The Non-JAZ TIFY Protein TIFY8 of Arabidopsis thaliana Interacts with the HD-ZIP III Transcription Factor REVOLUTA and Regulates Leaf Senescence
Abstract
:1. Introduction
2. Results
2.1. TIFY8 and REVOLUTA Proteins Physically Interact
2.2. TIFY8 Inhibits the Transactivation Capacity of REV
2.3. Expression Pattern of REV and TIFY8
2.4. Involvement of TIFY8 in Early Leaf Development and Senescence
2.5. Impact of JA on the REV/TIFY8/WRKY53 Network
2.6. Is the JA Influence on REV Function Mediated by Interaction with Other Proteins of the TIFY Family?
3. Discussion
4. Materials and Methods
4.1. Yeast Two-Hybrid Assays
4.2. Protein Extraction from Yeast Cells and Western Blot Analysis
4.3. Protoplast Transformation
4.4. MUSCLE Alignment of TIFY/ZIM Domains
4.5. Bimolecular Fluorescence Complementation (BiFC), Cytometry, and Confocal Microscopy
4.6. ß-Glucuronidase Reporter Assays
4.7. Plant Cultivation and Plant Lines
4.8. Phenotyping
4.9. Gene Expression Analyses Using qRT-PCR
4.10. Jasmonic Acid Treatment
4.11. Jasmonic Acid Measurements
4.12. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Talbert, P.B.; Adler, H.T.; Parks, D.W.; Comai, L. The REVOLUTA gene is necessary for apical meristem development and for limiting cell divisions in the leaves and stems of Arabidopsis thaliana. Development 1995, 121, 2723–2735. [Google Scholar] [CrossRef] [PubMed]
- Otsuga, D.; DeGuzman, B.; Prigge, M.J.; Drews, G.N.; Clark, S.E. REVOLUTA regulates meristem initiation at lateral positions. Plant J. Cell Mol. Biol. 2001, 25, 223–236. [Google Scholar] [CrossRef]
- Emery, J.F.; Floyd, S.K.; Alvarez, J.; Eshed, Y.; Hawker, N.P.; Izhaki, A.; Baum, S.F.; Bowman, J.L. Radial Patterning of Arabidopsis Shoots by Class III HD-ZIP and KANADI Genes. Curr. Biol. 2003, 13, 1768–1774. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Huhn, K.; Brandt, R.; Potschin, M.; Bieker, S.; Straub, D.; Doll, J.; Drechsler, T.; Zentgraf, U.; Wenkel, S. REVOLUTA and WRKY53 connect early and late leaf development in Arabidopsis. Development 2014, 141, 4772–4783. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.Y.; Botterweg-Paredes, E.; Doll, J.; Eguen, T.; Blaakmeer, A.; Matton, S.; Xie, Y.; Skjøth Lunding, B.; Zentgraf, U.; Guan, C.; et al. Multi-level analysis of the interactions between REVOLUTA and MORE AXILLARY BRANCHES 2 in controlling plant development reveals parallel, independent and antagonistic functions. Development 2020, 14, dev183681. [Google Scholar] [CrossRef]
- Bresson, J.; Doll, J.; Vasseur, F.; Stahl, M.; von Roepenack-Lahaye, E.; Kilian, J.; Stadelhofer, B.; Kremer, J.M.; Kolb, D.; Wenkel, S.; et al. The genetic interaction of REVOLUTA and WRKY53 links plant development, senescence, and immune responses. PLoS ONE 2022, 17, e0254741. [Google Scholar] [CrossRef] [PubMed]
- Zentgraf, U.; Doll, J. Arabidopsis WRKY53, a Node of Multi-Layer Regulation in the Network of Senescence. Plants 2019, 8, 578. [Google Scholar] [CrossRef]
- Brandt, R.; Salla-Martret, M.; Bou-Torrent, J.; Musielak, T.; Stahl, M.; Lanz, C.; Ott, F.; Schmid, M.; Greb, T.; Schwarz, M.; et al. Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses. Plant J. 2012, 72, 31–42. [Google Scholar] [CrossRef]
- Juarez, M.T.; Kui, J.S.; Thomas, J.; Heller, B.A.; Timmermans, M.C.P. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 2004, 428, 84–88. [Google Scholar] [CrossRef]
- Wenkel, S.; Emery, J.; Hou, B.H.; Evans, M.M.; Barton, M.K. A feedback regulatory module formed by LITTLE ZIPPER and HD-ZIPIII genes. Plant Cell 2007, 19, 3379–3390. [Google Scholar] [CrossRef] [Green Version]
- Magnani, E.; Barton, M.K. A per-ARNT-sim-like sensor domain uniquely regulates the activity of the homeodomain leucine zipper transcription factor REVOLUTA in Arabidopsis. Plant Cell 2011, 23, 567–582. [Google Scholar] [CrossRef]
- Möglich, A.; Ayers, R.A.; Moffat, K. Structure and signaling mechanism of Per-ARNT-Sim domains. Structure 2009, 17, 1282–1294. [Google Scholar] [CrossRef]
- Reinhart, B.J.; Liu, T.; Newell, N.R.; Magnani, E.; Huang, T.; Kerstetter, R.; Michaels, S.; Barton, M.K. Establishing a framework for the Ad/abaxial regulatory network of Arabidopsis: Ascertaining targets of class III homeodomain leucine zipper and KANADI regulation. Plant Cell 2013, 25, 3228–3249. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, L.; Barbero, G.F.; Geerinck, J.; Tilleman, S.; Grunewald, W.; Pérez, A.C.; Chico, J.M.; Bossche, R.V.; Sewell, J.; Gil, E.; et al. NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature 2010, 464, 788–791. [Google Scholar] [CrossRef] [PubMed]
- Shyu, C.; Figueroa, P.; DePew, C.L.; Cooke, T.F.; Sheard, L.B.; Moreno, J.E.; Katsir, L.; Zheng, N.; Browse, J.; Howe, G.A. JAZ8 lacks a canonical degron and has an EAR motif that mediates transcriptional repression of jasmonate responses in Arabidopsis. Plant Cell 2012, 24, 536–550. [Google Scholar] [CrossRef]
- Causier, B.; Ashworth, M.; Guo, W.; Davies, B. The TOPLESS interactome: A framework for gene repression in Arabidopsis. Plant Physiol. 2012, 158, 423–438. [Google Scholar] [CrossRef] [PubMed]
- Thines, B.; Katsir, L.; Melotto, M.; Niu, Y.; Mandaokar, A.; Liu, G.; Nomura, K.; He, S.Y.; Howe, G.A.; Browse, J. JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature 2007, 448, 661–665. [Google Scholar] [CrossRef] [PubMed]
- Xie, D.; Feys, B.; James, S.; Nieto-Rostro, M.; Turner, J. COI1: An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 1998, 280, 1091–1094. [Google Scholar] [CrossRef]
- White, D.W.R. PEAPOD regulates lamina size and curvature in Arabidopsis. Proc. Nat. Acad. Sci. USA 2006, 103, 13238–13243. [Google Scholar] [CrossRef]
- Wang, Z.; Li, N.; Jiang, S.; Gonzalez, N.; Huang, X.; Wang, Y.; Inzé, D.; Li, Y. SCF(SAP) controls organ size by targeting PPD proteins for degradation in Arabidopsis thaliana. Nat. Commun. 2016, 7, 11192. [Google Scholar] [CrossRef] [Green Version]
- White, D.W.R. PEAPOD repressors modulate and coordinate developmental responses to light intensity in Arabidopsis. New Phytol. 2022, 235, 1470–1485. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, N.; Pauwels, L.; Baekelandt, A.; De Milde, L.; Van Leene, J.; Besbrugge, N.; Heyndrickx, K.S.; Cuéllar Pérez, A.; Durand, A.N.; De Clercq, R.; et al. A Repressor Protein Complex Regulates Leaf Growth in Arabidopsis. Plant Cell 2015, 27, 2273–2287. [Google Scholar] [CrossRef] [PubMed]
- Cuéllar Pérez, A.; Nagels Durand, A.; Vanden Bossche, R.; De Clercq, R.; Persiau, G.; Van Wees, S.C.; Pieterse, C.M.; Gevaert, K.; De Jaeger, G.; Goossens, A.; et al. The non-JAZ TIFY protein TIFY8 from Arabidopsis thaliana is a transcriptional repressor. PLoS ONE 2014, 9, e84891. [Google Scholar] [CrossRef]
- Noir, S.; Bömer, M.; Takahashi, N.; Ishida, T.; Tsui, T.L.; Balbi, V.; Shanahan, H.; Sugimoto, K.; Devoto, A. Jasmonate controls leaf growth by repressing cell proliferation and the onset of endoreduplication while maintaining a potential stand-by mode. Plant Physiol. 2013, 161, 1930–1951. [Google Scholar] [CrossRef]
- Chung, H.S.; Cooke, T.F.; Depew, C.L.; Patel, L.C.; Ogawa, N.; Kobayashi, Y.; Howe, G.A. Alternative splicing expands the repertoire of dominant JAZ repressors of jasmonate signaling. Plant J. 2010, 63, 613–622. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, L.; De Clercq, R.; Goossens, J.; Iñigo, S.; Williams, C.; Ron, M.; Britt, A.; Goossens, A. A Dual sgRNA Approach for Functional Genomics in Arabidopsis thaliana. G3 Genes Genomes Genet. 2018, 8, 2603–2615. [Google Scholar] [CrossRef]
- Bresson, J.; Bieker, S.; Riester, L.; Doll, J.; Zentgraf, U. A guideline for leaf senescence analyses: From quantification to physiological and molecular investigations. J. Exp. Bot. 2018, 69, 769–786. [Google Scholar] [CrossRef]
- He, Y.; Fukushige, H.; Hildebrand, D.F.; Gan, S. Evidence supporting a role of jasmonic acid in Arabidopsis leaf senescence. Plant Physiol. 2002, 128, 876–884. [Google Scholar] [CrossRef]
- Huang, H.; Liu, B.; Liu, L.; Song, S. Jasmonate action in plant growth and development. J. Exp. Bot. 2017, 68, 1349–1359. [Google Scholar] [CrossRef]
- Breeze, E.; Harrison, E.; McHattie, S.; Hughes, L.; Hickman, R.; Hill, C.; Kiddle, S.; Kim, Y.; Penfold, C.A.; Jenkins, D.; et al. High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 2011, 23, 873–894. [Google Scholar] [CrossRef] [Green Version]
- Baekelandt, A.; Pauwels, L.; Wang, Z.; Li, N.; De Milde, L.; Natran, A.; Vermeersch, M.; Li, Y.; Goossens, A.; Inzé, D.; et al. Arabidopsis Leaf Flatness Is Regulated by PPD2 and NINJA through Repression of CYCLIN D3 Genes. Plant Physiol. 2018, 178, 217–232. [Google Scholar] [CrossRef] [PubMed]
- Zentgraf, U.; Jobst, J.; Kolb, D.; Rentsch, D. Senescence-related gene expression profiles of rosette leaves of Arabidopsis thaliana: Leaf age versus plant age. Plant Biol. 2004, 6, 178–183. [Google Scholar] [CrossRef] [PubMed]
- Sade, N.; Rubio-Wilhelmi, M.d.M.; Umnajkitikorn, K.; Blumwald, E. Stress-induced senescence and plant tolerance to abiotic stress. J. Exp. Bot. 2018, 69, 845–853. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, P.; Heinlein, C.; Orendi, G.; Zentgraf, U. Senescence specific regulation of catalases in Arabidopsis thaliana (L.) Heynh. Plant Cell Environ. 2006, 29, 1049–1060. [Google Scholar] [CrossRef] [PubMed]
- Bieker, S.; Riester, L.; Stahl, M.; Franzaring, J.; Zentgraf, U. Senescence-specific alteration of hydrogen peroxide levels in Arabidopsis thaliana and oilseed rape spring variety Brassica napus L. cv. Mozart. J. Integr. Plant Biol. 2012, 54, 540–554. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Cai, Z.; Gan, S. Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ. 2004, 27, 521–549. [Google Scholar] [CrossRef]
- Kim, J.; Kim, J.H.; Lyu, J.I.; Woo, H.R.; Lim, P.O. New insights into the regulation of leaf senescence in Arabidopsis. J. Exp. Bot. 2018, 69, 787–799. [Google Scholar] [CrossRef]
- Oña Chuquimarca, S.; Ayala-Ruano, S.; Goossens, J.; Pauwels, L.; Goossens, A.; Leon-Reyes, A.; Ángel Méndez, M. The Molecular Basis of JAZ-MYC Coupling, a Protein-Protein Interface Essential for Plant Response to Stressors. Front. Plant Sci. 2020, 11, 1139. [Google Scholar] [CrossRef]
- Song, S.; Huang, H.; Wang, J.; Liu, B.; Qi, T.; Xie, D. MYC5 is Involved in Jasmonate-Regulated Plant Growth, Leaf Senescence and Defense Responses. Plant Cell Physiol. 2017, 58, 1752–1763. [Google Scholar] [CrossRef]
- Mehlhorn, D.G.; Wallmerothm, N.; Berendzen, K.W.; Grefen, C. 2in1 vectors improve in planta BiFC and FRET analysis. Methods Mol. Biol. 2018, 691, 139–158. [Google Scholar] [CrossRef]
- Jefferson, R.A.; Kavanagh, T.A.; Bevan, M.W. GUS fusions: Beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6, 3901–3907. [Google Scholar] [CrossRef] [PubMed]
- Grefen, C.; Blatt, M.R. A 2in1 cloning system enables ratiometric bimolecular fluorescence complementation (rBiFC). Biotechniques 2012, 53, 311–314. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Panchuk, I.I.; Zentgraf, U.; Volkov, R.A. Expression of the Apx gene family during leaf senescence of Arabidopsis thaliana. Planta 2005, 222, 926–932. [Google Scholar] [CrossRef]
Function | Name | Description |
---|---|---|
vector selection | Double dropout (DDO) | SD/-Trp/-Leu |
interaction | Triple dropout (TDO) | SD/-Trp/-Leu/-His |
Quadruple dropout (QDO) | SD/-Trp/-Leu/-His/-Ade | |
QDO/X | SD/-Trp/-Leu/-His/-Ade supplemented with X-α-Gal (X) | |
QDO/X/AbA | SD/-Trp/-Leu/-His/-Ade supplemented with X-α-Gal (X) and Aureobasidin A (AbA) |
Oligonucleotides uses for cloning spacers | |||
LAPAU*3124 | ATTGCAAACCAGCCTCCACGCGG | Fw | sgRNA69 |
LAPAU3125 | AAACCCGCGTGGAGGCTGGTTTG | Rv | sgRNA69 |
LAPAU3126 | ATTGCTTGACCGCCATAGAAGA | Fw | sgRNA45 |
LAPAU3127 | AAACTCTTCTATGGCGGTCAAG | Rv | sgRNA45 |
LAPAU3128 | ATTGCCTTGGCAGGATCAAGCGG | Fw | sgRNA36 |
LAPAU3129 | AAACCCGCTTGATCCTGCCAAGG | Rv | sgRNA36 |
Genotyping primers | |||
CROPGEN *68 | TCACTTCACGACTCAGGAGC | Fw | Genotype sgRNA 69 |
CROPGEN69 | CCATTATCACATCCGCCTGC | Rv | Genotype sgRNA 69 |
CROPGEN70 | AACAGGGATGAAAGGTCCCG | Fw | Genotype sgRNA 45 or 36 |
CROPGEN71 | AGACCTGATTACTCTACTCCACTCA | Rv | Genotype sgRNA 45 or 36 |
Gene Name | Accession Number | Primer Sequence (for/rev) |
---|---|---|
Phenotyping ACTIN2 | At3g18780 | ACCCGATGGGCAAGTCATCACG TCCCACAAACGAGGGCTGGA |
SAG12 | At5g45890 | GCTTTGCCGGTTTCTGTTG GTTTCCCTTTCTTTATTTGTGTTG |
SAG13 | At2g29350 | AGGGAGCATCGTGCTCATATCC CCAGCTGATTCATGGCTCCTTTG |
Development and ACTIN2 | MeJA treatment At3g18780 | AAGCTCTCCTTTGTTGCTGTT GTTGTCTCGTGGATTCCAGCAGCTT |
TIFY8 | At4g32570 | CCGACAGACAGAACAAGATAAGC AAGCAGAAGCCGTGGAAGG |
REVOLUTA | At5g60690 | TCAGCTTGTCTGCGAAAATG ACCCAATCAACAGCAGTTCC |
WRKY53 | At4g23810 | CAGACGGGGATGCTACGG GGCGAGGCTAATGGTGGT |
Splicing variants TIFY8-SV1 | At4g32570 | TGTATGAAGGAGGCAGCTCTAAG TCATGTGGCTTCTTTTTCAGGATC |
TIFY8-SV2 | At4g32570 | TGTATGAAGGAGGCAGCTCTAAG TCAGTATTTGTAAGAAGCTAACCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Andrade Galan, A.G.; Doll, J.; Saile, S.C.; Wünsch, M.; Roepenack-Lahaye, E.v.; Pauwels, L.; Goossens, A.; Bresson, J.; Zentgraf, U. The Non-JAZ TIFY Protein TIFY8 of Arabidopsis thaliana Interacts with the HD-ZIP III Transcription Factor REVOLUTA and Regulates Leaf Senescence. Int. J. Mol. Sci. 2023, 24, 3079. https://doi.org/10.3390/ijms24043079
Andrade Galan AG, Doll J, Saile SC, Wünsch M, Roepenack-Lahaye Ev, Pauwels L, Goossens A, Bresson J, Zentgraf U. The Non-JAZ TIFY Protein TIFY8 of Arabidopsis thaliana Interacts with the HD-ZIP III Transcription Factor REVOLUTA and Regulates Leaf Senescence. International Journal of Molecular Sciences. 2023; 24(4):3079. https://doi.org/10.3390/ijms24043079
Chicago/Turabian StyleAndrade Galan, Ana Gabriela, Jasmin Doll, Svenja Corina Saile, Marieluise Wünsch, Edda von Roepenack-Lahaye, Laurens Pauwels, Alain Goossens, Justine Bresson, and Ulrike Zentgraf. 2023. "The Non-JAZ TIFY Protein TIFY8 of Arabidopsis thaliana Interacts with the HD-ZIP III Transcription Factor REVOLUTA and Regulates Leaf Senescence" International Journal of Molecular Sciences 24, no. 4: 3079. https://doi.org/10.3390/ijms24043079