Genomic SELEX Reveals Pervasive Role of the Flagella Master Regulator FlhDC in Carbon Metabolism

Abstract

Flagella are vital bacterial organs that allow microorganisms to move to favorable environments. However, their construction and operation consume a large amount of energy. The master regulator FlhDC mediates all flagellum-forming genes in E. coli through a transcriptional regulatory cascade, the details of which remain elusive. In this study, we attempted to uncover a direct set of target genes in vitro using gSELEX-chip screening to re-examine the role of FlhDC in the entire E. coli genome regulatory network. We identified novel target genes involved in the sugar utilization phosphotransferase system, sugar catabolic pathway of glycolysis, and other carbon source metabolic pathways in addition to the known flagella formation target genes. Examining FlhDC transcriptional regulation in vitro and in vivo and its effects on sugar consumption and cell growth suggested that FlhDC activates these new targets. Based on these results, we proposed that the flagella master transcriptional regulator FlhDC acts in the activation of a set of flagella-forming genes, sugar utilization, and carbon source catabolic pathways to provide coordinated regulation between flagella formation, operation and energy production.

1. Introduction

Flagella motility helps bacteria reach favorable environments and is vital in substrate adhesion, biofilm formation, and virulence processes [1]. Bacterial flagellum synthesis genes form an ordered cascade in which the expression of one gene at a given level requires the transcription of another gene at a higher level [2,3]. This regulatory cascade includes three gene classes. In Escherichia coli, a model bacterium, class I genes form the flhDC master operon at the top of the hierarchy, encoding an FlhDC (more specifically, FlhD₄C₂) transcriptional activator of class II gene expression [4]. Most class II genes encode flagella export system and basal body components. The fliA gene at this second level encodes a sigma factor, σ²⁸ (or RpoF), specific for flagella genes [5,6]. σ²⁸ and the anti-sigma factor FlgM positively and negatively regulate class III operons, respectively [7]. The cell retains the anti-sigma factor until the flagella basal body and hook are completed [8].

The flhDC operon is at the top of the flagella regulatory cascade and encodes the FlhDC activator required for the expression of all other genes in the flagella regulon. FlhD and FlhC form a heterohexamer (D₄C₂) that binds upstream of class II promoters and stimulates class II gene transcription [9]. The FlhD and FlhC proteins are class I transcription factors (TFs). The C-terminal domain of the RNA polymerase α-subunit is essential for transcriptional activation [10]. The DNA fragment bound by FlhDC, called the FlhDC-box, contains two 16 bp inverted repeats, with a 10–12 bp spacer between them [11,12,13,14]. The flhDC gene is under the control of multiple TFs that integrate various environmental cues (listed in the RegulonDB database (regulondb.ccg.unam.mx). Additionally, see the review in Ishihama et al., 2016 [15]). CRP (TF for secondary carbon source catabolism), H-NS (for nucleoid-associated multifunction), and QseB (for quorum-sensing) are known activators. AcrR (for acriflavine resistance), Fur (for iron homeostasis), FliZ (for curli and motility), HdfR (for flagella master operon flhDC), IHF (for nucleoid-associated multifunction), LrhA (for fimbriae synthesis), MatA (for flagellum biosynthesis), OmpR (for outer membrane proteins), RcsAB (for capsule synthesis), and YjjQ (for flagella synthesis) are known flhDC repressors.

Researchers have attempted to identify the FlhDC regulon using ChIP-seq to identify FlhDC-binding sites across the E. coli genome [14] and microarray analysis to determine the effect of flhDC deletion and overexpression [12,16] on global gene expression in vivo. These genome-wide approaches have revealed novel FlhDC targets. However, it is difficult to distinguish between the direct and indirect effects of FlhDC. For instance, the direct targets of TFs generally represent only minor fractions of the genes detected by microarray and RNA-seq analyses. Especially for FlhDC, genes encoding other transcription regulators are organized together to form a complex regulatory network downstream of a specific regulator [17,18]. In vivo analyses can also be difficult because a set of regulatory proteins involved in single promoter regulation often compete for binding at overlapping DNA sites [15].

In this study, we performed genomic SELEX (gSELEX) to screen FlhDC-recognized genomic DNA sequences to avoid the problems associated with in vivo experiments describe above. The original SELEX screening method uses randomized synthetic oligonucleotides to identify the target DNA sequence of a tested protein. However, after an in silico computer-based homology search for consensus sequences, it is difficult to uncover the whole set of target genes from the entire genome because one must distinguish between true and false positives. On the other hand, the gSELEX screening system uses genome fragments with all FlhDC target DNA sequences. It was developed to directly identify DNA sequences recognized in vitro by DNA-binding TFs [19,20] and target promoters, genes, and operons under the direct control of each TF. We have successfully applied the gSELEX screening system to identify the regulatory targets of more than 150 TFs from a single species: E. coli K-12 W3350 [15,21]. Here, we used a gSELEX-chip system to identify FlhDC-binding sites in the E. coli K-12 genome. The results indicated that FlhDC regulates genes involved in flagella formation, sugar utilization, and carbon source metabolism.

2. Results

2.1. Identification of FlhDC Regulation Targets per gSELEX-Chip Screening

We performed gSELEX screening using an improved method to identify a set of FlhDC-binding sequences [19,20]. Purified His-tagged FlhDC was mixed with a mixture of 200–300 bp E. coli genomic fragments, and FlhDC-bound DNA fragments were affinity-isolated. The original substrate mixture of original genomic DNA fragments showed smear PAGE bands. However, after six cycles of gSELEX, DNA fragments with a high FlhDC affinity were enriched, forming sharper bands on the PAGE gels (Figure S1).

gSELEX fragments and the original DNA library were labeled with Cy3 and Cy5, respectively, to uncover a comprehensive set of FlhDC-controlled targets. A mixture of fluorescently labeled samples was hybridized onto an E. coli DNA tiling microarray [22]. The ratio of the fluorescence intensity between the FlhDC sample and the original DNA library of each probe was measured and plotted against the corresponding position along the E. coli K-12 genome. The extent of FlhDC binding correlated with its FlhDC affinity. After setting the cutoff level to twenty, 17 peaks were identified in the gSELEX-chip pattern (Figure 1), and 38 additional peaks were identified by decreasing the cutoff level to ten (

Table 1. FlhDC-binding sites on the E. coli genome.

	Peak Position (bp)	Intensity	gSELEX Peak Type	Function	Operon	gene	D	FlhDC Site	D	gene	Operon	Function	FlhDC Box	position of FlhDC Box (bp)	Database (Known Target)
[Inside spacer regions]
1	45772	21	B			fixX	>		>	yaaU	yaaU	predicted transporter	TACCCGTCAGCGGGCGTTTTCC ATCAGCTTTATTGCCGCGATG	45985.5
2	331130	22	B			betT	>		>	pdeL	pdeL	predicted DNA-binding transcriptional regulator
3	395546	10	A	beta-lactamase/D-alanine carboxypeptidase	ampH	ampH	<		>	sbmA	sbmA-yaiW	predicted transporter	TTCCGGGCAGATCCCGATTAG CGCCGCGCGTTTCTGGTCGTT	395756
4	479234	13	B	maltose O-acetyltransferase	maa	maa	<		<	hha			AACGCATTAAATAATCGGTTTT CGTTAAAGGTTTTTCGGACATA	479262
5	703072	18	A	glucosamine-6-phosphate deaminase	nagBAC-umpH	nagB	<		>	nagE	nagE	fused N-acetyl glucosamine specific PTS enzyme: IIC, IIB, and IIA components	AACGAGCCAAATAGGGTTCTC GTAGGGGGAATAAGATGAATA	702903
6	791354	11	B	UDP-galactose-4-epimerase	galETKM	galE	<		<	modF			AAACAAACAACAATTGCGTT TCACCTTCGCTAATCAGCACATC	791409
7	1057170	12	A	DNA-binding response regulator in two-component regulatory system with TorS	torR	torR	<		>	torC	torCAD	trimethylamine N-oxide (TMAO) reductase I, cytochrome c-type subunit	AACTCTGGAACGCGCTACGCCG ACCCAGTGCTCGTTGGTCGGTA	1057086
8	1130058	13	A	assembly protein for flagellar basal-body periplasmic P ring	flgAMN	flgA	<		>	flgB	flgBCDEFGHIJ	flagellar component of cell-proximal portion of basal-body rod	AACGGCATAAATAGCGACCC ATTTTGCGTTTATTCCGCCGAT	1129912	flgA, flgB
9	1276852	11	A	sensory histidine kinase in two-component regulatory system with NarL	narXL	narX	<		>	narK	narK	nitrate/nitrite transporter	AACAACGCGGTCAACGTATTG CCAGCCGCAACCTGTGGATTT	1277030
10	1297734	26	A	alcohol dehydrogenase	adhE	adhE	<		>	ychE	ychE	predicted inner membrane protein	AATGCTGTCAAAAGGCGTATT GTCAGCGCGTCTTTTCAACCTTA	1297508
11	1488832	11	B			aldA	>		>	cybB	cybB	cytochrome b561	TAAGGCTGAAATACCCAACCC CGCCGATTATACCTAAGCCAAA	1488882
12	1525236	11	B			yncH	>		>	ydcD	rhsE-ydcD	predicted protein
13	1528470	11	B			ydcD	>		>	ydcC	ydcC	conserved protein	AAGATCATGAAAATTGTGATG TAAATCACGATTTTCATCTTT	1528271
14	1570272	10	B	glutamate decarboxylase B, PLP-dependent	gadBC	gadB	<		<	pqqL			AACGGCAGTGTTAACATTCTCT ACCGTCATTTGTTTCAACAATT	1570260
15	1580646	21	B	conserved protein	ydeNM	ydeN	<		<	ydeO			AAATAATCAAATAGCTAAAGC ATTCATCGTGTTGCCCGTATT	1580715
16	1588868	18	B	predicted fimbrial-like adhesin protein	ydeTSR	ydeS	<		<	hipA			AATGTCGCGGATAAATTTTAT CGATTGCCGTTTTTTTGCCTTT	1588853
17	1744232	28	A	conserved protein	ydhQ	ydhQ	<		>	valV	valVW	Val tRNA	AACGGTCGAAATAGCGCAGAA AATTACGTTTTGCCTCTTGCC	1744138
18	1860030	38	B	conserved protein	yeaC	yeaC	<		<	msrB			ATCGTTTTTTCAACCGTTGATT TCTTCGCCGTTTTCGCCATC	1859802
19	1986256	11	A	ncRNA	isrB	isrB	<		>	yecR	yecR	predicted protein	AATATTTTAATCAGCGAGGGGAT CTTCGCTGATTAAAGAAAT	1986340	yecR
20	1999848	10	B	RNA polymerase, sigma 28 (sigma F) factor	fliAZY	fliA	<		<	fliC			AATCGGACGATTAGTGGGTGAA ATGAGGGGTTATTTGGGGGTTA	1999646	fliA
21	2011168	54	A	flagellar basal-body component	fliE	fliE	<		>	fliF	fliFGHIJK	flagellar basal-body MS-ring and collar protein	AACGCCGTCCATAATCAGCCAC GAGGTGCGCGATGAATGCGACT	2010993	fliE, fliF
22	2017552	10	B			fliK	>		>	fliL	fliLMNOPQR	flagellar biosynthesis protein	AAAGCGCAGCAACGCGTCGTGC CCTCACCGGTCTTCTACGCGCT	2017546	fliL
23	2246656	16	B	lysine transporter	lysP	lysP	<		<	yeiE
24	2261652	82	A	fructose-specific PTS enzymes: IIA component	fruBKA	fruB	<		>	setB	setB	lactose/glucose efflux system	GGCGTTTTTAATCGTTGCCTTT CTCACCGGTATTGCGGGCGCT	2261710
25	2466256	22	B			yfdG	>		>	yfdH	yfdGHI	CPS-53 (KpLE1) prophage; bactoprenol glucosyl transferase
26	2531672	13	B			cysK	>		>	ptsH	ptsHI-crr	phosphohistidinoprotein-hexose phosphotransferase component of PTS system (Hpr)	ATCTGGTTAAACTGATGGCGG AACTCGAGTAATTTCCCGGGTT	2531784
27	2627634	10	B			yfgG	>		>	yfgH	yfgHI	predicted outer membrane lipoprotein	GGCGCGCTTATTGGCGCAGTC GCTGGCGGTGTTATCGGCCAC	2627801
28	2859272	11	A	predicted DNA-binding transcriptional regulator	ygbI	ygbI	<		>	ygbJ	ygbJK	predicted dehydrogenase, with NAD(P)-binding Rossmann-fold domain	AATGCCTGCGCTACGTTGAAA GAGGCAGGTGCTTGCGGGGTT	2859340	ygbJ
29	2989270	11	A	predicted protein	yqeK	yqeK	<		>	ygeG	ygeG	predicted chaperone	GGGGCTAAAAATATCGATAAC GCAATGCAATGTTTCTATCACA	2989422
30	3071934	98	B	D-erythrose 4-phosphate dehydrogenase	epd-pgk-fbaA	epd	<		<	yggC			CTTCGGCTACTTGCCGCGTTA ATCCTCCCGCAATTTTACGACTA	3071883
31	3086262	30	B			metK	>		>	galP	galP	D-galactose transporter	TCGGGCGCAAAAAGAGCCTGAT GATCGGCGCAATTTTGTTTGTT	3086313
32	3122256	12	B	conserved protein	glcDEFGBA	glcG	<		<	glcF			ATCGCCGCGAATTGCCAGTTTT TCCAGCGGTTCCTCGCGCAGA	3122357
33	3132170	11	A	predicted protein with nucleoside triphosphate hydrolase domain	yghSR	yghS	<		>	yghT	yghT	predicted protein with nucleoside triphosphate hydrolase domain	CAGGCCGGAAATGTCGGTCGT GCAGTGACAAAATTACCGTTGAT	3132054
34	3214830	74	A	predicted siderophore interacting protein	yqjH	yqjH	<		>	yqjI	yqjI	predicted transcriptional regulator	AACGCATCAAAGCGCGTTGCGT TGGCGCGGCGCTGCGCCAGAA	3215012
35	3651858	14	A	IS5 transposase and trans-activator	insH11	insH	<		>	slp	slp-dctR	outer membrane lipoprotein
36	3989170	50	A	hydroxymethylbilane synthase	hemCDXY	hemC	<		>	cyaA	cyaA	adenylate cyclase
37	4213236	21	B			metA	>		>	aceB	aceBAK	malate synthase A	ACAGGCAACAACAACCGATGA ACTGGCTTTCACAAGGCCGTA	4213530
38	4221834	873	A	DNA-binding transcriptional repressor	iclR	iclR	<		>	metH	metH	homocysteine-N5-methyltetrahydrofolate transmethylase	CACGCCAGAGAAACCGCGCTA CGTTGCCGGTGTTCTCGGCCCG	4221985
39	4240352	10	B	D-xylose transporter	xylE	xylE	<		<	malG
40	4281146	13	B	conserved protein	yjcF	yjcF	<		<	actP			ACTGCGGTAATCAGCCCCAGCC AGCCACCCATCATCGCGCCACG	4281280
41	4414856	19	A	conserved protein	bsmA	yjfO	<		>	yjfP	yjfP	predicted hydrolase	GATGATTGAAATAGAATCACGC GAGCTGGCAGATATTCCCGTT	4414746
42	4425648	11	B	predicted protein	yjfZ	yjfZ	<		<	ytfB
43	4464250	42	B	trehalose(maltose)-specific PTS enzyme: IIB component/IIC component	treBC	treB	<		<	treR			CTTGCGCCAAGTGCCAGCGTGT CGGTTGCGCACAGTAAGGCGGT	4464299
44	4638812	13	B			yjjY	>		>	yjtD	yjtD	predicted rRNA methyltransferase	GTCGGGCGAAATATCATTACT ACGCCACGCCAGTTGAACTGGT	4638978
[Inside genes, or downstrem of both transcription unit]
45	1092430	11	C	predicted outer membrane protein	pgaABCD	pgaA	<	ycdT	<	insF			GATATCTGGAATGGAGTGACG GTGATTGCTTTTTGTGCCGTA	1092524
46	1223252	14	C			ymgJ	>		<	minE			AAGAATAGAAATATCGCCATC TTTTTGCTCAAGCTGTACGGTT	1223316
47	1776868	10	C			ydiO	>	ydiP	>	ydiQ	ydiQRST-fadK	conserved protein	CCGGCGACAAACAGCGTTTCA CTGGCGTTATCAAAACAGCGTT	1777048
48	1981072	27	C	trehalose-6-phosphate phosphatase, biosynthetic	otsBA	otsB	<	araH	<	araG
49	2043166	14	C			asnT	>	yeeJ	>	shiA	shiA	shikimate transporter	ATCGGCCCAAAGCGTTGCCGA ACGTTTCGGTATTTCGGTGGCT	2042964
50	2120630	20	C	predicted UDP-glucose lipid carrier transferase	wcaCDEF-gmd-fcl-gmm-wcaI-cpsBG-wcaJ-wzxC	wcaJ	<	cpsG	<	cpsB			AGCAGGTTAATTTTTTCATAT CGTTACCCTTTTTCAGGCAAT	2120756
51	2732852	13	C	ncRNA	ryfD	ryfD	<	yfiH	<	rluD
52	3134160	16	C			yghT	>	pitB	<	gsp
53	3630156	11	C	predicted HlyD family secretion protein	yhiI-rbbA-yhhJ	yhiI	<	yhiJ	>	yhiM	yhiM	conserved inner membrane protein	AATATCGGTATTATCAAGAGA GCAACCGTAATTTTTGCTATT	3630007
54	4236932	30	C			yjbG	>	yjbH	<	yjbT			AACCGGACATCTGACCGCCT ACTGGACGCCATCTTTCGCTCA	4237161
55	4635274	13	C			creB	>	creC	>	creD	creABCD	inner membrane protein	TACTGACAACATTCTGACGCA AAATGCGCGTATGCAGGCATT	4635368

). Of these 55 high-level binding peaks, 18 FlhDC-binding sites were located within spacers of bidirectional transcription units (Table 1, type-A), and 26 FlhDC-binding sites were located within spacers upstream of one ORF but downstream of another ORF (Table 1, type-B). Eleven FlhDC-binding sites were located within the genes or downstream of both transcription units (Table 1, type-C). Hence, we predicted that the total number of FlhDC regulatory targets was between at least 44 (18 type-A and 26 type-B) and 62 (18 × 2 type-A and 26 × 1 type-B).

Currently, the RegulonDB database lists 20 genes or operons as FlhDC targets ([23,24]. regulondb.ccg.unam.mx (accessed on 1 December 2022)). gSELEX screening detected seven of these targets above the cutoff level of ten (Table 1), with the highest peak intensity at 54 for the fliE gene, which encodes a component of the flagellum hook-basal body subunit. Notably, at this cutoff setting, many known FlhDC targets involved with the flagella genes, including the flgAMN, flgBCDEFGHIJ, fliAZ-tcyJ, and fliLMNOPQR operons, were detected (Table 1). However, the known target, the fliDST operon, which is critical in flagellin biosynthesis and assembly, showed a peak intensity of six.

2.2. Verification of FlhDC Consensus Recognition Sequence

Using the DNA-binding sequence information from a set of FlhDC target sequences, a 42–44 bp palindromic sequence consisting of AAYGSSNNAAATAGCG-N_10-12-CGCTATTTNNSSCRTT was proposed as the consensus recognition sequence for FlhDC [11,12,13,14]. As we obtained 49 new FlhDC-binding sites, the FlhDC consensus sequence was analyzed using the MEME program [25] to identify the FlhDC-box sequence in the newly targeted regions. We identified the same 42–44 bp sequence in 44 of the 55 FlhDC target regions (Table 1), and the high conservation of the A₁, A₂, G₄, A₉, A₁₀, A₁₁, T₁₂, and A₁₃ bases was also consistent (Figure 2) [12]. These results suggest that the novel target genes of FlhDC identified by the gSELEX screening was valid.

2.3. FlhDC Binding In Vitro to the New Target Genes Involved in Sugar Utilization and Carbon Source Metabolism

FlhDC (formerly FlbBl) was originally identified as a flagella operon regulator [26]. Subsequently, several research groups have performed comprehensive in vivo analyses, including transcriptome and ChIP-seq analyses [11,12,14]. FlhDC is the principal regulator of bacterial flagellum biogenesis and swarming migration, and a microarray showed that it regulates several non-flagella genes. However, there was no evidence that these genes were directly regulated by FlhDC. gSELEX screening identified FlhDC-binding sites in several promoter regions of genes involved in sugar utilization and carbon source metabolism (Figure S2c–i), in addition to known FlhDC target genes involved in flagella formation (Figure S2a,b). Genes involved in sugar utilization, such as the ptsHI-crr operon (phosphoenolpyruvate: sugar phosphotransferase system (PTS) for PTS sugar utilization), fruBKA operon (fructose-specific PTS system and fructose utilization), and setB (sugar transporter), and genes involved in carbon source metabolism, such as pfkA (6-phosphofructokinase (I), the epd-pgk-fbaA operon (D-erythrose-4-phosphate dehydrogenase, phosphoglycerate kinase, fructose-bisphosphate aldolase (II), adhE (acetaldehyde-CoA dehydrogenase/alcohol dehydrogenase), the aceBAK operon (malate synthase, isocitrate lyase, isocitrate dehydrogenase kinase/phosphatase), and iclR (isocitrate lyase TF), were included in the list of predicted FlhDC targets (Table 1, Figure S2).

We focused on a set of genes involved in sugar utilization and carbon source metabolism to verify this novel role of FlhDC and analyzed the effects of FlhDC on gene regulation. We examined the in vitro binding of purified FlhDC complexes to sequences isolated by gSELEX screening using PAGE to confirm FlhDC–DNA complex formation. Upon increasing FlhDC supplementation, DNA fragments from the probes of known FlhDC targets detected in the gSELEX-chip formed FlhDC–DNA complexes in an FlhDC concentration-dependent manner (Figure 3a,b). The new targets were tested under the same conditions. FlhDC–DNA complex formation was observed for all tested probes depending on the FlhDC concentration (Figure 3c–i). In addition, FlhDC consensus sequences were identified in all the binding regions (Table 1). In contrast, the purH/rrsE intergenic region, the reference DNA added as a negative control (Figure S2j), did not form FlhDC–DNA complexes under the same conditions (Figure 3j). These results indicated specific binding of all seven FlhDC target sequences.

2.4. In Vivo Transcription Regulation of the Set of FlhDC Target Genes Involved in Sugar Utilization and Carbon Source Metabolism

We performed a Northern blotting analysis to examine the possible influence of FlhDC on target promoters detected in vitro based on FlhDC-binding sites and determined mRNA levels in vivo for each of the predicted FlhDC target genes in the presence or absence of FlhDC. Wild-type E. coli K-12 and the flhD-deleted mutant grown in M9-glucose (0.2%) medium and total RNA was extracted in the exponential phase. The mRNA levels of individual FlhDC target genes were analyzed by Northern blotting analysis. The mRNA levels of fliAZY and flgBCDEFGHIJ, known targets for which FlhDC acts as an activator, were detected using fliA and flgB probes, respectively. Both transcripts decreased markedly in the flhD knockout mutant (Figure 4). ptsHI-crr, fruBKA, setB, pfkA, epd-pgk-fbaA, aceBAK, and iclR mRNA levels also significantly decreased in the flhD mutant (Figure 4), implying that FlhDC has an activating role in these transcription units. adhE mRNA levels slightly decreased, indicating that FlhDC also acts as an adhE activator. metH, located in the divergence from iclR, was not affected, suggesting that FlhDC binding between the iclR/metH intergenic region activates iclR. pfkA encodes 6-phosphofructokinase I, a key rate-limiting enzyme in the glycolysis pathway [27,28]. These results suggest that FlhDC directly activates genes involved in flagella formation and carbon source metabolism, mainly the PTS sugar uptake and glycolysis pathways.

2.5. The Effects of FlhDC on Sugar Utilization and Cell Growth

Transcriptional regulation analyses suggested that FlhDC activates a set of carbon source metabolism genes involved in glucose uptake (ptsHI-crr), fructose uptake and utilization (fruBKA), and glycolysis (pfkA, pgk, fbaA) (Figure 4). Cell growth and sugar consumption of wild-type and flhD-deficient strains in glucose and fructose sole carbon source media were observed to evaluate the effects of FlhDC on glucose and fructose uptake and catabolism. After 8 h of incubation in the glucose sole carbon source medium, the cell density of the wild-type strain reached OD₆₀₀ = 0.85, and the glucose concentration decreased to 0.1% (Figure 5a). The OD₆₀₀ was less than 0.3 in the flhD-deficient strain, and approximately 0.15% of the glucose remained. After 12 h of incubation, the wild-type strain entered the stationary phase, and the glucose in the medium was depleted, whereas the flhD-deficient strain continued to grow and left 0.03% of the glucose remaining. The effect of flhD deficiency on the fructose medium was similar to that on the glucose medium, with slower growth and more fructose remaining in the medium in the flhD-deficient strain than in the wild-type strain (Figure 5b). Note that there was no difference in cell growth between the wild-type and flhD deficient strains on LB medium (data not shown). These results suggest that flhDC stimulates energy production by accelerating the uptake and catabolism of PTS sugars, such as glucose and fructose.

3. Discussion

Motility is necessary for microorganisms to adapt to environmental changes, and the precise control of flagella formation is critical. Flagella formation in E. coli has been well-described [2,3]. The class I flagella master regulator FlhDC initiates the signal cascade mechanism for flagella formation. FlhDC-activated class II genes include those involved in flagella basal body formation and flagella sigma factors, RpoF (σ²⁸). RpoF induction stimulates class III genes to assemble the hook and flagella filaments and complete flagella formation. Comprehensive in vivo analysis has been used to uncover the direct regulation of a set of genes involved in flagella formation [12,14]. Hitherto, microarray analysis showed that FlhDC regulates several non-flagella genes and/or operons involved in metabolism [11,16], such as the glpABC operon for glycerol degradation, the gltI-sroC-gltJKL operon (glutamate/aspartate transporter), mdh (malate dehydrogenase), the mglBAC operon (D-galactose transporter), the napFDAGHBC-ccmABCDEFGH operon (nitrate reductase), and the nrfABCDEFG operon (nitrite reductase) (listed in the RegulonDB database as FlhDC targets). However, the direct effect on these genes has not yet been determined, and only the nrfABCDEFG operon was detected in our gSELEX screening among the FlhDC low-intensity peaks (intensity level of eight; data not shown). In this study, we used a gSELEX analysis, which can identify direct target DNA sequences in vitro, to determine the genomic regulatory mechanisms of FlhDC. The results showed that previously unknown targets of class II flagellum-forming genes are involved in carbon source metabolism (Figure 1, Table 1), and FlhDC activates these genes (Figure 3 and Figure 4). As for the effects of these regulations on the phenotype, FlhDC stimulated the consumption of glucose and fructose and accelerated cell growth (Figure 5).

Novel genes regulated by FlhDC affect sugar utilization and metabolism of carbohydrate sources. The ptsHI-crr operon imports PTS sugars, such as glucose and fructose, and the fruBKA operon controls fructose import and utilization [29]. After uptake, sugars are catabolized in the glycolysis pathway and used for energy production such as ATP and NADH [28]. In the glycolysis pathway, the conversion of D-fructose 6-P to D-fructose 1,6-P2 via 6-phosphofructokinase is crucial for regulating the activity of the glycolysis pathway because this reaction is irreversible. E. coli has two 6-phosphofructokinase genes: pfkA encoding 6-phosphofructokinase 1 (PFK I), and pfkB encoding 6-phosphofructokinase 2 (PFK II). More than 90% of the phosphofructokinase activity in wild-type E. coli can be attributed to PFK I [27], suggesting that pfkA transcriptional activation via FlhDC has a marked effect on glycolysis activation. The epd-pgk-fbaB operon, activated by FlhDC, also contains pgk-encoded phosphoglycerate kinase and fbaB-encoded fructose-bisphosphate aldolase, enzymes for reversible reactions, suggesting that an increased carbon flux in the glycolysis pathway also occurs. Two pathways that metabolize the glycolysis product acetyl coenzyme A (acetyl-CoA) from sugars, the ethanol fermentation and glyoxylate pathways, were also identified as targets of FlhDC. adhE encodes fused acetaldehyde-CoA dehydrogenase and alcohol dehydrogenase. Thus, this enzyme catalyzes sequential two-step reactions, converting acetyl-CoA + NADH → acetaldehyde + coenzyme A + NAD⁺ and acetaldehyde + NADH → ethanol + NAD⁺. This multifunctional enzyme (AdhE) acts under anaerobic conditions to re-oxidize NADH to NAD⁺ because the glycolysis pathway requires NAD⁺ for sugar catabolism. FlhDC may activate adhE to maintain glycolysis activity under anaerobic conditions and energy production for flagella. In contrast, under aerobic conditions, the TCA cycle consumes an acetyl-CoA-derived carbon source to produce NADH for ATP production via an oxidative electron transfer system. The glyoxylate pathway is an anaplerotic reaction that enables E. coli to use acetyl-CoA as a carbon substrate. It consists of two enzymes, isocitrate lyase encoded by aceA, and malate synthase encoded by aceB. Isocitrate dehydrogenase kinase/phosphatase controls the activity of icd-encoded isocitrate dehydrogenase, a key enzyme for switching shifts between the TCA and glyoxylate pathways. FlhDC may activate the aceABK operon to maintain the activity of the TCA cycle under aerobic conditions to produce NADH for ATP production. On the other hand, this study focused on a group of genes in which FlhDC bound to the promoter region, and several binding regions were identified on the ORF (Table 1). It has been reported that transcription factors bind on ORFs [30] and examining these effects of these bindings may reveal new regulatory mechanisms.

Flagella synthesis and function are costly for cells [2,31]. Recently, it was estimated that all the flagella on a cell consume 10.2% of the intercellular ATP produced by E. coli (5% for construction and 5.2% for operating costs) [32]. Hence, we propose that cooperative transcription regulation of flagella and energy production (sugar utilization and carbon source metabolism) occur via the flagella master regulator FlhDC. Although this study examined the effects of FlhDC on a set of genes involved in central carbon metabolism with high FlhDC-binding strength using gSELEX screening, various other genes involved in carbon source metabolism and other biological functions were identified as novel FlhDC targets. Further studies could validate the effects of these genes to accelerate our understanding of the role of FlhDC in the entire E. coli genome.

4. Materials and Methods

4.1. Bacterial Strains and Plasmids

E. coli K-12 W3110 type-A [33] were used as the DNA source to construct the FlhD and FlhC expression plasmids. The E. coli K-12 W3110 type-A genome was also used to construct the DNA library required for gSELEX screening. E. coli DH5α cells were used for plasmid amplification, and E. coli BL21 (DE3) cells were used for FlhD and FlhC expression. E. coli BW25113 [34] and its flhD single-gene knockout mutant JW1881 [35] were obtained from the E. coli Stock Center (National Bio-Resource Center, Chiba, Japan). The pET21a(+) plasmid was used to construct the FlhD and FlhC co-expression plasmids. Cells were grown in an LB medium at 37 °C with constant shaking at 150 rpm. When necessary, 20 μg mL⁻¹ of kanamycin or 50 μg mL⁻¹ of ampicillin were added to the medium. Cell growth was monitored by measuring the turbidity at 600 nm.

4.2. Purifying the FlhDC Protein

A pFlhDC plasmid for expressing and purifying FlhDC was constructed according to the standard procedure, with slight modifications [19]. Briefly, FlhDC-coding sequences were amplified via PCR with a pair of primers (GTGGGACATATGCATCATCATCATCATCATCATACCTCCGAGTTGCTGAA and TACCGCTGCGCGGCCGCTCAGTGGTGGTGGTGGTGGTGAACAGCCTGTACTCTCTGTT) using E. coli K-12 W3110 genomic DNA as a template. They were inserted into the pET21a (+) vector (Novagen, Vadodara, India) between the NdeI and NotI sites, with the addition of a His x6 tag to the C-terminus of flhC, leading to the construction of the pFlhDC. The pFlhDC expression plasmid was transformed into E. coli BL21 (DE3) cells. Transformants were grown in an LB medium, and FlhD and FlhC were co-expressed by adding IPTG during the exponential phase. The FlhDC protein complex was purified by affinity purification using a NTA agarose column. The affinity-purified FlhDC protein complex was frozen in the storage buffer at −80 °C until use. Protein purity was greater than 90%, as determined by SDS-PAGE.

4.3. gSELEX Screening of FlhDC-Binding Sequences

gSELEX screening was performed as previously described [19,20]. Briefly, a mixture of DNA fragments from the E. coli K-12 W3110 genome was prepared by sonicating purified genomic DNA and cloned into a multi-copy plasmid, pBR322. For each gSELEX screening, the DNA mixture was regenerated by PCR. For gSELEX screening, 5 pmol of the DNA fragment mixture and 200 pmol FlhDC were mixed in a binding buffer (10 mM Tris-HCl, pH 7.8 at 4 °C, 3 mM magnesium acetate, 150 mM NaCl, and 1.25 mg/mL bovine serum albumin). The SELEX cycle was repeated six times to enrich the FlhDC-binding sequences. SELEX fragments were mapped along the E. coli genome using a gSELEX-chip system with a 43,450-feature DNA microarray [30]. The gSELEX sample obtained using FlhDC and the original genomic DNA library were labeled with Cy3 and Cy5, respectively. Following sample hybridization to the DNA tilling array (Agilent Technologies, Santa Clara, CA, USA), the Cy3/Cy5 ratio was measured, and the peaks of the scanned patterns were plotted against the positions of the DNA probes along the E. coli K-12 genome.

4.4. Gel Shift Assay

A gel shift assay was performed according to the standard procedure [36]. Probes for FlhDC-binding target sequences were generated via PCR amplification using a pair of primers (Table S1a) and Ex Taq DNA polymerase (TaKaRa). A mixture of each probe and FlhDC was incubated at 37 °C for 30 min in a gel shift buffer. After adding the DNA-loading solution, the mixture was subjected to PAGE. The gel was stained with GelRed (Biotium, Fremont, CA, USA) and detected using a LuminoGraph I (Atto, Amherst, MA, USA).

4.5. Consensus Sequence Analysis

An FlhDC-binding sequence set identified by the gSELEX-chip was analyzed using the MEME program [25] to analyze the FlhDC-binding sequence. Sequences were aligned, and a consensus sequence logo was created using WEBLOGO (http://weblogo.berkeley.edu/logo.cgi (accessed on 1 December 2022)).

4.6. Northern Blotting Analysis

Total RNA was extracted from the exponential phase of E. coli cells (OD₆₀₀ = 0.4) in an M9 minimal medium supplemented with 0.2% glucose using an ISOGEN solution (Nippon Gene, Tokyo, Japan). RNA purity was verified by electrophoresis on a 1.5% agarose gel with formaldehyde, followed by staining with GelRed. Northern blotting analysis was performed as previously described [37]. DIG-labeled probes were prepared by PCR amplification using W3110 genomic DNA (50 ng) as a template with a pair of primers (Table S1b), DIG-11-dUTP (Roche, Basel, Switzerland), dNTP, gene-specific forward and reverse primers, and Ex Taq DNA polymerase. Total RNA (3 μg) was incubated in a formaldehyde-MOPS gel-loading buffer for 10 min at 65 °C for denaturation, subjected to electrophoresis on a formaldehyde-supplemented 1.5% agarose gel, and transferred onto a nylon membrane (Roche). Hybridization was performed using a DIG easy Hyb system (Roche) at 50 °C overnight with a DIG-labeled probe. The membrane was treated with anti-DIG-AP Fab fragments and CDP-Star (Roche) to detect the DIG-labeled probe, and the image was scanned using LuminoGraph I (Atto).

4.7. Measuring Glucose and Fructose Concentrations in the Culture Medium

E. coli cells were grown in an M9 minimal medium supplemented with 0.2% glucose or 0.2% fructose. A 0.5 mL aliquot of the bacterial culture was collected in a 1.5 mL tube and centrifuged at 20,400× g for 2 min. The supernatant was transferred to a new 1.5 mL tube for glucose and fructose measurements. The concentrations of glucose and fructose in the samples were measured using the ENZYTEC Liquid for D-Glucose/D-Fructose assay (R-Biopharm, Darmstadt, Germany).