Theanine, a Tea-Leaf-Specific Amino Acid, Alleviates Stress through Modulation of Npas4 Expression in Group-Housed Older Mice
Abstract
:1. Introduction
2. Results
2.1. Body, Adrenal Glands, Thymus, and Cerebrum Weights
2.2. Stress-Related Gene Expression in the Hippocampus and Cerebral Cortex
2.3. Gene Expression Changes in the Hippocampus of Group-Housed Mice at Two Months of Age
2.4. The Effect of Age on Npas4 Gene Expression in the Hippocampus and Cerebral Cortex
2.5. The Effect of Age on IEG Expression in the Hippocampus
2.6. Expression of Glucocorticoid Receptor and DNA Methyltransferase, which Downregulate Npas4
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Experimental Design
4.3. Measurement of DNA Microarray and Principal Component Analysis
4.4. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR)
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Saito, E.; Inoue, M.; Sawada, N.; Shimazu, T.; Yamaji, T.; Iwasaki, M.; Sasazuki, S.; Noda, M.; Iso, H.; Tsugane, S. JPHC Study Group. Association of green tea consumption with mortality due to all causes and major causes of death in a Japanese population: The Japan Public Health Center-based Prospective Study (JPHC Study). Ann. Epidemiol. 2015, 25, 512–518.e3. [Google Scholar] [CrossRef] [PubMed]
- Terashima, T.; Takido, J.; Yokogoshi, H. Time-dependent changes of amino acids in the serum, liver, brain and urine of rats administered with theanine. Biosci. Biotechnol. Biochem. 1999, 63, 615–618. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, K.; Nagato, Y.; Aoi, N.; Juneja, L.R.; Kim, M.; Yamamoto, T.; Sugimoto, S. Effects of L-theanine on the release of α-brain waves in human volunteers. Nippon. Nogeikagaku Kaishi 1998, 72, 153–157. [Google Scholar] [CrossRef] [Green Version]
- Kimura, K.; Ozeki, M.; Juneja, L.R.; Ohira, H. L-Theanine reduces psychological and physiological stress responses. Biol. Psychol. 2007, 74, 39–45. [Google Scholar] [CrossRef] [PubMed]
- Unno, K.; Tanida, N.; Ishii, N.; Yamamoto, H.; Iguchi, K.; Hoshino, M.; Takeda, A.; Ozawa, H.; Ohkubo, T.; Juneja, L.R.; et al. Anti-stress effect of theanine on students during pharmacy practice: Positive correlation among salivary α-amylase activity, trait anxiety and subjective stress. Pharmacol. Biochem. Behav. 2013, 111, 128–135. [Google Scholar] [CrossRef] [PubMed]
- Hidese, S.; Ogawa, S.; Ota, M.; Ishida, I.; Yasukawa, Z.; Ozeki, M.; Kunugi, H. Effects of L-Theanine Administration on Stress-Related Symptoms and Cognitive Functions in Healthy Adults: A Randomized Controlled Trial. Nutrients 2019, 11, 2362. [Google Scholar] [CrossRef] [Green Version]
- Unno, K.; Fujitani, K.; Takamori, N.; Takabayashi, F.; Maeda, K.; Miyazaki, H.; Tanida, N.; Iguchi, K.; Shimoi, K.; Hoshino, M. Theanine intake improves the shortened lifespan, cognitive dysfunction and behavioural depression that are induced by chronic psychosocial stress in mice. Free. Radic. Res. 2011, 45, 966–974. [Google Scholar] [CrossRef] [PubMed]
- Unno, K.; Iguchi, K.; Tanida, N.; Fujitani, K.; Takamori, N.; Yamamoto, H.; Ishii, N.; Nagano, H.; Nagashima, T.; Hara, A.; et al. Ingestion of theanine, an amino acid in tea, suppresses psychosocial stress in mice. Exp. Physiol. 2013, 98, 290–303. [Google Scholar] [CrossRef] [PubMed]
- Williams, J.L.; Everett, J.M.; D’Cunha, N.M.; Sergi, D.; Georgousopoulou, E.N.; Keegan, R.J.; McKune, A.J.; Mellor, D.D.; Anstice, N.; Naumovski, N. The Effects of Green Tea Amino Acid L-Theanine Consumption on the Ability to Manage Stress and Anxiety Levels: A Systematic Review. Plant Foods Hum. Nutr. 2020, 75, 12–23. [Google Scholar] [CrossRef]
- Kakuda, T. Neuroprotective effects of theanine and its preventive effects on cognitive dysfunction. Pharmacol. Res. 2011, 64, 162–168. [Google Scholar] [CrossRef]
- Leschik, J.; Lutz, B.; Gentile, A. Stress-Related Dysfunction of Adult Hippocampal Neurogenesis-An Attempt for Understanding Resilience? Int. J. Mol. Sci. 2021, 22, 7339. [Google Scholar] [CrossRef]
- Yoneda, Y.; Kuramoto, N.; Kawada, K. The role of glutamine in neurogenesis promoted by the green tea amino acid theanine in neural progenitor cells for brain health. Neurochem. Int. 2019, 129, 104505. [Google Scholar] [CrossRef]
- Spiegel, I.; Mardinly, A.R.; Gabel, H.W.; Bazinet, J.E.; Couch, C.H.; Tzeng, C.P.; Harmin, D.A.; Greenberg, M.E. Npas4 regulates excitatory-inhibitory balance within neural circuits through cell-type-specific gene programs. Cell 2014, 157, 1216–1229. [Google Scholar] [CrossRef] [Green Version]
- Fu, J.; Guo, O.; Zhen, Z.; Zhen, J. Essential Functions of the Transcription Factor Npas4 in Neural Circuit Development, Plasticity, and Diseases. Front. Neurosci. 2020, 14, 603373. [Google Scholar] [CrossRef]
- Drouet, J.B.; Peinnequin, A.; Faure, P.; Denis, J.; Fidier, N.; Maury, R.; Buguet, A.; Cespuglio, R.; Canini, F. Stress-induced hippocampus Npas4 mRNA expression relates to specific psychophysiological patterns of stress response. Brain Res. 2018, 1679, 75–83. [Google Scholar] [CrossRef] [PubMed]
- Unno, K.; Hara, A.; Nakagawa, A.; Iguchi, K.; Ohshio, M.; Morita, A.; Nakamura, Y. Anti-stress effects of drinking green tea with lowered caffeine and enriched theanine, epigallocatechin and arginine on psychosocial stress induced adrenal hypertrophy in mice. Phytomedicine 2016, 23, 1365–1374. [Google Scholar] [CrossRef] [PubMed]
- Unno, K.; Sumiyoshi, A.; Konishi, T.; Hayashi, M.; Taguchi, K.; Muguruma, Y.; Inoue, K.; Iguchi, K.; Nonaka, H.; Kawashima, R.; et al. Theanine, the Main Amino Acid in Tea, Prevents Stress-Induced Brain Atrophy by Modifying Early Stress Responses. Nutrients 2020, 12, 174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Unno, K.; Muguruma, Y.; Inoue, K.; Konishi, T.; Taguchi, K.; Hasegawa-Ishii, S.; Shimada, A.; Nakamura, Y. Theanine, Antistress Amino Acid in Tea Leaves, Causes Hippocampal Metabolic Changes and Antidepressant Effects in Stress-Loaded Mice. Int. J. Mol. Sci. 2020, 22, 193. [Google Scholar] [CrossRef]
- Zullo, J.M.; Drake, D.; Aron, L.; O’Hern, P.; Dhamne, S.C.; Davidsohn, N.; Mao, C.A.; Klein, W.H.; Rotenberg, A.; Bennett, D.A.; et al. Regulation of lifespan by neural excitation and REST. Nature 2019, 574, 359–364. [Google Scholar] [CrossRef]
- Barrientos, R.M.; Kitt, M.M.; Watkins, L.R.; Maier, S.F. Neuroinflammation in the normal aging hippocampus. Neuroscience 2015, 309, 84–99. [Google Scholar] [CrossRef] [Green Version]
- Jaszczyk, A.; Stankiewicz, A.M.; Juszczak, G.R. Dissection of Mouse Hippocampus with Its Dorsal, Intermediate and Ventral Subdivisions Combined with Molecular Validation. Brain Sci. 2022, 12, 799. [Google Scholar] [CrossRef] [PubMed]
- Larimore, J.; Zlatic, S.A.; Arnold, M.; Singleton, K.S.; Cross, R.; Rudolph, H.; Bruegge, M.V.; Sweetman, A.; Garza, C.; Whisnant, E.; et al. Dysbindin Deficiency Modifies the Expression of GABA Neuron and Ion Permeation Transcripts in the Developing Hippocampus. Front. Genet. 2017, 8, 28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moench, K.M.; Breach, M.R.; Wellman, C.L. Chronic stress produces enduring sex- and region-specific alterations in novel stress-induced c-Fos expression. Neurobiol. Stress 2019, 10, 100147. [Google Scholar] [CrossRef] [PubMed]
- Duric, V.; Banasr, M.; Licznerski, P.; Schmidt, H.D.; Stockmeier, C.A.; Simen, A.A.; Newton, S.S.; Duman, R.S. A negative regulator of MAP kinase causes depressive behavior. Nat. Med. 2010, 16, 1328–1332. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Helbling, J.C.; Minni, A.M.; Pallet, V.; Moisan, M.P. Stress and glucocorticoid regulation of NR4A genes in mice. J. Neurosci. Res. 2014, 92, 825–834. [Google Scholar] [CrossRef]
- Stankiewicz, A.M.; Goscik, J.; Swiergiel, A.H.; Majewska, A.; Wieczorek, M.; Juszczak, G.R.; Lisowski, P. Social stress increases expression of hemoglobin genes in mouse prefrontal cortex. BMC Neurosci. 2014, 15, 130. [Google Scholar] [CrossRef] [Green Version]
- Zhou, H.; Tan, H.; Letourneau, L.; Wang, J.F. Increased thioredoxin-interacting protein in brain of mice exposed to chronic stress. Prog. Neuropsychopharmacol. Biol. Psychiatry 2019, 88, 320–326. [Google Scholar] [CrossRef]
- Furukawa-Hibi, Y.; Yun, J.; Nagai, T.; Yamada, K. Transcriptional suppression of the neuronal PAS domain 4 (Npas4) gene by stress via the binding of agonist-bound glucocorticoid receptor to its promoter. J. Neurochem. 2012, 123, 866–875. [Google Scholar] [CrossRef]
- Furukawa-Hibi, Y.; Nagai, T.; Yun, J.; Yamada, K. Stress increases DNA methylation of the neuronal PAS domain 4 (Npas4) gene. Neuroreport 2015, 26, 827–832. [Google Scholar] [CrossRef]
- Xu, C.; Zhang, M.; Zu, L.; Zhang, P.; Sun, L.; Liu, X.; Fang, M. Repressor element-1 silencing transcription factor regulates glutamate receptors and immediate early genes to affect synaptic plasticity. Aging 2021, 13, 15569–15579. [Google Scholar] [CrossRef]
- Bersten, D.C.; Wright, J.A.; McCarthy, P.J.; Whitelaw, M.L. Regulation of the neuronal transcription factor NPAS4 by REST and microRNAs. Biochim. Biophys. Acta. 2014, 1839, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Song, A.Q.; Gao, B.; Fan, J.J.; Zhu, Y.J.; Zhou, J.; Wang, Y.L.; Xu, L.Z.; Wu, W.N. NLRP1 inflammasome contributes to chronic stress-induced depressive-like behaviors in mice. J. Neuroinflammation 2020, 17, 178. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.D.; Barnard, D.F.; Kulp, A.C.; Mehta, D.M. Neuroendocrine Regulation of Brain Cytokines After Psychological Stress. J. Endocr. Soc. 2019, 3, 1302–1320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.M.; Zhang, G.F.; Jia, M.; Xie, Z.M.; Yang, J.J.; Shen, J.C.; Zhou, Z.Q. Environmental enrichment improves pain sensitivity, depression-like phenotype, and memory deficit in mice with neuropathic pain: Role of NPAS4. Psychopharmacology 2019, 236, 1999–2014. [Google Scholar] [CrossRef]
- Konishi, T. Principal component analysis for designed experiments. BMC Bioinform. 2015, 16, S7. [Google Scholar] [CrossRef] [Green Version]
- Konishi, T. Three-parameter lognormal distribution ubiquitously found in cDNA microarray data and its application to parametric data treatment. BMC Bioinform. 2004, 5, 5, Erratum in BMC Bioinform. 2004, 5, 82. [Google Scholar] [CrossRef] [Green Version]
- Konishi, T. Microarray test results should not be compensated for multiplicity of gene contents. BMC Syst. Biol. 2011, 5, S6. [Google Scholar] [CrossRef] [Green Version]
- Konishi, T. Data distribution of short oligonucleotide expression arrays and its application to the construction of a generalized intellectual framework. Stat. Appl. Genet. Mol. Biol. 2008, 7, 25. [Google Scholar] [CrossRef]
- Zhang, J.; Chen, S.R.; Chen, H.; Pan, H.L. RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons. J. Biol. Chem. 2018, 293, 19078–19091. [Google Scholar]
- Takano, S.; Uchida, K.; Miyagi, M.; Inoue, G.; Aikawa, J.; Iwabuchi, K.; Takaso, M. Adrenomedullin Regulates IL-1 Gene Expression in F4/80+ Macrophages during Synovial Inflammation. J. Immunol. Res. 2017, 2017, 9832430. [Google Scholar] [CrossRef] [Green Version]
- Dong-Newsom, P.; Powell, N.D.; Bailey, M.T.; Padgett, D.A.; Sheridan, J.F. Repeated social stress enhances the innate immune response to a primary HSV-1 infection in the cornea and trigeminal ganglia of Balb/c mice. Brain Behav. Immun. 2010, 24, 273–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ibi, D.; Takuma, K.; Koike, H.; Mizoguchi, H.; Tsuritani, K.; Kuwahara, Y.; Kamei, H.; Nagai, T.; Yoneda, Y.; Nabeshima, T.; et al. Social isolation rearing-induced impairment of the hippocampal neurogenesis is associated with deficits in spatial memory and emotion-related behaviors in juvenile mice. J. Neurochem. 2008, 105, 921–932. [Google Scholar] [CrossRef]
- Simjee, S.U.; Shaheen, F.; Choudhary, M.I.; Rahman, A.U.; Jamall, S.; Shah, S.U.; Khan, N.; Kabir, N.; Ashraf, N. Suppression of c-Fos protein and mRNA expression in pentylenetetrazole-induced kindled mouse brain by isoxylitones. J. Mol. Neurosci. 2012, 47, 559–570. [Google Scholar] [CrossRef] [PubMed]
- Shandilya, M.C.V.; Gautam, A. The temporal effect of hippocampal Arc in the working memory paradigm during noveltyexploration. Brain Res. Bull. 2020, 158, 51–58. [Google Scholar] [CrossRef]
- Zheng, Y.; Zha, Y.; Driessens, G.; Locke, F.; Gajewski, T.F. Transcriptional regulator early growth response gene 2 (Egr2) is required for T cell anergy in vitro and in vivo. J. Exp. Med. 2012, 209, 2157–2163. [Google Scholar] [CrossRef] [PubMed]
- Kong, Q.; Yu, M.; Zhang, M.; Wei, C.; Gu, H.; Yu, S.; Sun, W.; Li, N.; Zhou, Y. Conditional Dnmt3b deletion in hippocampal dCA1 impairs recognition memory. Mol. Brain 2020, 13, 42. [Google Scholar] [CrossRef] [Green Version]
Expression | Function | Genes | Contents |
---|---|---|---|
Downregulated | Biological process | 1623 | 37,720 |
Regulation of transcription, DNA-templated | 1609 | 18,613 | |
Positive regulation of transcription from RNA polymerase II promoter | 650 | 9631 | |
Transcription, DNA-templated | 587 | 12,890 | |
Signal transduction | 473 | 12,057 | |
Transport | 465 | 12,634 | |
Positive regulation of transcription, DNA-templated | 387 | 6212 | |
Cell adhesion | 384 | 3802 | |
Metabolic process | 377 | 10,709 | |
Multicellular organismal development | 344 | 6594 | |
Upregulated | Regulation of transcription, DNA-templated | 647 | 18,613 |
Transcription, DNA-templated | 527 | 12,890 | |
Positive regulation of transcription from RNA polymerase II promoter | 503 | 9631 | |
Translation | 465 | 2523 | |
Transport | 352 | 12,634 | |
Metabolic process | 335 | 10,709 | |
Negative regulation of transcription from RNA polymerase II promoter | 234 | 6790 | |
Protein phosphorylation | 232 | 8086 | |
Multicellular organismal development | 229 | 6594 | |
Phosphorylation | 219 | 5556 |
Expression | Symbol | Full Name |
---|---|---|
Downregulated | Ttr | transthyretin |
Kcnj13 | potassium inwardly rectifying channel, subfamily J, member 13 | |
Npas4 | neuronal PAS domain protein 4 | |
Fos | FBJ osteosarcoma oncogene | |
Arc | activity regulated cytoskeletal-associated protein | |
Egr2 | early growth response 2 | |
Dusp1 | dual specificity phosphatase 1 | |
Nr4a1 | nuclear receptor subfamily 4, group A, member 1 | |
Gh | growth hormone | |
Olfr382 | olfactory receptor 382 | |
Upregulated | Mela | melanoma antigen |
Zfp125 | zinc finger protein 125 | |
Hbb-b2 | hemoglobin, beta adult minor chain | |
C1qc | complement component 1, q subcomponent, C chain | |
Ly6a | lymphocyte antigen 6 complex, locus A | |
Hba-a2 | hemoglobin alpha, adult chain 2 | |
Tpm3-rs7 | tropomyosin 3, related sequence 7 | |
Gm8615 | glucosamine-6-phosphate deaminase 1 pseudogene | |
Txnip | thioredoxin interacting protein | |
Edv | endogenous sequence related to the Duplan murine retrovirus |
Housing Condition | 1 M (2 Months Old) | 6 M (7 Months Old) |
---|---|---|
Group | Control (water) | Control (water) |
Theanine | Theanine | |
Alone | Control (water) | Control (water) |
Theanine | Theanine | |
Two | Control (water) | Control (water) |
Theanine | Theanine |
Gene | Forward Sequence (5′to3) | Reverse Sequence (5′to3) | Ref. |
---|---|---|---|
β-actin | TGACAGGATGCAGAAGGAGA | GCTGGAAGGTGGACAGTGAG | |
REST | ATCGGACGCGGGTAGCGAG | GGCTGCCAGTTCAGCTTTCG | [39] |
IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT | [40] |
TNFα | CTGTCTACTGAACTTCGGGGTGAT | GGTCTGGGCCATAGAACTGATG | [41] |
Npas4 | AGCATTCCAGGCTCATCTGAA | GGCGAAGTAAGTCTTGGTAGGATT | [42] |
Fos | AAGTAGTGCAGCCCGGAGTA | CCAGTCAAGAGCATCAGCAA | [43] |
Arc | ACGATCTGGCTTCCTCATTCTGCT | AGGTTCCCTCAGCATCTCTGCTTT | [44] |
Egr2 | CTACCCGGTGGAAGACCTC | AATGTTGATCATGCCATCTCC | [45] |
Nr4a1 | CTGCCTTCCTGGAACTCTTCA | CGGGTTTAGATCGGTATGCC | [25] |
holo-GR | GATGGGGAATGACTTGGGCT | TTGGGATTCTCTGGACGGCT | [29] |
Dnmt3a | CTGGTGATTGGAGGCAGTCCATGCA | TAGCTGAGGCTGTCTGCATCGGACA | [46] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Unno, K.; Taguchi, K.; Konishi, T.; Ozeki, M.; Nakamura, Y. Theanine, a Tea-Leaf-Specific Amino Acid, Alleviates Stress through Modulation of Npas4 Expression in Group-Housed Older Mice. Int. J. Mol. Sci. 2023, 24, 3983. https://doi.org/10.3390/ijms24043983
Unno K, Taguchi K, Konishi T, Ozeki M, Nakamura Y. Theanine, a Tea-Leaf-Specific Amino Acid, Alleviates Stress through Modulation of Npas4 Expression in Group-Housed Older Mice. International Journal of Molecular Sciences. 2023; 24(4):3983. https://doi.org/10.3390/ijms24043983
Chicago/Turabian StyleUnno, Keiko, Kyoko Taguchi, Tomokazu Konishi, Makoto Ozeki, and Yoriyuki Nakamura. 2023. "Theanine, a Tea-Leaf-Specific Amino Acid, Alleviates Stress through Modulation of Npas4 Expression in Group-Housed Older Mice" International Journal of Molecular Sciences 24, no. 4: 3983. https://doi.org/10.3390/ijms24043983