Mineralocorticoid Receptor Antagonism Attenuates Multiple Organ Failure after Renal Ischemia and Reperfusion in Mice
Abstract
:1. Introduction
2. Results
2.1. MR Antagonist Decreases Tubular Cell Death and Oxidative Damage Induced by Renal IR
2.2. MR Antagonist Reduces Renal Inflammation in Renal IR Injury
2.3. MR Antagonist Reduces Hepatocellular Damage and Inflammation in Renal IR Injury
2.4. MR Antagonist Reduces Intestinal Damage and Inflammation in Renal IR Injury
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. Renal IR Model and Treatment
4.3. Hematoxylin & Eosin (H&E) Staining
4.4. Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay
4.5. Immunohistochemistry (IHC)
4.6. Biochemical Assays
4.7. Western Blot Analysis
4.8. Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis
4.9. Statistical Evaluation
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chawla, L.S.; Bellomo, R.; Bihorac, A.; Goldstein, S.L.; Siew, E.D.; Bagshaw, S.M.; Bittleman, D.; Cruz, D.; Endre, Z.; Fitzgerald, R.L.; et al. Acute kidney disease and renal recovery: Consensus report of the Acute Disease Quality Initiative (ADQI) 16 Workgroup. Nat. Rev. Nephrol. 2017, 13, 241–257. [Google Scholar] [CrossRef]
- Tang, M.; Jia, H.; Chen, S.; Yang, B.; Patpur, B.K.; Song, W.; Chang, Y.; Li, J.; Yang, C. Significance of MR/OPN/HMGB1 axis in NAFLD-associated hepatic fibrogenesis. Life Sci. 2021, 264, 118619. [Google Scholar] [CrossRef]
- Kellum, J.A.; Romagnani, P.; Ashuntantang, G.; Ronco, C.; Zarbock, A.; Anders, H.J. Acute kidney injury. Nat. Rev. Dis. Primers 2021, 7, 52. [Google Scholar] [CrossRef]
- Lee, S.A.; Cozzi, M.; Bush, E.L.; Rabb, H. Distant Organ Dysfunction in Acute Kidney Injury: A Review. Am. J. Kidney Dis. 2018, 72, 846–856. [Google Scholar] [CrossRef]
- Singbartl, K.; Joannidis, M. Short-term Effects of Acute Kidney Injury. Crit. Care Clin. 2015, 31, 751–762. [Google Scholar] [CrossRef]
- Ologunde, R.; Zhao, H.; Lu, K.; Ma, D. Organ cross talk and remote organ damage following acute kidney injury. Int. Urol. Nephrol. 2014, 46, 2337–2345. [Google Scholar] [CrossRef]
- Mehta, R.L.; Pascual, M.T.; Gruta, C.G.; Zhuang, S.; Chertow, G.M. Refining predictive models in critically ill patients with acute renal failure. J. Am. Soc. Nephrol. 2002, 13, 1350–1357. [Google Scholar] [CrossRef]
- Park, S.W.; Chen, S.W.; Kim, M.; Brown, K.M.; Kolls, J.K.; D’Agati, V.D.; Lee, H.T. Cytokines induce small intestine and liver injury after renal ischemia or nephrectomy. Lab. Investig. 2011, 91, 63–84. [Google Scholar] [CrossRef]
- Park, S.W.; Kim, M.; Kim, J.Y.; Ham, A.; Brown, K.M.; Mori-Akiyama, Y.; Ouellette, A.J.; D’Agati, V.D.; Lee, H.T. Paneth cell-mediated multiorgan dysfunction after acute kidney injury. J. Immunol. 2012, 189, 5421–5433. [Google Scholar] [CrossRef]
- Han, S.J.; Lee, H.T. Mechanisms and therapeutic targets of ischemic acute kidney injury. Kidney Res. Clin. Pract. 2019, 38, 427–440. [Google Scholar] [CrossRef]
- Jaisser, F.; Farman, N. Emerging Roles of the Mineralocorticoid Receptor in Pathology: Toward New Paradigms in Clinical Pharmacology. Pharmacol. Rev. 2016, 68, 49–75. [Google Scholar] [CrossRef]
- Ruiz-Ortega, M.; Ruperez, M.; Esteban, V.; Rodriguez-Vita, J.; Sanchez-Lopez, E.; Carvajal, G.; Egido, J. Angiotensin II: A key factor in the inflammatory and fibrotic response in kidney diseases. Nephrol. Dial. Transplant. 2006, 21, 16–20. [Google Scholar] [CrossRef]
- Cao, W.; Jin, L.; Zhou, Z.; Yang, M.; Wu, C.; Wu, L.; Cui, S. Overexpression of Intrarenal Renin-Angiotensin System in Human Acute Tubular Necrosis. Kidney Blood Press. Res. 2016, 41, 746–756. [Google Scholar] [CrossRef] [PubMed]
- Ba Aqeel, S.H.; Sanchez, A.; Batlle, D. Angiotensinogen as a biomarker of acute kidney injury. Clin. Kidney J. 2017, 10, 759–768. [Google Scholar] [CrossRef] [PubMed]
- Chrysostomou, A.; Becker, G. Spironolactone in addition to ACE inhibition to reduce proteinuria in patients with chronic renal disease. N. Engl. J. Med. 2001, 345, 925–926. [Google Scholar] [CrossRef] [PubMed]
- Chrysostomou, A.; Pedagogos, E.; MacGregor, L.; Becker, G.J. Double-blind, placebo-controlled study on the effect of the aldosterone receptor antagonist spironolactone in patients who have persistent proteinuria and are on long-term angiotensin-converting enzyme inhibitor therapy, with or without an angiotensin II receptor blocker. Clin. J. Am. Soc. Nephrol. 2006, 1, 256–262. [Google Scholar] [CrossRef]
- Mejia-Vilet, J.M.; Ramirez, V.; Cruz, C.; Uribe, N.; Gamba, G.; Bobadilla, N.A. Renal ischemia-reperfusion injury is prevented by the mineralocorticoid receptor blocker spironolactone. Am. J. Physiol. Renal. Physiol. 2007, 293, F78–F86. [Google Scholar] [CrossRef]
- Sanchez-Pozos, K.; Barrera-Chimal, J.; Garzon-Muvdi, J.; Perez-Villalva, R.; Rodriguez-Romo, R.; Cruz, C.; Gamba, G.; Bobadilla, N.A. Recovery from ischemic acute kidney injury by spironolactone administration. Nephrol. Dial. Transplant. 2012, 27, 3160–3169. [Google Scholar] [CrossRef]
- Chen, C.; Liang, W.; Jia, J.; van Goor, H.; Singhal, P.C.; Ding, G. Aldosterone induces apoptosis in rat podocytes: Role of PI3-K/Akt and p38MAPK signaling pathways. Nephron. Exp. Nephrol. 2009, 113, e26–e34. [Google Scholar] [CrossRef]
- Barrera-Chimal, J.; Perez-Villalva, R.; Rodriguez-Romo, R.; Reyna, J.; Uribe, N.; Gamba, G.; Bobadilla, N.A. Spironolactone prevents chronic kidney disease caused by ischemic acute kidney injury. Kidney Int. 2013, 83, 93–103. [Google Scholar] [CrossRef]
- Kovarik, J.J.; Kaltenecker, C.C.; Domenig, O.; Antlanger, M.; Poglitsch, M.; Kopecky, C.; Saemann, M.D. Effect of Mineralocorticoid Receptor Antagonism and ACE Inhibition on Angiotensin Profiles in Diabetic Kidney Disease: An Exploratory Study. Diabetes Ther. 2021, 12, 2485–2498. [Google Scholar] [CrossRef] [PubMed]
- Barrera-Chimal, J.; Andre-Gregoire, G.; Nguyen Dinh Cat, A.; Lechner, S.M.; Cau, J.; Prince, S.; Kolkhof, P.; Loirand, G.; Sauzeau, V.; Hauet, T.; et al. Benefit of Mineralocorticoid Receptor Antagonism in AKI: Role of Vascular Smooth Muscle Rac1. J. Am. Soc. Nephrol. 2017, 28, 1216–1226. [Google Scholar] [CrossRef] [PubMed]
- Jeong, B.Y.; Lee, H.Y.; Park, C.G.; Kang, J.; Yu, S.L.; Choi, D.R.; Han, S.Y.; Park, M.H.; Cho, S.; Lee, S.Y.; et al. Oxidative stress caused by activation of NADPH oxidase 4 promotes contrast-induced acute kidney injury. PLoS ONE 2018, 13, e0191034. [Google Scholar] [CrossRef] [PubMed]
- Nakazawa, D.; Kumar, S.V.; Marschner, J.; Desai, J.; Holderied, A.; Rath, L.; Kraft, F.; Lei, Y.; Fukasawa, Y.; Moeckel, G.W.; et al. Histones and Neutrophil Extracellular Traps Enhance Tubular Necrosis and Remote Organ Injury in Ischemic AKI. J. Am. Soc. Nephrol. 2017, 28, 1753–1768. [Google Scholar] [CrossRef]
- Simmons, E.M.; Himmelfarb, J.; Sezer, M.T.; Chertow, G.M.; Mehta, R.L.; Paganini, E.P.; Soroko, S.; Freedman, S.; Becker, K.; Spratt, D.; et al. Plasma cytokine levels predict mortality in patients with acute renal failure. Kidney Int. 2004, 65, 1357–1365. [Google Scholar] [CrossRef]
- Serteser, M.; Koken, T.; Kahraman, A.; Yilmaz, K.; Akbulut, G.; Dilek, O.N. Changes in hepatic TNF-alpha levels, antioxidant status, and oxidation products after renal ischemia/reperfusion injury in mice. J. Surg. Res. 2002, 107, 234–240. [Google Scholar] [CrossRef]
- Li, L.; Huang, L.; Vergis, A.L.; Ye, H.; Bajwa, A.; Narayan, V.; Strieter, R.M.; Rosin, D.L.; Okusa, M.D. IL-17 produced by neutrophils regulates IFN-gamma-mediated neutrophil migration in mouse kidney ischemia-reperfusion injury. J. Clin. Investig. 2010, 120, 331–342. [Google Scholar] [CrossRef]
- Wu, H.; Ma, J.; Wang, P.; Corpuz, T.M.; Panchapakesan, U.; Wyburn, K.R.; Chadban, S.J. HMGB1 contributes to kidney ischemia reperfusion injury. J. Am. Soc. Nephrol. 2010, 21, 1878–1890. [Google Scholar] [CrossRef]
- Ma, K.; Gao, W.; Xu, H.; Liang, W.; Ma, G. Role and Mechanism of the Renin-Angiotensin-Aldosterone System in the Onset and Development of Cardiorenal Syndrome. J. Renin. Angiotensin. Aldosterone Syst. 2022, 2022, 3239057. [Google Scholar] [CrossRef]
- Menez, S.; Parikh, C.R. Renin-Angiotensin System Blockade after Acute Kidney Injury: The Plot Thickens. Clin. J. Am. Soc. Nephrol. 2020, 15, 2–4. [Google Scholar] [CrossRef]
- Nishiyama, A.; Abe, Y. Molecular mechanisms and therapeutic strategies of chronic renal injury: Renoprotective effects of aldosterone blockade. J. Pharmacol. Sci. 2006, 100, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primers (5′-3′) | Reverse Primers (5′-3′) |
---|---|---|
GAPDH | GTGGCAAAGTGGAGATTGTTG | TTGACTGTGCCGTTGAATTTG |
IL-1β | TCGCAGCAGCACATCAACAAGAG | GGTGCTCATGTCCTCATCCTGGA |
IL-6 | CCAATTCATCTTGAAATCAC | GGAATGTCCACAAACTGATA |
MCP-1 | ACCTTTGAATGTGAAGTTGA | CTACAGAAGTGCTTGAGGTG |
MIP-2 | AGAGGGTGAGTTGGGAACTA | GCCATCCGACTGCATCTATT |
NGAL | CACCACGGACTACAACCAGTTCGC | TCAGTTGTCAATGCATTGGTCGGTG |
α-SMA | TCAGGGAGTAATGGTTGGAATG | GGTGATGATGCCGTGTTCTA |
TGF-β | CGAAGCGGACTACTATGCTAAA | TCCCGAATGTCTGACGTATTG |
TNFα | CATATACCTGGGAGGAGTCT | GAGCAATGACTCCAAAGTAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, E.J.; Je, J.; Dusabimana, T.; Yun, S.P.; Kim, H.J.; Kim, H.; Park, S.W. Mineralocorticoid Receptor Antagonism Attenuates Multiple Organ Failure after Renal Ischemia and Reperfusion in Mice. Int. J. Mol. Sci. 2023, 24, 3413. https://doi.org/10.3390/ijms24043413
Park EJ, Je J, Dusabimana T, Yun SP, Kim HJ, Kim H, Park SW. Mineralocorticoid Receptor Antagonism Attenuates Multiple Organ Failure after Renal Ischemia and Reperfusion in Mice. International Journal of Molecular Sciences. 2023; 24(4):3413. https://doi.org/10.3390/ijms24043413
Chicago/Turabian StylePark, Eun Jung, Jihyun Je, Theodomir Dusabimana, Seung Pil Yun, Hye Jung Kim, Hwajin Kim, and Sang Won Park. 2023. "Mineralocorticoid Receptor Antagonism Attenuates Multiple Organ Failure after Renal Ischemia and Reperfusion in Mice" International Journal of Molecular Sciences 24, no. 4: 3413. https://doi.org/10.3390/ijms24043413