Regulatory Effects of the Kiss1 Gene in the Testis on Puberty and Reproduction in Hezuo and Landrance Boars
Abstract
:1. Introduction
2. Results
2.1. Morphological Analysis of Testicular Tissue from HZ and LC Boars
2.2. CDS Sequence Characteristics of HZ Boars Kiss1
2.3. Physicochemical Properties and Structure Analysis of HZ Boars Kiss1 Protein
2.4. Expression Patterns of Kiss1 at the Transcript and Protein Levels in Developmental Testes of HZ and LC Boars
2.5. Immunolocalization of Kiss1 Protein in Developmental Testes of HZ and LC Boars
3. Discussion
4. Materials and Methods
4.1. Animals and Sample Collection
4.2. H&E Staining of Testis Tissues from HZ and LC Boars
4.3. RNA Extraction and cDNA Synthesis
4.4. Cloning of HZ Boars Kiss1 Gene
4.5. Bioinformatics Analysis of the Kiss1 Gene in HZ Boars
4.6. Quantitative Real-Time PCR (qRT-PCR) Assay of the Kiss1 Gene in HZ and LC Boars
4.7. Western Blot Analysis of the Kiss1 Protein in HZ and LC Boars
4.8. Immunohistochemistry of the Kiss1 Protein in HZ and LC Boars
4.9. Data Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abreu, A.P.; Kaiser, U.B. Pubertal Development and Regulation. Lancet Diabetes Endocrinol. 2016, 4, 254–264. [Google Scholar] [CrossRef]
- Lucaccioni, L.; Trevisani, V.; Marrozzini, L.; Bertoncelli, N.; Predieri, B.; Lugli, L.; Berardi, A.; Iughetti, L. Endocrine-Disrupting Chemicals and Their Effects during Female Puberty: A Review of Current Evidence. Int. J. Mol. Sci. 2020, 21, 2078. [Google Scholar] [CrossRef] [PubMed]
- Palumbo, S.; Cirillo, G.; Aiello, F.; Papparella, A.; del Giudice, E.M.; Grandone, A. MKRN3 Role in Regulating Pubertal Onset: The State of Art of Functional Studies. Front. Endocrinol. 2022, 13, 991322. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Zhang, X.D.; Ning, W.; Zhang, X.D.; Ru, Z.Y.; Wang, S.Q.; Sheng, M.; Zhang, J.R.; Zhang, X.Y.; Luo, H.Q.; et al. Expression Analysis of Circular RNAs in Young and Sexually Mature Boar Testes. Animals 2021, 11, 1430. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Gao, Q.; Li, T.J.; Liu, R.F.; Cheng, Z.C.; Guo, M.; Xiao, J.H.; Wu, D.; Zeng, W.X. Sertoli Cell and Spermatogonial Development in Pigs. J. Anim. Sci. Biotechnol. 2022, 13, 45. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Wang, X.; Zhang, H.; Chen, Z.; Zhao, X.; Ma, Y. Histomorphological Comparisons and Expression Patterns of BOLL Gene in Sheep Testes at Different Development Stages. Animals 2019, 9, 105. [Google Scholar] [CrossRef] [PubMed]
- Ashraf, M.; Zeeshan, M.; Ahmad, N.; Javed, K.; Riaz, A.; Riaz, H. Changes in the Testicular Histomorphometry and Their Association with Genes Expression Pattern of Testes from Birth to Puberty in Beetal Goat Kids. Small Rumin. Res. 2022, 210, 106666. [Google Scholar] [CrossRef]
- Choi, J.-H.; Yoo, H.-W. Control of Puberty: Genetics, Endocrinology, and Environment. Curr. Opin. Endocrinol. 2013, 20, 62–68. [Google Scholar] [CrossRef]
- Terasawa, E.; Fernandez, D.L. Neurobiological Mechanisms of the Onset of Puberty in Primates. Endocr. Rev. 2001, 22, 111–151. [Google Scholar]
- Rey, R.A. The Role of Androgen Signaling in Male Sexual Development at Puberty. Endocrinology 2021, 162, bqaa215. [Google Scholar] [CrossRef]
- Kuohung, W.; Kaiser, U.B. GPR54 and KiSS-1: Role in the Regulation of Puberty and Reproduction. Rev. Endocr. Metab. Dis. 2006, 7, 257–263. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Welch, D.R. Suppression of Metastasis in Human Breast Carcinoma MDA-MB-435 Cells after Transfection with the Metastasis Suppressor Gene, KiSS-1. Cancer Res. 1997, 57, 2384–2387. [Google Scholar] [PubMed]
- Poling, M.C.; Kauffman, A.S. Sexually Dimorphic Testosterone Secretion in Prenatal and Neonatal Mice Is Independent of Kisspeptin-Kiss1r and GnRH Signaling. Endocrinology 2012, 153, 782–793. [Google Scholar] [CrossRef] [PubMed]
- Salehi, S.; Adeshina, I.; Chen, H.; Zirkin, B.R.; Hussain, M.A.; Wondisford, F.; Wolfe, A.; Radovick, S. Developmental and Endocrine Regulation of Kisspeptin Expression in Mouse Leydig Cells. Endocrinology 2015, 156, 1514–1522. [Google Scholar] [CrossRef] [PubMed]
- Katulski, K.; Podfigurna, A.; Czyzyk, A.; Meczekalski, B.; Genazzani, A.D. Kisspeptin and LH pulsatile temporal coupling in PCOS patients. Endocrine 2018, 61, 149–157. [Google Scholar] [CrossRef] [PubMed]
- Dhillo, W.S. Kisspeptin: A Novel Regulator of Reproductive Function. J. Neuroendocrinol. 2008, 20, 963–970. [Google Scholar] [CrossRef] [PubMed]
- Gottsch, M.L.; Cunningham, M.J.; Smith, J.T.; Popa, S.M.; Acohido, B.V.; Crowley, W.F.; Seminara, S.; Clifton, D.K.; Steiner, R.A. A Role for Kisspeptins in the Regulation of Gonadotropin Secretion in the Mouse. Endocrinology 2004, 145, 4073–4077. [Google Scholar] [CrossRef]
- Uenoyama, Y.; Nakamura, S.; Hayakawa, Y.; Ikegami, K.; Watanabe, Y.; Deura, C.; Minabe, S.; Tomikawa, J.; Goto, T.; Ieda, N.; et al. Lack of Pulse and Surge Modes and Glutamatergic Stimulation of Luteinising Hormone Release in Kiss1 Knockout Rats. J. Neuroendocrinol. 2015, 27, 187–197. [Google Scholar] [CrossRef]
- Silveira, L.G.; Noel, S.D.; Silveira-Neto, A.P.; Abreu, A.P.; Brito, V.N.; Santos, M.G.; Bianco, S.D.C.; Kuohung, W.; Xu, S.; Gryngarten, M.; et al. Mutations of the KISS1 Gene in Disorders of Puberty. J. Clin. Endocr. Metab. 2010, 95, 2276–2280. [Google Scholar] [CrossRef]
- Cao, Y.; Li, Z.; Jiang, W.; Ling, Y.; Kuang, H. Reproductive Functions of Kisspeptin/KISS1R Systems in the Periphery. Reprod. Biol. Endocrinol. 2019, 17, 65. [Google Scholar] [CrossRef]
- Navarro, V.M.; Fernandez-Fernandez, R.; Castellano, J.M.; Roa, J.; Mayen, A.; Barreiro, M.L.; Gaytan, F.; Aguilar, E.; Pinilla, L.; Dieguez, C.; et al. Advanced Vaginal Opening and Precocious Activation of the Reproductive Axis by KiSS-1 Peptide, the Endogenous Ligand of GPR54. J. Physiol. 2004, 561, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Anjum, S.; Krishna, A.; Sridaran, R.; Tsutsui, K. Localization of Gonadotropin-Releasing Hormone (GnRH), Gonadotropin-Inhibitory Hormone (GnIH), Kisspeptin and GnRH Receptor and Their Possible Roles in Testicular Activities from Birth to Senescence in Mice. J. Exp. Zool. Part A 2012, 317A, 630–644. [Google Scholar] [CrossRef] [PubMed]
- Mei, H.; Doran, J.; Kyle, V.; Yeo, S.-H.; Colledge, W.H. Does Kisspeptin Signaling Have a Role in the Testes? Front. Endocrinol. 2013, 4, 198. [Google Scholar] [CrossRef] [PubMed]
- Samir, H.; Nagaoka, K.; Karen, A.; Ahmed, E.; El Sayed, M.; Watanabe, G. Investigation the mRNA Expression of KISS1 and Localization of Kisspeptin in the Testes of Shiba Goats and Its Relationship with the Puberty and Steriodogenic Enzymes. Small Rumin. Res. 2015, 133, 1–6. [Google Scholar] [CrossRef]
- Selvaraj, S.; Kitano, H.; Fujinaga, Y.; Ohga, H.; Yoneda, M.; Yamaguchi, A.; Shimizu, A.; Matsuyama, M. Molecular Characterization, Tissue Distribution, and mRNA Expression Profiles of two Kiss Genes in the Adult Male and Female Chub Mackerel (Scomber japonicus) during Different Gonadal Stages. Gen. Comp. Endocrinol. 2010, 169, 28–38. [Google Scholar] [CrossRef] [PubMed]
- Tariq, A.R.; Shahab, M.; Clarke, I.J.; Pereira, A.; Smith, J.T.; Khan, S.-u.-H.; Sultan, J.; Javed, S.; Anwar, T. Kiss1 and Kiss1 Receptor Expression in the Rhesus Monkey Testis: A Possible Local Regulator of Testicular Function. Cent. Eur. J. Biol. 2013, 8, 968–974. [Google Scholar] [CrossRef]
- Ohtaki, T.; Shintani, Y.; Honda, S.; Matsumoto, H.; Hori, A.; Kanehashi, K.; Terao, Y.; Kumano, S.; Takatsu, Y.; Masuda, Y.; et al. Metastasis Suppressor Gene KiSS-1 Encodes Peptide Ligand of a G-protein-coupled Receptor. Nature 2001, 411, 613–617. [Google Scholar] [CrossRef]
- Pinto, F.M.; Cejudo-Roman, A.; Ravina, C.G.; Fernandez-Sanchez, M.; Martin-Lozano, D.; Illanes, M.; Tena-Sempere, M.; Candenas, M.L. Characterization of the Kisspeptin System in Human Spermatozoa. Int. J. Androl. 2012, 35, 63–73. [Google Scholar] [CrossRef]
- Wang, J.-Y.; Hsu, M.-C.; Tseng, T.-H.; Wu, L.-S.; Yang, K.-T.; Chiu, C.-H. Kisspeptin Expression in Mouse Leydig Cells Correlates with Age. J. Chin. Med. Assoc. 2015, 78, 249–257. [Google Scholar] [CrossRef]
- Han, Y.; Peng, X.; Si, W.; Liu, G.; Han, Y.; Jiang, X.; Na, R.; Yang, L.; Wu, J.; Guangxin, E.; et al. Local Expressions and Function of Kiss1/GPR54 in goats’ testes. Gene 2020, 738, 144488. [Google Scholar] [CrossRef]
- Samir, H.; Nagaoka, K.; Watanabe, G. Effect of Kisspeptin Antagonist on Goat in Vitro Leydig Cell Steroidogenesis. Theriogenology 2018, 121, 134–140. [Google Scholar] [CrossRef] [PubMed]
- Selvaraj, S.; Ohga, H.; Kitano, H.; Nyuji, M.; Yamaguchi, A.; Matsuyama, M. Peripheral Administration of Kiss1 Pentadecapeptide Induces Gonadal Development in Sexually Immature Adult Scombroid Fish. Zool. Sci. 2013, 30, 446–454. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Yan, Z.; Wang, P.; Yang, Q.; Huang, X.; Shi, H.; Tang, Y.; Ji, Y.; Zhang, J.; Gun, S. Identification and Characterization of lncRNA and mRNA in Testes of Landrace and Hezuo Boars. Animals 2021, 11, 2263. [Google Scholar] [CrossRef] [PubMed]
- Lunstra, D.D.; Ford, J.J.; Klindt, J.; Wise, T.H. Physiology of the Meishan boar. J. Reprod. Fertil. Suppl. 1997, 52, 181–193. [Google Scholar]
- Franca, L.R.; Silva, V.A., Jr.; Chiarini-Garcia, H.; Garcia, S.K.; Debeljuk, L. Cell Proliferation and Hormonal Changes during Postnatal Development of the Testis in the Pig. Biol. Reprod. 2000, 63, 1629–1636. [Google Scholar] [CrossRef]
- Paixao, G.; Esteves, A.; Carolino, N.; dos Anjos Pires, M.; Payan-Carreira, R. Evaluation of Gonadal Macroscopic and Microscopic Morphometry Reveals Rrecocious Puberty in Bisaro Pig. Reprod. Domest. Anim. 2020, 55, 1706–1713. [Google Scholar] [CrossRef] [PubMed]
- Ding, H.; Luo, Y.; Liu, M.; Huang, J.; Xu, D. Histological and Transcriptome Analyses of Testes from Duroc and Meishan Boars. Sci. Rep. 2016, 6, 20758. [Google Scholar] [CrossRef]
- Kotani, M.; Detheux, M.; Vandenbogaerde, A.; Communi, D.; Vanderwinden, J.M.; Le Poul, E.; Brezillon, S.; Tyldesley, R.; Suarez-Huerta, N.; Vandeput, F.; et al. The Metastasis Suppressor Gene KiSS-1 Encodes kisspeptins, the Natural Ligands of the Orphan G protein-coupled Receptor GPR54. J. Biol. Chem. 2001, 276, 34631–34636. [Google Scholar] [CrossRef]
- Han, S.-K.; Gottsch, M.L.; Lee, K.J.; Popa, S.M.; Smith, J.T.; Jakawich, S.K.; Clifton, D.K.; Steiner, R.A.; Herbison, A.E. Activation of Gonadotropin-releasing Hormone Neurons by kisspeptin As a Neuroendocrine Switch for the Onset of Puberty. J. Neurosci. 2005, 25, 11349–11356. [Google Scholar] [CrossRef]
- Shahab, M.; Mastronardi, C.; Seminara, S.B.; Crowley, W.F.; Ojeda, S.R.; Plant, T.M. Increased Hypothalamic GPR54 Signaling: A Potential Mechanism for Initiation of Puberty in Primates. Proc. Natl. Acad. Sci. USA 2005, 102, 2129–2134. [Google Scholar] [CrossRef]
- Han, Y.; Zhao, Y.; Si, W.; Jiang, X.; Wu, J.; Na, R.; Han, Y.; Li, K.; Yang, L.; Guangxin, E.; et al. Temporal Expression of the KISS1/GPR54 System in Goats’ Testes and Epididymides and Its Spatial Expression in Pubertal Goats. Theriogenology 2020, 152, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Feng, T.; Bai, J.H.; Xu, X.L.; Liu, Y. Kisspeptin and Its Effect on Mammalian Spermatogensis. Curr. Drug Metab. 2019, 20, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Pinilla, L.; Aguilar, E.; Dieguez, C.; Millar, R.P.; Tena-Sempere, M. Kisspeptins and Reproduction: Physiological Roles and Regulatory Mechanisms. Physiol. Rev. 2012, 92, 1235–1316. [Google Scholar] [CrossRef] [PubMed]
- Ullah, H.; Nabi, G.; Zubair, H.; Ullah, R.; Shahab, M. Age-dependent Changes in the Reproductive Axis Responsiveness to Kisspeptin-10 Administration in Healthy Men. Andrologia 2019, 51, e13219. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Nie, H.; Duan, S.; Yan, P.; Izaz, A.; Wang, R.; Zhou, Y.; Wu, X. Cloning, Characterisation and Expression Profile of kisspeptin1 and the kisspeptin1 Receptor in the Hypothalamic-pituitary-ovarian Axis of Chinese Alligator sinensis during the Reproductive Cycle. Reprod. Fert. Develop. 2020, 32, 792–804. [Google Scholar] [CrossRef] [PubMed]
- van Aerle, R.; Kille, P.; Lange, A.; Tyler, C.R. Evidence for the Existence of a Functional Kiss1/Kiss1 Receptor Pathway in Fish. Peptides 2008, 29, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Liu, L.; Li, Z.; Wang, D.; Li, N.; Song, Y.; Guo, C.; Liu, X. Molecular Cloning and Characterization of kiss1 in Brandt’s Voles (Lasiopodomys brandtii). Comp. Biochem. Phys. B 2017, 208, 68–74. [Google Scholar] [CrossRef] [PubMed]
- Tomikawa, J.; Homma, T.; Tajima, S.; Shibata, T.; Inamoto, Y.; Takase, K.; Inoue, N.; Ohkura, S.; Uenoyama, Y.; Maeda, K.-I.; et al. Molecular Characterization and Estrogen Regulation of Hypothalamic KISS1 Gene in the Pig. Biol. Reprod. 2010, 82, 313–319. [Google Scholar] [CrossRef]
- Cao, G.L.; Chu, M.X.; Fang, L.; Di, R.; Feng, T.; Li, N. Analysis on DNA Sequence of KiSS-1 Gene and Its Association with Litter Size in Goats. Mol. Biol. Rep. 2010, 37, 3921–3929. [Google Scholar] [CrossRef]
- Seminara, S.B.; Kaiser, U.B. New Gatekeepers of Reproduction: GPR54 and Its Cognate Ligand, KiSS-1. Endocrinology 2005, 146, 1686–1688. [Google Scholar] [CrossRef]
- Sivalingam, M.; Parhar, I.S. Hypothalamic kisspeptin and kisspeptin receptors: Species variation in reproduction and reproductive behaviours. Front. Neuroendocrinol. 2022, 64, 100951. [Google Scholar] [CrossRef] [PubMed]
- Xun, W.J.; Cao, T.; Zhou, H.L.; Hou, G.Y.; Shi, L.G. Expression and localization of Kiss-1 gene in the testis of Wuzhishan pigs at different developmental stages. China Anim. Husb. Vet. Med. 2015, 42, 370–374. [Google Scholar]
- Irfan, S.; Ehmcke, J.; Shahab, M.; Wistuba, J.; Schlatt, S. Immunocytochemical Localization of Kisspeptin and Kisspeptin Receptor in the Primate Testis. J. Med. Primatol. 2016, 45, 105–111. [Google Scholar] [CrossRef] [PubMed]
- Hsu, M.-C.; Wang, J.-Y.; Lee, Y.-J.; Jong, D.-S.; Tsui, K.-H.; Chiu, C.-H. Kisspeptin Modulates Fertilization Capacity of Mouse Spermatozoa. Reproduction 2014, 147, 835–845. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, H.; L’Hernault, S.W. Spermatogenesis. Curr. Biol. 2017, 27, R988–R994. [Google Scholar] [CrossRef] [PubMed]
- Rouhana, L.; Chong, T.; Newmark, P.A. Analysis of Morphogenesis and Flagellar Assembly During Spermatogenesis in Planarian Flatworms. Methods Mol. Biol. 2022, 2364, 199–216. [Google Scholar] [PubMed]
- Selvaraj, S.; Ohga, H.; Nyuji, M.; Kitano, H.; Nagano, N.; Yamaguchi, A.; Matsuyama, M. Subcutaneous Administration of Kiss1 Pentadecapeptide Accelerates Spermatogenesis in Prepubertal Male Chub Mackerel (Scomber japonicus). Comp. Biochem. Phys. A 2013, 166, 228–236. [Google Scholar] [CrossRef]
- Avelar, G.F.; Oliveira, C.F.A.; Soares, J.M.; Silva, I.J.; Dobrinski, I.; Hess, R.A.; Franca, L.R. Postnatal Somatic Cell Proliferation and Seminiferous Tubule Maturation in Pigs: A Non-random Event. Theriogenology 2010, 74, 11–23. [Google Scholar] [CrossRef]
- McCoard, S.A.; Lunstra, D.D.; Wise, T.H.; Ford, J.J. Specific Staining of Sertoli Cell Nuclei and Evaluation of Sertoli Cell Number and Proliferative Activity in Meishan and White Composite Boars during the Neonatal Period. Biol. Reprod. 2001, 64, 689–695. [Google Scholar] [CrossRef]
Gene | Sequence (5′-3′) | Length/bp | Utilization | Accession No. |
---|---|---|---|---|
Kiss1 | F: CCAGGATGAATGCACTGGTT | 433 | cloning | NM_001134964.1 |
R: GTTTGAAGGTCTCAGTCTCG | ||||
Kiss1 | F: ATGCACTGGTTTTTTGGCAGCTGAT | 98 | qRT-PCR | NM_001134964.1 |
R: TGTAGATCTAGGATTCTCCATGGGT | ||||
β-actin | F: ATATTGCTGCGCTCGTGGT | 148 | qRT-PCR | XM_003124280.5 |
R: TAGGAGTCCTTCTGGCCCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, H.; Yan, Z.; Du, H.; Tang, Y.; Song, K.; Yang, Q.; Huang, X.; Wang, P.; Gao, X.; Yang, J.; et al. Regulatory Effects of the Kiss1 Gene in the Testis on Puberty and Reproduction in Hezuo and Landrance Boars. Int. J. Mol. Sci. 2023, 24, 16700. https://doi.org/10.3390/ijms242316700
Shi H, Yan Z, Du H, Tang Y, Song K, Yang Q, Huang X, Wang P, Gao X, Yang J, et al. Regulatory Effects of the Kiss1 Gene in the Testis on Puberty and Reproduction in Hezuo and Landrance Boars. International Journal of Molecular Sciences. 2023; 24(23):16700. https://doi.org/10.3390/ijms242316700
Chicago/Turabian StyleShi, Haixia, Zunqiang Yan, Hong Du, Yuran Tang, Kelin Song, Qiaoli Yang, Xiaoyu Huang, Pengfei Wang, Xiaoli Gao, Jiaojiao Yang, and et al. 2023. "Regulatory Effects of the Kiss1 Gene in the Testis on Puberty and Reproduction in Hezuo and Landrance Boars" International Journal of Molecular Sciences 24, no. 23: 16700. https://doi.org/10.3390/ijms242316700