Myeloma Microenvironmental TIMP1 Induces the Invasive Phenotype in Fibroblasts to Modulate Disease Progression
Abstract
:1. Introduction
2. Results
2.1. TIMP1 Protein Expression Was Higher in BM Plasma from Patients with MM
2.2. TIMP1 mRNA Levels Were Higher in MM Cells Than in Control Cells
2.3. TIMP1 Expression and Cytogenetics in MM
2.4. Effects of TIMP1 Expression on Patient Survival
2.5. TIMP1 Did Not Affect HMCL Proliferation or Drug Resistance
2.6. TIMP1 Reinforced the Invasive Phenotype in Fibroblasts
2.7. BM Plasma from Patients with MM Reinforced the Invasive Capacity of Fibroblasts in a TIMP1-Dependent Manner
2.8. Fibroblasts Supported Myeloma Cell Invasion and Expansion in ECM
2.9. Transcriptome Analysis of OUMS-36T-3F Fibroblasts Treated with Recombinant TIMP1 or Anti-TIMP1 Antibodies
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. Reagents
4.3. Patients
4.4. Isolation of Nucleic Acids and RNA Expression Analysis by Polymerase Chain Reaction (PCR)
4.5. TIMP1 Protein Concentration Assay
4.6. In Vitro Cell Line Culture
4.7. In Vitro Cell Invasion Assays
4.8. RNA Sequencing
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kyle, R.A.; Rajkumar, S.V. Multiple myeloma. Blood 2008, 111, 2962–2972. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palumbo, A.; Anderson, K. Multiple Myeloma. N. Engl. J. Med. 2011, 364, 1046–1060. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kyle, R.A.; Larson, D.R.; Therneau, T.M.; Dispenzieri, A.; Kumar, S.; Cerhan, J.R.; Rajkumar, S.V. Long-Term Follow-up of Monoclonal Gammopathy of Undetermined Significance. N. Engl. J. Med. 2018, 378, 241–249. [Google Scholar] [CrossRef] [PubMed]
- Chesi, M.; Bergsagel, P.L. Molecular pathogenesis of multiple myeloma: Basic and clinical updates. Int. J. Hematol. 2013, 97, 313–323. [Google Scholar] [CrossRef] [PubMed]
- Komohara, Y.; Fujiwara, Y.; Ohnishi, K.; Takeya, M. Tumor-associated macrophages: Potential therapeutic targets for anti-cancer therapy. Adv. Drug Deliv. Rev. 2015, 99 Pt B, 180–185. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.; Lin, K.; Li, X.; Yuan, X.; Xu, P.; Ni, P.; Xu, D. Redefining Tumor-Associated Macrophage Subpopulations and Functions in the Tumor Microenvironment. Front. Immunol. 2020, 11, 1731. [Google Scholar] [CrossRef]
- Sahai, E.; Astsaturov, I.; Cukierman, E.; DeNardo, D.G.; Egeblad, M.; Evans, R.M.; Fearon, D.; Greten, F.R.; Hingorani, S.R.; Hunter, T.; et al. A framework for advancing our understanding of cancer-associated fibroblasts. Nat. Rev. Cancer 2020, 20, 174–186. [Google Scholar] [CrossRef] [Green Version]
- Khokha, R.; Murthy, A.; Weiss, A. Metalloproteinases and their natural inhibitors in inflammation and immunity. Nat. Rev. Immunol. 2013, 13, 649–665. [Google Scholar] [CrossRef]
- Robert, S.; Gicquel, T.; Victoni, T.; Valenca, S.S.; Barreto, E.; Bailly-Maître, B.; Boichot, E.; Lagente, V. Involvement of matrix metalloproteinases (MMPs) and inflammasome pathway in molecular mechanisms of fibrosis. Biosci. Rep. 2016, 36, e00360. [Google Scholar] [CrossRef] [Green Version]
- Roderfeld, M. Matrix metalloproteinase functions in hepatic injury and fibrosis. Matrix Biol. 2018, 68-69, 452–462. [Google Scholar] [CrossRef]
- Stetler-Stevenson, W.G. Tissue Inhibitors of Metalloproteinases in Cell Signaling: Metalloproteinase-Independent Biological Activities. Sci. Signal. 2008, 1, re6. [Google Scholar] [CrossRef] [Green Version]
- Guedez, L.; Courtemanch, L.; Stetler-Stevenson, M. Tissue inhibitor of metalloproteinase (TIMP)-1 induces differentiation and an antiapoptotic phenotype in germinal center B cells. Blood 1998, 92, 1342–1349. [Google Scholar] [CrossRef]
- Guedez, L.; Martinez, A.; Zhao, S.; Vivero, A.; Pittaluga, S.; Stetler-Stevenson, M.; Raffeld, M.; Stetler-Stevenson, W.G. Tissue inhibitor of metalloproteinase 1 (TIMP-1) promotes plasmablastic differentiation of a Burkitt lymphoma cell line: Implications in the pathogenesis of plasmacytic/plasmablastic tumors. Blood 2005, 105, 1660–1668. [Google Scholar] [CrossRef] [Green Version]
- Justo, B.L.; Jasiulionis, M.G. Characteristics of TIMP1, CD63, and β1-Integrin and the Functional Impact of Their Interaction in Cancer. Int. J. Mol. Sci. 2021, 22, 9319. [Google Scholar] [CrossRef]
- Song, G.; Xu, S.; Zhang, H.; Wang, Y.; Xiao, C.; Jiang, T.; Wu, L.; Zhang, T.; Sun, X.; Zhong, L.; et al. TIMP1 is a prognostic marker for the progression and metastasis of colon cancer through FAK-PI3K/AKT and MAPK pathway. J. Exp. Clin. Cancer Res. 2016, 35, 148. [Google Scholar] [CrossRef] [Green Version]
- Peng, L.; Yanjiao, M.; Ai-Guo, W.; Pengtao, G.; Jianhua, L.; Ju, Y.; Hongsheng, O.; Xichen, Z. A fine balance between CCNL1 and TIMP1 contributes to the development of breast cancer cells. Biochem. Biophys. Res. Commun. 2011, 409, 344–349. [Google Scholar] [CrossRef]
- Luparello, C.; Avanzato, G.; Carella, C.; Pucci-Minafra, I. Tissue inhibitor of metalloprotease (TIMP)-1 and proliferative behaviour of clonal breast cancer cells. Breast Cancer Res. Treat. 1999, 54, 235–244. [Google Scholar] [CrossRef]
- Urbaniak-Kujda, D.; Kapelko-Slowik, K.; Prajs, I.; Dybko, J.; Wolowiec, D.; Biernat, M.; Slowik, M.; Kuliczkowski, K. Increased expression of metalloproteinase-2 and -9 (MMP-2, MMP-9), tissue inhibitor of metalloproteinase-1 and -2 (TIMP-1, TIMP-2), and EMMPRIN (CD147) in multiple myeloma. Hematology 2016, 21, 26–33. [Google Scholar] [CrossRef]
- Terpos, E.; Dimopoulos, M.A.; Shrivastava, V.; Leitzel, K.; Christoulas, D.; Migkou, M.; Gavriatopoulou, M.; Anargyrou, K.; Hamer, P.; Kastritis, E.; et al. High levels of serum TIMP-1 correlate with advanced disease and predict for poor survival in patients with multiple myeloma treated with novel agents. Leuk. Res. 2010, 34, 399–402. [Google Scholar] [CrossRef]
- Lwin, S.T.; Fowler, J.A.; Drake, M.T.; Edwards, J.R.; Lynch, C.C.; Edwards, C.M. A loss of host-derived MMP-7 promotes myeloma growth and osteolytic bone disease in vivo. Mol. Cancer 2017, 16, 49. [Google Scholar] [CrossRef] [Green Version]
- Dong, J.; Ma, Q. TIMP1 promotes multi-walled carbon nanotube-induced lung fibrosis by stimulating fibroblast activation and proliferation. Nanotoxicology 2017, 11, 41–51. [Google Scholar] [CrossRef] [Green Version]
- Moehler, T.; Ho, A.; Goldschmidt, H.; Barlogie, B. Angiogenesis in hematologic malignancies. Crit. Rev. Oncol. Hematol. 2003, 45, 227–244. [Google Scholar] [CrossRef]
- Medeiros, T.; Saraiva, G.N.; Moraes, L.A.; Gomes, A.C.; Lacerda, G.S.; Leite, P.E.; Esberard, E.B.; Andrade, T.G.; Xavier, A.R.; Quírico-Santos, T.; et al. Liver fibrosis improvement in chronic hepatitis C after direct acting-antivirals is accompanied by reduced profibrogenic biomarkers–a role for MMP-9/TIMP-1. Dig. Liver Dis. 2020, 52, 1170–1177. [Google Scholar] [CrossRef]
- El Motteleb, D.M.A.; Ibrahim, I.A.-H.; Elshazly, S.M. Sildenafil protects against bile duct ligation induced hepatic fibrosis in rats: Potential role for silent information regulator 1 (SIRT1). Toxicol. Appl. Pharmacol. 2017, 335, 64–71. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Green Version]
- Rethnam, M.; Tan, D.Q.; Suda, T. Myeloma cells self-promote migration by regulating TAB1-driven TIMP-1 expression in mesenchymal stem cells. Biochem. Biophys. Res. Commun. 2021, 534, 843–848. [Google Scholar] [CrossRef]
- Zdzisińska, B.; Walter-Croneck, A.; Kandefer-Szerszeń, M. Matrix metalloproteinases-1 and -2, and tissue inhibitor of metalloproteinase-2 production is abnormal in bone marrow stromal cells of multiple myeloma patients. Leuk. Res. 2008, 32, 1763–1769. [Google Scholar] [CrossRef]
- Marquez-Curtis, L.; Dobrowsky, A.; Montaño, J.; Turner, A.R.; Ratajczak, J.; Ratajczak, M.Z.; Janowska-Wieczorek, A. Matrix metalloproteinase and tissue inhibitors of metalloproteinase secretion by haematopoietic and stromal precursors and their production in normal and leukaemic long-term marrow cultures. Br. J. Haematol. 2001, 115, 595–604. [Google Scholar] [CrossRef]
- Merz, M.; Merz, A.M.A.; Wang, J.; Wei, L.; Hu, Q.; Hutson, N.; Rondeau, C.; Celotto, K.; Belal, A.; Alberico, R.; et al. Deciphering spatial genomic heterogeneity at a single cell resolution in multiple myeloma. Nat. Commun. 2022, 13, 807. [Google Scholar] [CrossRef]
- Varga, C.; Xie, W.; Laubach, J.; Ghobrial, I.M.; O’Donnell, E.K.; Weinstock, M.; Paba-Prada, C.; Warren, D.; Maglio, M.E.; Schlossman, R.; et al. Development of extramedullary myeloma in the era of novel agents: No evidence of increased risk with lenalidomide-bortezomib combinations. Br. J. Haematol. 2015, 169, 843–850. [Google Scholar] [CrossRef]
- Xie, Z.; Chng, W.J. MMSET: Role and Therapeutic Opportunities in Multiple Myeloma. BioMed Res. Int. 2014, 2014, 636514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakopoulou, L.; Giannopoulou, I.; Stefanaki, K.; Panayotopoulou, E.; Tsirmpa, I.; Alexandrou, P.; Mavrommatis, J.; Katsarou, S.; Davaris, P. Enhanced mRNA expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) in breast carcinomas is correlated with adverse prognosis. J. Pathol. 2002, 197, 307–313. [Google Scholar] [CrossRef] [PubMed]
- Würtz, S.; Møller, S.; Mouridsen, H.; Hertel, P.B.; Friis, E.; Brünner, N. Plasma and Serum Levels of Tissue Inhibitor of Metalloproteinases-1 Are Associated with Prognosis in Node-negative Breast Cancer: A prospective study. Mol. Cell. Proteom. 2008, 7, 424–430. [Google Scholar] [CrossRef] [Green Version]
- Wu, Z.-S.; Wu, Q.; Yang, J.-H.; Wang, H.-Q.; Ding, X.-D.; Yang, F.; Xu, X.-C. Prognostic significance of MMP-9 and TIMP-1 serum and tissue expression in breast cancer. Int. J. Cancer 2008, 122, 2050–2056. [Google Scholar] [CrossRef]
- Lipton, A.; Ali, S.M.; Leitzel, K.; Demers, L.; Evans, D.B.; Hamer, P.; Brown-Shimer, S.; Pierce, K.; Carney, W. Elevated plasma tissue inhibitor of metalloproteinase-1 level predicts decreased response and survival in metastatic breast cancer. Cancer 2007, 109, 1933–1939. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.-Y.; Li, L.; Zhao, Z.-S.; Wang, H.-J. Clinical utility of measuring expression levels of KAP1, TIMP1 and STC2 in peripheral blood of patients with gastric cancer. World J. Surg. Oncol. 2013, 11, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshikawa, T.; Cho, H.; Tsuburaya, A.; Kobayashi, O. Impact of plasma tissue inhibitor of metalloproteinase-1 on long-term survival in patients with gastric cancer. Gastric Cancer 2009, 12, 31–36. [Google Scholar] [CrossRef]
- Fu, Z.; Lv, J.; Ma, C.; Yang, D.; Wang, T. Tissue inhibitor of metalloproteinase-1 decreased chemosensitivity of MDA-435 breast cancer cells to chemotherapeutic drugs through the PI3K/AKT/NF-кB pathway. Biomed. Pharmacother. 2011, 65, 163–167. [Google Scholar] [CrossRef]
- Bjerre, C.; Vinther, L.; Belling, K.; Würtz, S.; Yadav, R.; Lademann, U.; Rigina, O.; Do, K.N.; Ditzel, H.J.; Lykkesfeldt, A.E.; et al. TIMP1 overexpression mediates resistance of MCF-7 human breast cancer cells to fulvestrant and down-regulates progesterone receptor expression. Tumor Biol. 2013, 34, 3839–3851. [Google Scholar] [CrossRef] [Green Version]
- Schrohl, A.-S.; Gelder, M.E.M.-V.; Holten-Andersen, M.N.; Christensen, I.J.; Look, M.P.; Mouridsen, H.T.; Brünner, N.; Foekens, J.A. Primary Tumor Levels of Tissue Inhibitor of Metalloproteinases-1 Are Predictive of Resistance to Chemotherapy in Patients with Metastatic Breast Cancer. Clin. Cancer Res. 2006, 12, 7054–7058. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Wang, Y.; Tang, J.; Qin, S.; Shen, X.; He, S.; Ju, S. CAM-DR: Mechanisms, Roles and Clinical Application in Tumors. Front. Cell Dev. Biol. 2021, 9, 698047. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; Du, Y.; Shen, Y.; He, Y.; Zhao, H.; Li, Z. TGF-beta 1 induced fibroblast proliferation is mediated by the FGF-2/ERK pathway. Front. Biosci. 2012, 17, 2667–2674. [Google Scholar] [CrossRef] [Green Version]
- Kuzet, S.-E.; Gaggioli, C. Fibroblast activation in cancer: When seed fertilizes soil. Cell Tissue Res. 2016, 365, 607–619. [Google Scholar] [CrossRef] [PubMed]
- Hideshima, T.; Podar, K.; Chauhan, D.; Anderson, K.C. Cytokines and signal transduction. Best Pract. Res. Clin. Haematol. 2005, 18, 509–524. [Google Scholar] [CrossRef]
- Gaggioli, C.; Hooper, S.; Hidalgo-Carcedo, C.; Grosse, R.; Marshall, J.F.; Harrington, K.; Sahai, E. Fibroblast-led collective invasion of carcinoma cells with differing roles for RhoGTPases in leading and following cells. Nat. Cell Biol. 2007, 9, 1392–1400. [Google Scholar] [CrossRef]
- Shay, G.; Hazlehurst, L.; Lynch, C.C. Dissecting the multiple myeloma-bone microenvironment reveals new therapeutic opportunities. J. Mol. Med. 2015, 94, 21–35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parmo-Cabañas, M.; Molina-Ortiz, I.; Matías-Román, S.; García-Bernal, D.; Carvajal-Vergara, X.; Valle, I.; Pandiella, A.; Arroyo, A.G.; Teixidó, J. Role of metalloproteinases MMP-9 and MT1-MMP in CXCL12-promoted myeloma cell invasion across basement membranes. J. Pathol. 2006, 208, 108–118. [Google Scholar] [CrossRef]
- Subramanian, R.; Basu, D.; Dutta, T.K. Significance of bone marrow fibrosis in multiple myeloma. Pathology 2007, 39, 512–515. [Google Scholar] [CrossRef]
- Sakemura, R.; Hefazi, M.; Siegler, E.L.; Cox, M.J.; Larson, D.P.; Hansen, M.J.; Roman, C.M.; Schick, K.J.; Can, I.; Tapper, E.E.; et al. Targeting cancer-associated fibroblasts in the bone marrow prevents resistance to CART-cell therapy in multiple myeloma. Blood 2022, 139, 3708–3721. [Google Scholar] [CrossRef]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Green Version]
- Kanda, Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow Transplant. 2013, 48, 452–458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Characteristics | Providers |
---|---|---|
KMS11 | HMCL, t(4;14) | Dr. Takemi Otsuki (Kawasaki Medical School, Okayama, Japan) |
OPM2 | HMCL, t(4;14) | Dr. Masaki Ri (Nagoya City University, Nagoya, Japan) |
KMS12PE | HMCL, t(11;14) | Dr. Takemi Otsuki (Kawasaki Medical School, Okayama, Japan) |
KMS26 | HMCL, t(14;16) | Dr. Takemi Otsuki (Kawasaki Medical School, Okayama, Japan) |
KMM1 | HMCL, t(8;14) | Dr. Takemi Otsuki (Kawasaki Medical School, Okayama, Japan) |
HS-5 | Human fibroblast cell line | Dr. Hideto Tamura (Dokkyo Medical University, Tochigi, Japan) |
OUMS-36T-3F | Human fibroblast cell line | JCRB Cell Bank (Tokyo, Japan) |
Factor | Group | NDMM | RRMM | SMM |
---|---|---|---|---|
n | 120 | 25 | 14 | |
ASCT (%) | 0 | 82 (73.2) | 12 (48.0) | 10 (100.0) |
1 | 30 (26.8) | 13 (52.0) | 0 (0.0) | |
Cytogenetics Karyotype (%) | del 17p | 10 (9.5) | 3 (13.6) | 0 (0.0) |
N | 28 (26.7) | 4 (18.2) | 4 (36.4) | |
t(11;14) | 27 (25.7) | 7 (31.8) | 1 (9.1) | |
t(14;16) | 5 (4.8) | 0 (0.0) | 0 (0.0) | |
t(4;14) | 14 (13.3) | 4 (18.2) | 3 (27.3) | |
trisomy11 | 21 (20.0) | 4 (18.2) | 3 (27.3) | |
EMM (%) | 0 | 57 (54.8) | 16 (64.0) | 10 (90.9) |
1 | 47 (45.2) | 9 (36.0) | 1 (9.1) | |
Gender (%) | F | 57 (47.9) | 12 (48.0) | 8 (57.1) |
M | 62 (52.1) | 13 (52.0) | 6 (42.9) | |
IgH (%) | BJ | 18 (15.5) | 4 (16.0) | 0 (0.0) |
IgA | 28 (24.1) | 7 (28.0) | 1 (7.1) | |
IgD | 3 (2.6) | 0 (0.0) | 0 (0.0) | |
IgG | 64 (55.2) | 12 (48.0) | 13 (92.9) | |
IgM | 1 (0.9) | 2 (8.0) | 0 (0.0) | |
unknown | 2 (1.7) | 0 (0.0) | 0 (0.0) | |
IgL (%) | unknown | 2 (1.7) | 0 (0.0) | 0 (0.0) |
κ | 66 (56.9) | 12 (48.0) | 6 (42.9) | |
λ | 48 (41.4) | 13 (52.0) | 8 (57.1) | |
ISS (%) | 1 | 22 (19.3) | 7 (35.0) | 8 (57.1) |
2 | 48 (42.1) | 9 (45.0) | 6 (42.9) | |
3 | 44 (38.6) | 4 (20.0) | 0 (0.0) | |
R.ISS (%) | 1 | 13 (12.0) | 3 (16.7) | 5 (38.5) |
2 | 79 (73.1) | 12 (66.7) | 8 (61.5) | |
3 | 16 (14.8) | 3 (16.7) | 0 (0.0) | |
age | 70.00 [41.00, 88.00] | 66.00 [42.00, 82.00] | 73.50 [30.00, 81.00] | |
Alb | 3.40 [1.90, 4.80] | 3.50 [2.00, 4.90] | 3.45 [2.80, 4.20] | |
b2MG | 4.50 [1.40, 99.60] | 3.50 [1.70, 123.40] | 2.20 [1.30, 4.30] | |
LDH | 173.00 [90.00, 2601.00] | 211.50 [152.00, 775.00] | 211.00 [122.00, 273.00] | |
TIMP1 Protein (ng/mL) | 150.82 [44.02, 743.99] | 382.17 [382.17, 382.17] | 99.48 [52.72, 193.30] | |
TIMP1 mRNA | 0.04 [0.00, 2.12] | 0.04 [0.00, 3.44] | 0.02 [0.00, 0.97] |
Oligonucleotide Name | Gene | Sequence (5′→3′) |
---|---|---|
HA257212-Forward | TIMP1 | AAGACCTACACTGTTGGCTGTGAG |
HA257212-Reverse | GTCCGTCCACAAGCAATGAG | |
HA067803-Forward | ACTB | TGGCACCCAGCACAATGAA |
HA067803-Reverse | CTAAGTCATAGTCCGCCTAGAAGCA | |
HA133460-Forward | ACTA2 | ATTGCCGACCGAATGCAGA |
HA133460-Reverse | ATGGAGCCACCGATCCAGAC | |
HA039683-Forward | FAP | CAACTGTGATGGCAAGAGCAGAA |
HA039683-Reverse | TCGTGGACAGGCCGGATAA | |
HA037419-Forward | S100A4 | GGGTGACAAGTTCAAGCTCAACA |
HA037419-Reverse | ATCATGGCGATGCAGGACAG | |
HA101241-Forward | STC1 | AGTGCTACAGCAAGCTGAATGTGTG |
HA101241-Reverse | GCAGGCTTCGGACAAGTCTGTTA | |
HA283325-Forward | VIM | AACCTGGCCGAGGACATCA |
HA283325-Reverse | TCAAGGTCAAGACGTGCCAGA | |
HA127650-Forward | POSTN | GCTCCTGACACAACCTGGAGA |
HA127650-Reverse | AACTCCTGGTGTCAGGTGATAAAGA | |
HA308571-Forward | ASPN | CCCAAATCATTAGCAGAACTCAGAA |
HA308571-Reverse | CCCTGGCTCTATCCCATTATTATCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ishihara, R.; Oda, T.; Murakami, Y.; Matsumura, I.; Watanabe, S.; Asao, Y.; Masuda, Y.; Gotoh, N.; Kasamatsu, T.; Takei, H.; et al. Myeloma Microenvironmental TIMP1 Induces the Invasive Phenotype in Fibroblasts to Modulate Disease Progression. Int. J. Mol. Sci. 2023, 24, 2216. https://doi.org/10.3390/ijms24032216
Ishihara R, Oda T, Murakami Y, Matsumura I, Watanabe S, Asao Y, Masuda Y, Gotoh N, Kasamatsu T, Takei H, et al. Myeloma Microenvironmental TIMP1 Induces the Invasive Phenotype in Fibroblasts to Modulate Disease Progression. International Journal of Molecular Sciences. 2023; 24(3):2216. https://doi.org/10.3390/ijms24032216
Chicago/Turabian StyleIshihara, Rei, Tsukasa Oda, Yuki Murakami, Ikuko Matsumura, Saki Watanabe, Yuta Asao, Yuta Masuda, Nanami Gotoh, Tetsuhiro Kasamatsu, Hisashi Takei, and et al. 2023. "Myeloma Microenvironmental TIMP1 Induces the Invasive Phenotype in Fibroblasts to Modulate Disease Progression" International Journal of Molecular Sciences 24, no. 3: 2216. https://doi.org/10.3390/ijms24032216