 443 | Ⅹ |
RcbHLH65 | RchiOBHm_Chr5g0008581 | 5 | 5,519,637 | 3 | 4 | 573 | 191 | Ⅰb |
RcbHLH66 | RchiOBHm_Chr5g0008601 | 5 | 5,547,115 | 2 | 3 | 495 | 165 | Ⅰb |
RcbHLH67 | RchiOBHm_Chr5g0010631 | 5 | 7,014,429 | 1 | 2 | 789 | 263 | Ⅴb |
RcbHLH68 | RchiOBHm_Chr5g0013411 | 5 | 9,054,888 | 0 | 1 | 741 | 247 | ⅩⅣ |
RcbHLH69 | RchiOBHm_Chr5g0018101 | 5 | 12,626,832 | 1 | 2 | 861 | 287 | Ⅷ(a+b+c) |
RcbHLH70 | RchiOBHm_Chr5g0024601 | 5 | 18,681,604 | 1 | 2 | 711 | 237 | Ⅷ(a+b+c) |
RcbHLH71 | RchiOBHm_Chr5g0025741 | 5 | 19,690,297 | 3 | 4 | 633 | 211 | Ⅲ(a+b+c) |
RcbHLH72 | RchiOBHm_Chr5g0036871 | 5 | 31,168,132 | 6 | 7 | 1356 | 452 | Ⅹ |
RcbHLH73 | RchiOBHm_Chr5g0037201 | 5 | 31,555,063 | 4 | 5 | 699 | 233 | Ⅳa |
RcbHLH74 | RchiOBHm_Chr5g0048491 | 5 | 45,475,282 | 9 | 10 | 2886 | 962 | ⅩⅢ |
RcbHLH75 | RchiOBHm_Chr5g0053301 | 5 | 55,574,872 | 1 | 2 | 792 | 264 | Ⅴb |
RcbHLH76 | RchiOBHm_Chr5g0056871 | 5 | 60,661,176 | 3 | 4 | 987 | 329 | Ⅲ(a+b+c) |
RcbHLH77 | RchiOBHm_Chr5g0056881 | 5 | 60,670,256 | 3 | 4 | 1101 | 367 | Ⅲ(a+b+c) |
RcbHLH78 | RchiOBHm_Chr5g0077341 | 5 | 83,273,897 | 6 | 7 | 1314 | 438 | Ⅸ |
RcbHLH79 | RchiOBHm_Chr6g0245181 | 6 | 1,110,505 | 5 | 6 | 1020 | 340 | Ⅳb |
RcbHLH80 | RchiOBHm_Chr6g0246251 | 6 | 1,988,321 | 2 | 3 | 975 | 325 | Ⅳa |
RcbHLH81 | RchiOBHm_Chr6g0253641 | 6 | 8,755,304 | 4 | 5 | 1017 | 339 | Ⅷ(a+b+c) |
RcbHLH82 | RchiOBHm_Chr6g0254731 | 6 | 9,664,169 | 4 | 5 | 855 | 285 | Ⅹ |
RcbHLH83 | RchiOBHm_Chr6g0257881 | 6 | 13,317,333 | 2 | 3 | 1095 | 365 | ⅩⅣ |
RcbHLH84 | RchiOBHm_Chr6g0264701 | 6 | 20,040,197 | 7 | 8 | 1272 | 424 | Ⅻ |
RcbHLH85 | RchiOBHm_Chr6g0268091 | 6 | 24,936,757 | 1 | 2 | 453 | 151 | Ⅲ(d+e+f) |
RcbHLH86 | RchiOBHm_Chr6g0270891 | 6 | 28,916,670 | 2 | 3 | 732 | 244 | Ⅰb |
RcbHLH87 | RchiOBHm_Chr6g0271001 | 6 | 29,045,898 | 2 | 3 | 2796 | 932 | Orphan |
RcbHLH88 | RchiOBHm_Chr6g0278441 | 6 | 41,562,004 | 8 | 9 | 1653 | 551 | Ⅲ(a+b+c) |
RcbHLH89 | RchiOBHm_Chr6g0278471 | 6 | 41,578,713 | 7 | 8 | 1890 | 630 | Ⅲ(a+b+c) |
RcbHLH90 | RchiOBHm_Chr6g0283511 | 6 | 46,738,527 | 6 | 7 | 1650 | 550 | Ⅻ |
RcbHLH91 | RchiOBHm_Chr6g0285491 | 6 | 48,833,566 | 7 | 8 | 1533 | 511 | Ⅶ |
RcbHLH92 | RchiOBHm_Chr6g0288541 | 6 | 51,800,989 | 10 | 11 | 2190 | 730 | ⅩⅢ |
RcbHLH93 | RchiOBHm_Chr6g0288981 | 6 | 52,186,951 | 1 | 2 | 1434 | 478 | Ⅲ(d+e+f) |
RcbHLH94 | RchiOBHm_Chr6g0289601 | 6 | 52,628,904 | 5 | 6 | 882 | 294 | Ⅺ |
RcbHLH95 | RchiOBHm_Chr6g0291161 | 6 | 54,342,571 | 5 | 6 | 2109 | 703 | Ⅲ(d+e+f) |
RcbHLH96 | RchiOBHm_Chr6g0301601 | 6 | 61,956,169 | 6 | 7 | 1434 | 478 | Ⅹ |
RcbHLH97 | RchiOBHm_Chr6g0308101 | 6 | 66,214,825 | 0 | 1 | 750 | 250 | Ⅷ(a+b+c) |
RcbHLH98 | RchiOBHm_Chr6g0308241 | 6 | 66,322,449 | 1 | 2 | 633 | 211 | ⅩⅣ |
RcbHLH99 | RchiOBHm_Chr6g0308251 | 6 | 66,326,408 | 5 | 6 | 1002 | 334 | Ⅶ |
RcbHLH100 | RchiOBHm_Chr6g0309431 | 6 | 67,137,708 | 3 | 4 | 1137 | 379 | Ⅷ(a+b+c) |
RcbHLH101 | RchiOBHm_Chr6g0310101 | 6 | 67,513,823 | 8 | 9 | 1293 | 431 | Ⅻ |
RcbHLH102 | RchiOBHm_Chr7g0180121 | 7 | 2,158,763 | 5 | 6 | 816 | 272 | Ⅻ |
RcbHLH103 | RchiOBHm_Chr7g0181001 | 7 | 2,715,710 | 4 | 5 | 750 | 250 | Ⅳb |
RcbHLH104 | RchiOBHm_Chr7g0182341 | 7 | 3,630,748 | 4 | 5 | 1092 | 364 | Ⅶ |
RcbHLH105 | RchiOBHm_Chr7g0183781 | 7 | 4,545,994 | 11 | 12 | 1701 | 567 | Ⅴa |
RcbHLH106 | RchiOBHm_Chr7g0185551 | 7 | 5,672,706 | 5 | 6 | 855 | 285 | Ⅻ |
RcbHLH107 | RchiOBHm_Chr7g0186541 | 7 | 6,438,416 | 9 | 10 | 2337 | 779 | ⅩⅢ |
RcbHLH108 | RchiOBHm_Chr7g0187141 | 7 | 6,933,397 | 1 | 2 | 1407 | 469 | Ⅲ(d+e+f) |
RcbHLH109 | RchiOBHm_Chr7g0187261 | 7 | 7,027,943 | 1 | 2 | 1350 | 450 | Ⅲ(d+e+f) |
RcbHLH110 | RchiOBHm_Chr7g0188921 | 7 | 8,298,561 | 3 | 4 | 1593 | 531 | Ⅲ(a+b+c) |
RcbHLH111 | RchiOBHm_Chr7g0189021 | 7 | 8,415,832 | 7 | 8 | 1041 | 347 | Ⅻ |
RcbHLH112 | RchiOBHm_Chr7g0193761 | 7 | 12,029,125 | 2 | 3 | 573 | 191 | Ⅰb |
RcbHLH113 | RchiOBHm_Chr7g0197531 | 7 | 15,472,708 | 7 | 8 | 1920 | 640 | Ⅲ(d+e+f) |
RcbHLH114 | RchiOBHm_Chr7g0199961 | 7 | 17,925,106 | 1 | 2 | 765 | 255 | Ⅰb |
RcbHLH115 | RchiOBHm_Chr7g0209751 | 7 | 27,192,104 | 0 | 1 | 2082 | 694 | Ⅲ(d+e+f) |
RcbHLH116 | RchiOBHm_Chr7g0210101 | 7 | 27,730,558 | 2 | 3 | 963 | 321 | Ⅰa |
RcbHLH117 | RchiOBHm_Chr7g0212241 | 7 | 29,570,891 | 1 | 2 | 1392 | 464 | Ⅲ(d+e+f) |
RcbHLH118 | RchiOBHm_Chr7g0227911 | 7 | 51,177,367 | 4 | 5 | 672 | 224 | Ⅸ |
RcbHLH119 | RchiOBHm_Chr7g0233161 | 7 | 57,581,440 | 3 | 4 | 1068 | 356 | Ⅲ(a+b+c) |
RcbHLH120 | RchiOBHm_Chr7g0236841 | 7 | 61,576,445 | 1 | 2 | 645 | 215 | Ⅴb |
RcbHLH121 | RchiOBHm_Chr7g0237511 | 7 | 62,551,696 | 1 | 2 | 1083 | 361 | ⅩⅢ |
Sequence 1 | Sequence 2 | Ka | Ks | Ka/Ks | Effective Len | Average S-Sites | Average N-Sites |
---|---|---|---|---|---|---|---|
RcbHLH7 | RcbHLH109 | 0.443081 | NaN | NaN | 1275 | 291.6667 | 983.3333 |
RcbHLH11 | RcbHLH114 | 0.462303 | NaN | NaN | 597 | 133.8333 | 463.1667 |
RcbHLH20 | RcbHLH97 | 0.328431 | 2.687639 | 0.1222 | 636 | 140 | 496 |
RcbHLH21 | RcbHLH99 | 0.48712 | 1.774278 | 0.274545 | 885 | 202.0833 | 682.9167 |
RcbHLH24 | RcbHLH119 | 0.287838 | 1.620301 | 0.177645 | 1032 | 222.1667 | 809.8333 |
RcbHLH25 | RcbHLH87 | 0.457511 | 2.840734 | 0.161054 | 2733 | 555.5833 | 2177.417 |
RcbHLH26 | RcbHLH120 | 0.59898 | 1.798421 | 0.333059 | 555 | 133.8333 | 421.1667 |
RcbHLH29 | RcbHLH65 | 0.455457 | 4.125944 | 0.110389 | 537 | 122.5 | 414.5 |
RcbHLH34 | RcbHLH110 | 0.370849 | 2.185043 | 0.169722 | 1443 | 325.9167 | 1117.083 |
RcbHLH37 | RcbHLH53 | 0.392481 | 1.639823 | 0.239344 | 588 | 153.5833 | 434.4167 |
RcbHLH54 | RcbHLH111 | 0.438746 | NaN | NaN | 552 | 122.75 | 429.25 |
RcbHLH55 | RcbHLH106 | 0.435383 | 1.727525 | 0.252027 | 681 | 142.3333 | 538.6667 |
RcbHLH58 | RcbHLH105 | 0.367022 | 2.17115 | 0.169045 | 981 | 223 | 758 |
RcbHLH60 | RcbHLH102 | 0.205017 | 1.25652 | 0.163163 | 753 | 174.1667 | 578.8333 |
RcbHLH62 | RcbHLH73 | 0.230957 | 1.156031 | 0.199784 | 693 | 159.3333 | 533.6667 |
RcbHLH64 | RcbHLH72 | 0.369998 | 1.720924 | 0.215 | 1137 | 258.75 | 878.25 |
Gene Name | Gene ID | Species | Pathogens | References |
---|---|---|---|---|
SlybHLH131 | Solyc06g051550.2.1 | Solanum lycopersicum | Tomato yellow leaf curl virus | [13] |
FAMA | AT3G24140 | Arabidopsis thaliana | Botrytis cinerea | [22] |
AtMYC2 | At1g32640 | Arabidopsis thaliana | Botrytis cinerea | [23] |
AtbHLH13 | At1g01260 | Arabidopsis thaliana | Botrytis cinerea | [24] |
OsbHLH6 | Os04g23550 | Oryza sativa | Magnaporthe oryzae | [25] |
OsbHLH034 | Os02g49480 | Oryza sativa | Xanthomonas oryzae pv. oryzae | [14] |
Gene 2 | Accession Number | Group | log2Ratio 30 hpi | log2Ratio 48 hpi |
---|---|---|---|---|
RcbHLH4 | RchiOBHm_Chr1g0348781 | Ⅶ | −1.02302 | −1.36247 |
RcbHLH8 | RchiOBHm_Chr1g0361191 | Ⅰa | −1.05954 | −1.91491 |
RcbHLH16 | RchiOBHm_Chr2g0091241 | Ⅹ | 0 | −1.13271 |
RcbHLH17 | RchiOBHm_Chr2g0093571 | Ⅳd | 3.07535 | 4.92649 |
RcbHLH21 | RchiOBHm_Chr2g0105931 | Ⅶ | 0 | 1.03517 |
RcbHLH29 * | RchiOBHm_Chr2g0126861 | Ⅰb | 0 | 6.04668 |
RcbHLH32 | RchiOBHm_Chr2g0152511 | Ⅶ | 0 | −16.01 |
RcbHLH34 | RchiOBHm_Chr2g0176421 | Ⅲ(a+b+c) | 1.07031 | 1.74663 |
RcbHLH37 | RchiOBHm_Chr3g0457291 | ⅩⅥ | −1.36188 | -- |
RcbHLH39 | RchiOBHm_Chr3g0462431 | Ⅷ(a+b+c) | −1.48345 | -- |
RcbHLH40 | RchiOBHm_Chr3g0465361 | ⅩⅢ | 1.40229 | 2.20545 |
RcbHLH42 | RchiOBHm_Chr3g0480751 | Ⅻ | 0 | −1.48859 |
RcbHLH44 | RchiOBHm_Chr4g0390311 | Ⅳd | 2.8578 | 4.76511 |
RcbHLH46 | RchiOBHm_Chr4g0399211 | Ⅲ(a+b+c) | 1.25346 | 3.44205 |
RcbHLH50 | RchiOBHm_Chr4g0412071 | Ⅻ | −1.46896 | −1.77088 |
RcbHLH53 | RchiOBHm_Chr4g0425781 | ⅩⅥ | 0 | −1.61078 |
RcbHLH55 | RchiOBHm_Chr4g0434901 | Ⅻ | 0 | −2.09156 |
RcbHLH57 | RchiOBHm_Chr4g0437041 | Ⅻ | 1.04454 | -- |
RcbHLH59 | RchiOBHm_Chr4g0443741 | Ⅲ(a+b+c) | 0 | 1.92286 |
RcbHLH60 * | RchiOBHm_Chr4g0445091 | Ⅻ | −1.22975 | −4.12905 |
RcbHLH62 | RchiOBHm_Chr5g0004471 | Ⅳa | 0 | 2.03271 |
RcbHLH67 | RchiOBHm_Chr5g0010631 | Ⅴb | 1.17478 | 1.30658 |
RcbHLH72 | RchiOBHm_Chr5g0036871 | Ⅹ | 0 | 2.48493 |
RcbHLH75 | RchiOBHm_Chr5g0053301 | Ⅴb | −2.3709 | −1.67965 |
RcbHLH78 | RchiOBHm_Chr5g0077341 | Ⅸ | −1.05564 | −1.12357 |
RcbHLH80 * | RchiOBHm_Chr6g0246251 | Ⅳa | −3.29702 | −2.05486 |
RcbHLH84 | RchiOBHm_Chr6g0264701 | Ⅻ | 0 | −1.21958 |
RcbHLH90 | RchiOBHm_Chr6g0283511 | Ⅻ | 1.64315 | 2.09937 |
RcbHLH91 | RchiOBHm_Chr6g0285491 | Ⅶ | 0 | −1.17746 |
RcbHLH92 | RchiOBHm_Chr6g0288541 | ⅩⅢ | 0 | −1.37089 |
RcbHLH94 | RchiOBHm_Chr6g0289601 | Ⅺ | 0 | −1.06842 |
RcbHLH99 | RchiOBHm_Chr6g0308251 | Ⅶ | 1.31529 | 2.89317 |
RcbHLH101 | RchiOBHm_Chr6g0310101 | Ⅻ | 0 | 1.23509 |
RcbHLH102 | RchiOBHm_Chr7g0180121 | Ⅻ | 0 | −1.80483 |
RcbHLH104 | RchiOBHm_Chr7g0182341 | Ⅶ | 0 | −1.28473 |
RcbHLH105 | RchiOBHm_Chr7g0183781 | Ⅴa | −1.38441 | -- |
RcbHLH106 | RchiOBHm_Chr7g0185551 | Ⅻ | 0 | 1.81513 |
RcbHLH108 | RchiOBHm_Chr7g0187141 | Ⅲ(d+e+f) | 0 | 2.74536 |
RcbHLH109 | RchiOBHm_Chr7g0187261 | Ⅲ(d+e+f) | −3.56492 | -- |
RcbHLH110 | RchiOBHm_Chr7g0188921 | Ⅲ(a+b+c) | 0 | −1.77728 |
RcbHLH111 | RchiOBHm_Chr7g0189021 | Ⅻ | 1.34134 | 2.0827 |
RcbHLH112 * | RchiOBHm_Chr7g0193761 | Ⅰb | 1.22723 | 4.82187 |
RcbHLH115 | RchiOBHm_Chr7g0209751 | Ⅲ(d+e+f) | 0 | 1.34433 |
RcbHLH116 | RchiOBHm_Chr7g0210101 | Ⅰa | 0 | −3.38838 |
RcbHLH118 | RchiOBHm_Chr7g0227911 | Ⅸ | 0 | −1.0994 |
RcbHLH121 | RchiOBHm_Chr7g0237511 | ⅩⅢ | 0 | −1.02865 |
Gene Name | Accession Number | Primer Sequence (5′-3′) | Amplicon Length | Ta | Tm | Amplification Efficiency |
---|---|---|---|---|---|---|
RcbHLH29 | RchiOBHm_Chr2g0126861 | F: GGTTCCACCCTAGAGGTTGTT | 110 bp | 60 °C | 81.69 | 2.005 |
R: CTGCACGGACTAGGTGAAGT | ||||||
RcbHLH60 | RchiOBHm_Chr4g0445091 | F: CGATGAGTTTGGACCACCGA | 116 bp | 60 °C | 84.1 | 1.972 |
R: CCTCAGCTTTGGCCTCAAGA | ||||||
RcbHLH80 | RchiOBHm_Chr6g0246251 | F: ACACAAACCAAGTGGGGGTT | 102 bp | 60 °C | 85.27 | 1.968 |
R: GTTCCCTGACTGGCCTTCAA | ||||||
RcbHLH112 | RchiOBHm_Chr7g0193761 | F: CGATCTTGCAGCCTCCTACA | 120 bp | 60 °C | 82.43 | 2.024 |
R: CAACCTTGATCCGACCACCA | ||||||
RcUBI2 | RchiOBHm_Chr1g0359561 | F: GCCCTGGTGCGTTCCCAACTG | 82 bp | 60 °C | 82.43 | 2.024 |
R: CCTGCGTGTCTGTCCGCATTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, C.; Gao, J.; Zhang, S.; Jiang, N.; Su, D.; Huang, X.; Zhang, Z. The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis). Int. J. Mol. Sci. 2023, 24, 16305. https://doi.org/10.3390/ijms242216305
Ding C, Gao J, Zhang S, Jiang N, Su D, Huang X, Zhang Z. The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis). International Journal of Molecular Sciences. 2023; 24(22):16305. https://doi.org/10.3390/ijms242216305
Chicago/Turabian StyleDing, Chao, Junzhao Gao, Shiya Zhang, Ning Jiang, Dongtao Su, Xinzheng Huang, and Zhao Zhang. 2023. "The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis)" International Journal of Molecular Sciences 24, no. 22: 16305. https://doi.org/10.3390/ijms242216305