Key Genes of Immunity Associated with Pterygium and Primary Sjögren’s Syndrome
Abstract
:1. Introduction
2. Results
2.1. Identification of DEGs and Intersection Set in Pterygium Growth and pSS
2.2. GO and KEGG Enrichment Pathway Analysis
2.3. PPI Network Analysis and Hub Gene Selection
2.4. Hub Genes Expression in Clinical Samples
3. Discussion
4. Materials and Methods
4.1. Microarray Data Collection
4.2. Data Processing and Identification of DEGs
4.3. Functional Enrichment Analyses for Intersection DEGs
4.4. Construction of PPI Network and Identification of Hub Genes
4.5. Acquisition of Clinical Samples
4.6. Tissue RNA Extraction and Quantitative Real-Time PCR (qPCR)
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Coroneo, M.T.; Tat, L.; Chen, H.; Grupchev, D.I.; Grupcheva, C.N.; Ip, M.H. Handing it to pterygium: Explaining pterygium laterality. Ocul. Surf. 2021, 19, 63–67. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.; Wang, J.; Tian, J.; Deng, X.; Balayan, A.; Sun, Y.; Xiang, Y.; Guan, J.; Schimelman, J.; Hwang, H.; et al. Rapid 3D bioprinting of a multicellular model recapitulating pterygium microenvironment. Biomaterials 2022, 282, 12391. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.C.; Lin, C.L.; Chen, Z.T.Y.; Hu, F.R.; Sung, F.C.; Wang, I.J. Risk of Skin Cancer in Patients with Pterygium: A Nationwide Population-Based Cohort Study in Taiwan. Ocul. Surf. 2014, 12, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Zloto, O.; Greenbaum, E.; Fabian, I.D.; Ben Simon, G.J. Evicel versus Tisseel versus Sutures for Attaching Conjunctival Autograft in Pterygium Surgery. Ophthalmology 2017, 124, 61–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cunha, C.C.; Berezovsky, A.; Furtado, J.M.; Ferraz, N.N.; Fernandes, A.G.; Muñoz, S.; Salomão, S.R. Presbyopia and Ocular Conditions Causing Near Vision Impairment in Older Adults from the Brazilian Amazon Region. Am. J. Ophthalmol. 2018, 196, 72–81. [Google Scholar] [CrossRef]
- Moussa, K.; Shantha, J.; Schallhorn, J.M. Blurry Vision and Eye Pain after Pterygium Surgery. JAMA Ophthalmol. 2018, 136, 827. [Google Scholar] [CrossRef]
- Bikbov, M.M.; Zainullin, R.M.; Kazakbaeva, G.M.; Gilmanshin, T.R.; Salavatova, V.F.; Arslangareeva, I.I.; Jonas, J.B. Pterygium Prevalence and Its Associations in a Russian Population: The Ural Eye and Medical Study. Am. J. Ophthalmol. 2019, 205, 27–34. [Google Scholar] [CrossRef]
- Fernandes, A.G.; Salomão, S.R.; Ferraz, N.N.; Mitsuhiro, M.H.; Furtado, J.M.; Muñoz, S.; Berezovsky, A. Pterygium in adults from the Brazilian Amazon Region: Prevalence, visual status and refractive errors. Br. J. Ophthalmol. 2020, 104, 757–763. [Google Scholar] [CrossRef]
- Janson, B.; Sikder, S. Surgical management of pterygium. Ocul. Surf. 2014, 12, 112–119. [Google Scholar] [CrossRef]
- Khanna, R.C.; Marmamula, S.; Cicinelli, M.V.; Mettla, A.L.; Giridhar, P.; Banerjee, S.; Shekhar, K.; Chakrabarti, S.; Murthy, G.V.S.; Gilbert, C.E.; et al. Fifteen-year incidence rate and risk factors of pterygium in the Southern Indian state of Andhra Pradesh. Br. J. Ophthalmol. 2021, 105, 619–624. [Google Scholar] [CrossRef]
- Wang, Y.; Shan, G.; Gan, L.; Qian, Y.; Chen, T.; Wang, H.; Pan, X.; Wang, W.; Pan, L.; Zhang, X.; et al. Prevalence and associated factors for pterygium in Han and Mongolian adults: A cross-sectional study in inner Mongolian, China. BMC Ophthalmol. 2020, 20, 45. [Google Scholar] [CrossRef] [Green Version]
- Prat, D.; Zloto, O.; Ben Artsi, E.; Ben Simon, G.J. Therapeutic contact lenses vs. tight bandage patching and pain following pterygium excision: A prospective randomized controlled study. Graefe’s Arch. Clin. Exp. Ophthalmol. 2018, 256, 2143–2148. [Google Scholar] [CrossRef]
- Alsarhani, W.; Alshahrani, S.; Showail, M.; Alhabdan, N.; Alsumari, O.; Almalki, A.; Alsarhani, A.; Alluhaidan, A.; Alqahtani, B. Characteristics and recurrence of pterygium in Saudi Arabia: A single center study with a long follow-up. BMC Ophthalmol. 2021, 21, 207. [Google Scholar] [CrossRef]
- Julio, G.; Lluch, S.; Pujol, P.; Alonso, S.; Merindano, D. Tear osmolarity and ocular changes in pterygium. Cornea 2012, 31, 1417–1421. [Google Scholar] [CrossRef]
- Tan, J.; Vollmer-Conna, U.; Tat, L.; Coroneo, M. Dry-Eye Disease in Recurrent Pterygium. Ophthalmic Res. 2019, 61, 199–203. [Google Scholar] [CrossRef]
- Kampitak, K.; Leelawongtawun, W.; Leeamornsiri, S.; Suphachearaphan, W. Role of artificial tears in reducing the recurrence of pterygium after surgery: A prospective randomized controlled trial. Acta. Ophthalmol. 2017, 95, e227–e229. [Google Scholar] [CrossRef]
- Bjordal, O.; Norheim, K.B.; Rødahl, E.; Jonsson, R.; Omdal, R. Primary Sjögren’s syndrome and the eye. Surv. Ophthalmol. 2020, 65, 119–132. [Google Scholar] [CrossRef] [Green Version]
- Bartoloni, E.; Alunno, A.; Valentini, V.; Valentini, E.; La Paglia, G.M.C.; Leone, M.C.; Cafaro, G.; Marcucci, E.; Bonifacio, A.F.; Luccioli, F.; et al. The prevalence and relevance of traditional cardiovascular risk factors in primary Sjögren’s syndrome. Clin. Exp. Rheumatol. 2018, 36, S113–S120. [Google Scholar]
- Jan, R.L.; Ho, C.H.; Wang, J.J.; Tseng, S.H.; Chang, Y.S. Associations between Sjögren Syndrome, Sociodemographic Factors, Comorbid Conditions, and Scleritis in a Taiwanese Population-Based Study. J. Pers. Med. 2022, 12, 105. [Google Scholar] [CrossRef]
- Vehof, J.; Utheim, T.P.; Bootsma, H.; Hammond, C.J. Advances, limitations and future perspectives in the diagnosis and management of dry eye in Sjögren’s syndrome. Clin. Exp. Rheumatol. 2020, 38, S301–S309. [Google Scholar]
- Zhao, S.; Le, Q. Analysis of the first tear film break-up point in Sjögren’s syndrome and non-Sjögren’s syndrome dry eye patients. BMC Ophthalmol. 2022, 22, 1. [Google Scholar] [CrossRef] [PubMed]
- Coursey, T.G.; Tukler, H.J.; Barbosa, F.L.; de Paiva, C.S.; Pflugfelder, S.C. Interferon-γ-Induced Unfolded Protein Response in Conjunctival Goblet Cells as a Cause of Mucin Deficiency in Sjögren Syndrome. Am. J. Pathol. 2016, 186, 1547–1558. [Google Scholar] [CrossRef]
- Singh, S.; Das, A.V.; Basu, S. Ocular Involvement in Sjögren Syndrome: Risk Factors for Severe Visual Impairment and Vision-Threatening Corneal Complications. Am. J. Ophthalmol. 2021, 225, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez-Arcelus, M.; Baglaenko, Y.; Arora, J.; Hannes, S.; Luo, Y.; Amariuta, T.; Esko, T.; Brenner, M.B.; Raychaudhuri, S. Allele-specific expression changes dynamically during T cell activation in HLA and other autoimmune loci. Nat. Genet. 2020, 52, 247–253. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Ruiz, R.; Niewold, T.B. Type I Interferons in Autoimmunity. J. Investig. Dermatol. 2022, 142, 793–803. [Google Scholar] [CrossRef]
- Xu, Y.; Qiao, C.; He, S.; Lu, C.; Dong, S.; Wu, X.; Zheng, F. Identification of Functional Genes in Pterygium Based on Bioinformatics Analysis. Biomed Res. Int. 2020, 2020, 2383516. [Google Scholar] [CrossRef]
- He, S.; Sun, H.; Huang, Y.; Dong, S.; Qiao, C.; Zhang, S.; Yang, G. Identification and Interaction Analysis of Significant Genes and MicroRNAs in Pterygium. Biomed Res. Int. 2019, 2019, 2767512. [Google Scholar] [CrossRef] [Green Version]
- Shibata, N.; Ishida, H.; Kiyokawa, E.; Singh, D.P.; Sasaki, H.; Kubo, E. Relative gene expression analysis of human pterygium tissues and UV radiation-evoked gene expression patterns in corneal and conjunctival cells. Exp. Eye Res. 2020, 199, 108194. [Google Scholar] [CrossRef]
- Cui, J.; Li, H.; Wang, T.; Shen, Q.; Yang, Y.; Yu, X.; Hu, H. Novel Immune-Related Genetic Expression for Primary Sjögren’s Syndrome. Front. Med. 2021, 8, 719958. [Google Scholar] [CrossRef]
- Li, N.; Li, Y.; Hu, J.; Wu, Y.; Yang, J.; Fan, H.; Li, L.; Luo, D.; Ye, Y.; Gao, Y.; et al. A Link Between Mitochondrial Dysfunction and the Immune Microenvironment of Salivary Glands in Primary Sjogren’s Syndrome. Front. Immunol. 2022, 13, 845209. [Google Scholar] [CrossRef]
- Macleod, T.; Berekmeri, A.; Bridgewood, C.; Stacey, M.; McGonagle, D.; Wittmann, M. The Immunological Impact of IL-1 Family Cytokines on the Epidermal Barrier. Front. Immunol. 2021, 12, 808012. [Google Scholar] [CrossRef]
- Migliorini, P.; Italiani, P.; Pratesi, F.; Puxeddu, I.; Boraschi, D. The IL-1 family cytokines and receptors in autoimmune diseases. Autoimmun. Rev. 2020, 19, 102617. [Google Scholar] [CrossRef]
- Pinteaux, E.; Abdulaal, W.H.; Mufazalov, I.A.; Humphreys, N.E.; Simonsen-Jackson, M.; Francis, S.; Müller, W.; Waisman, A. Cell-specific conditional deletion of interleukin-1 (IL-1) ligands and its receptors: A new toolbox to study the role of IL-1 in health and disease. J. Mol. Med. 2020, 98, 923–930. [Google Scholar] [CrossRef]
- Seltzer, J.; Moorad, R.; Schifano, J.M.; Landis, J.T.; Dittmer, D.P. Interleukin-1 Receptor-Associated Kinase (IRAK) Signaling in Kaposi Sarcoma-Associated Herpesvirus-Induced Primary Effusion Lymphoma. J. Virol. 2020, 94, e02123-19. [Google Scholar] [CrossRef]
- Scarneo, S.A.; Hughes, P.F.; Yang, K.W.; Carlson, D.A.; Gurbani, D.; Westover, K.D.; Haystead, T.A.J. A highly selective inhibitor of interleukin-1 receptor-associated kinases 1/4 (IRAK-1/4) delineates the distinct signaling roles of IRAK-1/4 and the TAK1 kinase. J. Biol. Chem. 2020, 295, 1565–1574. [Google Scholar] [CrossRef]
- Chang, J.; Burkett, P.R.; Borges, C.M.; Kuchroo, V.K.; Turka, L.A.; Chang, C.H. MyD88 is essential to sustain mTOR activation necessary to promote T helper 17 cell proliferation by linking IL-1 and IL-23 signaling. Proc. Natl. Acad. Sci. USA 2013, 110, 2270–2275. [Google Scholar] [CrossRef] [Green Version]
- Zoukhri, D.; Macari, E.; Choi, S.H.; Kublin, C.L. C-Jun NH2-terminal kinase mediates interleukin-1beta-induced inhibition of lacrimal gland secretion. J. Neurochem. 2006, 96, 126–135. [Google Scholar] [CrossRef] [Green Version]
- Özçaka, Ö.; Alpöz, E.; Nalbantsoy, A.; Karabulut, G.; Kabasakal, Y. Clinical periodontal status and inflammatory cytokines in primary Sjögren syndrome and rheumatoid arthritis. J. Periodontol. 2018, 89, 959–965. [Google Scholar] [CrossRef]
- Contreras-Ruiz, L.; Mir, F.A.; Turpie, B.; Krauss, A.H.; Masli, S. Sjögren’s syndrome associated dry eye in a mouse model is ameliorated by topical application of integrin α4 antagonist GW559090. Exp. Eye Res. 2016, 143, 1–8. [Google Scholar] [CrossRef]
- Chen, Y.T.; Lazarev, S.; Bahrami, A.F.; Noble, L.B.; Chen, F.Y.; Zhou, D.; Gallup, M.; Yadav, M.; McNamara, N.A. Interleukin-1 receptor mediates the interplay between CD4+ T cells and ocular resident cells to promote keratinizing squamous metaplasia in Sjögren’s syndrome. Lab. Investig. 2012, 92, 556–570. [Google Scholar] [CrossRef] [Green Version]
- Cui, Y.H.; Feng, Q.Y.; Liu, Q.; Li, H.Y.; Song, X.L.; Hu, Z.X.; Xu, Z.Y.; Li, J.H.; Li, M.J.; Zheng, W.L.; et al. Posttranscriptional regulation of MMP-9 by HuR contributes to IL-1β-induced pterygium fibroblast migration and invasion. J. Cell. Physiol. 2020, 235, 5130–5140. [Google Scholar] [CrossRef] [PubMed]
- Ho, S.C.; Chang, Y.H.; Chang, K.S. Structural Moieties Required for Cinnamaldehyde-Related Compounds to Inhibit Canonical IL-1β Secretion. Molecules 2018, 23, 3241. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Gao, W.; Yan, X.; Sun, Y.; Xu, T. MicroRNA-132 as a negative regulator in NF-κB signaling pathway via targeting IL-1β in miiuy croaker. Dev. Comp. Immunol. 2021, 122, 104113. [Google Scholar] [CrossRef]
- Geranurimi, A.; Cheng, C.W.H.; Quiniou, C.; Zhu, T.; Hou, X.; Rivera, J.C.; St-Cyr, D.J.; Beauregard, K.; Bernard-Gauthier, V.; Chemtob, S.; et al. Probing Anti-inflammatory Properties Independent of NF-κB through Conformational Constraint of Peptide-Based Interleukin-1 Receptor Biased Ligands. Front. Chem. 2019, 7, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, Y.; Shaw, G.S.; Konermann, L. Calcium-Mediated Control of S100 Proteins: Allosteric Communication via an Agitator/Signal Blocking Mechanism. J. Am. Chem. Soc. 2017, 139, 11460–11470. [Google Scholar] [CrossRef] [Green Version]
- Baudier, J.; Deloulme, J.C.; Shaw, G.S. The Zn and Ca-binding S100B and S100A1 proteins: Beyond the myths. Biol. Rev. Camb. Philos. Soc. 2020, 95, 738–758. [Google Scholar] [CrossRef]
- Tong, L.; Lan, W.; Lim, R.R.; Chaurasia, S.S. S100A proteins as molecular targets in the ocular surface inflammatory diseases. Ocul. Surf. 2014, 12, 23–31. [Google Scholar] [CrossRef]
- Riau, A.K.; Wong, T.T.; Beuerman, R.W.; Tong, L. Calcium-binding S100 protein expression in pterygium. Mol. Vis. 2009, 15, 335–342. [Google Scholar]
- Zhang, Y.; Liu, F. Elevation of S100 calcium-binding protein A7 in recurrent pterygium. Exp. Ther. Med. 2019, 18, 3147–3152. [Google Scholar] [CrossRef]
- Hynne, H.; Aqrawi, L.A.; Jensen, J.L.; Thiede, B.; Palm, Ø.; Amdal, C.D.; Westgaard, K.L.; Herlofson, B.B.; Utheim, T.P.; Galtung, H.K. Proteomic Profiling of Saliva and Tears in Radiated Head and Neck Cancer Patients as Compared to Primary Sjögren’s Syndrome Patients. Int. J. Mol. Sci. 2022, 23, 3714. [Google Scholar] [CrossRef]
- Zhou, L.; Wei, R.; Zhao, P.; Koh, S.K.; Beuerman, R.W.; Ding, C. Proteomic analysis revealed the altered tear protein profile in a rabbit model of Sjögren’s syndrome-associated dry eye. Proteomics 2013, 13, 2469–2481. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Zhang, F.; Wang, Y. S100A proteins in the pathogenesis of experimental corneal neovascularization. Mol. Vis. 2010, 16, 2225–2235. [Google Scholar]
- Marinković, G.; Koenis, D.S.; de Camp, L.; Jablonowski, R.; Graber, N.; de Waard, V.; de Vries, C.J.; Goncalves, I.; Nilsson, J.; Jovinge, S.; et al. S100A9 Links Inflammation and Repair in Myocardial Infarction. Circ. Res. 2020, 127, 664–676. [Google Scholar] [CrossRef]
- Zhang, X.; Wei, L.; Wang, J.; Qin, Z.; Wang, J.; Lu, Y.; Zheng, X.; Peng, Q.; Ye, Q.; Ai, F.; et al. Suppression Colitis and Colitis-Associated Colon Cancer by Anti-S100a9 Antibody in Mice. Front. Immunol. 2017, 8, 1774. [Google Scholar] [CrossRef]
- Kawano, T.; Shimamura, M.; Nakagami, H.; Iso, T.; Koriyama, H.; Takeda, S.; Baba, K.; Sasaki, T.; Sakaguchi, M.; Morishita, R.; et al. Therapeutic Vaccine Against S100A9 (S100 Calcium-Binding Protein A9) Inhibits Thrombosis Without Increasing the Risk of Bleeding in Ischemic Stroke in Mice. Hypertension 2018, 72, 1355–1364. [Google Scholar] [CrossRef]
- Aragona, P.; Baudouin, C.; Benitez, D.; Castillo, J.M.; Messmer, E.; Barabino, S.; Merayo-Lloves, J.; Inferrera, L.; Rolando, M.; Mencucci, R.; et al. The ocular microbiome and microbiota and their effects on ocular surface pathophysiology and disorders. Surv. Ophthalmol. 2021, 66, 907–925. [Google Scholar] [CrossRef]
- Chalkia, A.K.; Tseliou, M.; Bontzos, G.; Tsakalis, N.G.; Liakopoulos, D.A.; Blazaki, S.; Sourvinos, G.; Detorakis, E.T. Association between HPV detection in swab samples and tissue specimens and ophthalmic pterygium recurrence. Graefes. Arch. Clin. Exp. Ophthalmol. 2021, 259, 3077–3082. [Google Scholar] [CrossRef]
- Xuan, J.; Ji, Z.; Wang, B.; Zeng, X.; Chen, R.; He, Y.; Rao, P.; Wu, P.; Shi, G. Serological Evidence for the Association between Epstein-Barr Virus Infection and Sjögren’s Syndrome. Front. Immunol. 2020, 11, 590444. [Google Scholar] [CrossRef]
- Lee, S.J.; Lee, J.S.; Shin, M.G.; Tanaka, Y.; Park, D.J.; Kim, T.J.; Park, Y.W.; Lee, S.S. Detection of HTLV-1 in the labial salivary glands of patients with Sjögren’s syndrome: A distinct clinical subgroup? J. Rheumatol. 2012, 39, 809–815. [Google Scholar] [CrossRef]
- Koganti, R.; Yadavalli, T.; Shukla, D. Current and Emerging Therapies for Ocular Herpes Simplex Virus Type-1 Infections. Microorganisms 2019, 7, 429. [Google Scholar] [CrossRef] [Green Version]
- Ma, D.; Chen, C.B.; Jhanji, V.; Xu, C.; Yuan, X.L.; Liang, J.J.; Huang, Y.; Cen, L.P.; Ng, T.K. Expression of SARS-CoV-2 receptor ACE2 and TMPRSS2 in human primary conjunctival and pterygium cell lines and in mouse cornea. Eye 2020, 34, 1212–1219. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Zhou, X. Bioinformatics analysis of potential common pathogenic mechanisms for COVID-19 infection and primary Sjogren’s syndrome. Front. Immunol. 2022, 13, 938837. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Casals, M.; Sainz-de-la-Maza, M.; Muxí, A. COVID-19 vaccination unveiling subclinical Sjögren’s syndrome. Clin. Exp. Rheumatol. 2021, 6, 228–229. [Google Scholar] [CrossRef] [PubMed]
- Wong, Y.W.; Chew, J.; Yang, H.; Tan, D.T.; Beuerman, R. Expression of insulin-like growth factor binding protein-3 in pterygium tissue. Br. J. Ophthalmol. 2006, 90, 769–772. [Google Scholar] [CrossRef] [PubMed]
- Hou, A.; Lan, W.; Law, K.P.; Khoo, S.C.J.; Tin, M.Q.; Lim, Y.P.; Tong, L. Evaluation of global differential gene and protein expression in primary Pterygium: S100A8 and S100A9 as possible drivers of a signaling network. PLoS ONE 2014, 9, e97402. [Google Scholar] [CrossRef] [Green Version]
- Riau, A.K.; Wong, T.T.; Lan, W.; Finger, S.N.; Chaurasia, S.S.; Hou, A.H.; Chen, S.; Yu, S.J.; Tong, L. Aberrant DNA methylation of matrix remodeling and cell adhesion related genes in pterygium. PLoS ONE 2011, 6, e14687. [Google Scholar] [CrossRef]
- Gene Ontology Consortium. The Gene Ontology resource: Enriching a GOld mine. Nucleic Acids Res. 2021, 49, D325–D334. [Google Scholar] [CrossRef]
- Kanehisa, M.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016, 44, D457–D462. [Google Scholar] [CrossRef] [Green Version]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; von Mering, C. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef]
Participant Number | Group | Sex | Age |
---|---|---|---|
1 | healthy control | Male | 45 |
2 | healthy control | Male | 58 |
3 | healthy control | Female | 75 |
4 | pterygium | Female | 59 |
5 | pterygium | Male | 72 |
6 | pterygium | Female | 77 |
7 | primary Sjögren Syndrome | Female | 66 |
8 | primary Sjögren Syndrome | Female | 68 |
9 | primary Sjögren Syndrome | Male | 57 |
Gene | Forward Primer | Reverse Primer |
---|---|---|
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
IL1R1 | ATGAAATTGATGTTCGTCCCTGT | ACCACGCAATAGTAATGTCCTG |
ICAM1 | GTATGAACTGAGCAATGTGCAAG | GTTCCACCCGTTCTGGAGTC |
IRAK1 | GCACCCACAACTTCTCGGAG | CACCGTGTTCCTCATCACCG |
S100A9 | GGTCATAGAACACATCATGGAGG | GGCCTGGCTTATGGTGGTG |
S100A8 | ATGCCGTCTACAGGGATGAC | ACTGAGGACACTCGGTCTCTA |
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
IL1R1 | ATGAAATTGATGTTCGTCCCTGT | ACCACGCAATAGTAATGTCCTG |
ICAM1 | GTATGAACTGAGCAATGTGCAAG | GTTCCACCCGTTCTGGAGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Chen, H.; Cui, H. Key Genes of Immunity Associated with Pterygium and Primary Sjögren’s Syndrome. Int. J. Mol. Sci. 2023, 24, 2047. https://doi.org/10.3390/ijms24032047
Liu Y, Chen H, Cui H. Key Genes of Immunity Associated with Pterygium and Primary Sjögren’s Syndrome. International Journal of Molecular Sciences. 2023; 24(3):2047. https://doi.org/10.3390/ijms24032047
Chicago/Turabian StyleLiu, Yumeilan, Hao Chen, and Hongping Cui. 2023. "Key Genes of Immunity Associated with Pterygium and Primary Sjögren’s Syndrome" International Journal of Molecular Sciences 24, no. 3: 2047. https://doi.org/10.3390/ijms24032047