Soybean GmSAUL1, a Bona Fide U-Box E3 Ligase, Negatively Regulates Immunity Likely through Repressing the Activation of GmMPK3

Abstract

E3 ubiquitin ligases play important roles in plant immunity, but their role in soybean has not been investigated previously. Here, we used Bean pod mottle virus (BPMV)-mediated virus-induced gene silencing (VIGS) to investigate the function of GmSAUL1 (Senescence-Associated E3 Ubiquitin Ligase 1) homologs in soybean. When two closely related SAUL1 homologs were silenced simultaneously, the soybean plants displayed autoimmune phenotypes, which were significantly alleviated by high temperature, suggesting that GmSAUL1a/1b might be guarded by an R protein. Interestingly, silencing GmSAUL1a/1b resulted in the decreased activation of GmMPK6, but increased activation of GmMPK3 in response to flg22, suggesting that the activation of GmMPK3 is most likely responsible for the activated immunity observed in the GmSAUL1a/1b-silenced plants. Furthermore, we provided evidence that GmSAUL1a is a bona fide E3 ligase. Collectively, our results indicated that GmSAUL1 plays a negative role in regulating cell death and immunity in soybean.

1. Introduction

Plants ward off numerous pathogens through multi-layer defenses, including nonhost resistance, pathogen-associated molecular patterns (PAMP)-triggered immunity (PTI) or basal resistance, and effector-triggered immunity (ETI) [1,2]. The detection of PAMPs by plasma-membrane-localized pattern recognition receptors (PPRs) activates PTI [3,4], whereas the specific recognition of pathogen-delivered effectors by R proteins or NLRs (nucleotide-binding leucine-rich repeat proteins) leads to ETI [2]. Although divergent signaling exists between PTI and ETI [5], they activate a similar set of overlapping responses including the induction of pathogenesis-related (PR) genes, the activation of mitogen-activated protein kinases (MAPKs) and calcium-dependent protein kinases, and the hypersensitive response (HR) cell death [6,7]. However, the activation of ETI is higher in magnitude and lasts longer than PTI [2].

Ubiquitination is a common post-translational modification in eukaryotes for the regulation of the stability of protein substrates [8,9]. Ubiquitin and ubiquitin-like modifiers have evolved significantly to fulfill diverse functions in plants. Poly-ubiquitinated protein substrates linked via the Lys⁴⁸ residue of ubiquitin is marked and subsequently targeted for degradation by the 26S proteasome, whereas Lys⁶³-linked ubiquitination usually plays non-proteolytic regulatory roles. The ubiquitination reaction consists of three steps catalyzed sequentially by a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), and a ubiquitin ligase (E3) [8,10]. Among these three enzymes, E3 ligases are the key enzymes that determine substrate specificity [11]. The Arabidopsis genome consists over 1400 genes that encode E3 ligase-related proteins [12], implying their diverse functions in numerous biological processes. E3 ligases are classified into different families: HECT, SCF, RING-finger, U-box, and APC [13,14]. Among these E3-ligase families, F-box proteins are involved in the regulation of hormone signaling [15], whereas U-box E3 ligases have been reported playing critical roles in plant immunity [13,14]. Rice SPL11 encodes a protein with a central U-box domain and carboxyl-terminal armadillo (ARM) repeat domain and the spl11 mutant displays an autoimmune response with enhanced disease resistance [16]. The Arabidopsis U-box (PUB) proteins PUB12 and PUB13 negatively regulate PTI responses through targeting the flagellin receptor FLS2 (Flagellin-Sensitive 2) for degradation [17]. A triplet of U-box protein paralogs, PUB22, PUB23, and PUB24, are involved in PTI through redundantly targeting the exocyst complex component EXO70B2 for degradation [18].

Arabidopsis senescence-associated E3 ubiquitin ligase 1 (SAUL1) was initially identified as a U-box E3 ubiquitin ligase required for the suppression of premature senescence [19]. Recently, it has been shown that a loss-of-function mutation in SAUL1 results in enhanced disease resistance against multiple biotrophic pathogens [20,21,22,23,24]. This autoimmunity is totally dependent on Enhanced Disease Susceptibility 1 (EDS1), Phytoalexin Deficient 4 (PAD4), and Suppressor of the G2 Allele of SKP1b (SGT1B) [20,21,22]. From saul1-1 suppressor screening, the TIR-type NLR (TNL) protein SUSA1 (Suppressor of saul1-1), previously referred to as SOC3 (Suppressor of chs1-2, 3) [25], was identified as a guard for SAUL1 [23]. Interestingly, the autoimmunity triggered by the overexpression of SAUL1 also depends on SOC3 [23]. These results indicate that the homeostasis of SAUL1 is monitored by SOC3. A level of SAUL1 exceeding a certain threshold range will lead to the activation of immunity. Liang et al. recently uncovered SOC3 pairs with different truncated TIR-NB (TN) proteins to monitor either the absence or overexpression of SAUL1, respectively [24].

Mitogen-activated protein kinase (MAPK) cascades are major components downstream of PTI and ETI to transduce defense signals [26,27,28]. Increasing evidence indicates that MPK3 and MPK6 play positive roles in immunity [26,28,29,30,31,32,33], whereas MPK4 plays both positive and negative roles in regulating plant immunity [34,35,36,37,38]. Using virus-induced gene silencing (VIGS) mediated by Bean pod mottle virus (BPMV), we demonstrated that, while soybean GmMPK4 plays a negative role, GmMPK6 plays both positive and negative roles in defense responses [39,40].

The BPMV-VIGS system is one of the most successful tools in functional genomics studies in paleoploidy soybean [41,42], in which most of the genes in its genome have two copies [43]. In this study, we sought to identify the E3 ligases with critical roles in soybean immunity by reverse genetic screening using the BPMV-VIGS system. We found that when two closely related SAUL1 homologs, GmSAUL1a and GmSAUL1b, were silenced simultaneously, the soybean plants exhibited autoimmune phenotypes with enhanced resistance to different biotrophic viral and bacterial pathogens, indicating that the GmSAUL1a/1b plays a negative role in immune responses in soybean. Treatment of the GmSAUL1a/1b-silenced plants at 30 °C significantly alleviated the auto-immune phenotypes, suggesting that GmSAUL1a/1b might be guarded by an R protein. Interestingly, we found that silencing the GmSAUL1a/1b in soybean resulted in the differential activation or repression of downstream MPK3 and MPK6. Collectively, our results indicated that GmSAUL1a/1b plays a negative role in regulating cell death and immunity.

2. Results

2.1. Silencing GmSAUL1 Results in a Constitutively Activated Immune Responses in Soybean

To identify the genes involved in immunity in soybean, we performed reverse genetic screening using the BPMV-VIGS system. When two U-box genes were silenced simultaneously, the soybean plants exhibited an auto-immune phenotype, including stunted stature (Figure 1A), cell death on the leaves (compare Figure 1B with Figure 1C and Figure 1D with Figure 1E), induced expression of PR1 (Figure 1F, middle gel), and the over-accumulation of both H₂O₂ (compare Figure 2A with Figure 2B) and salicylic acid (SA) (Figure 2C,D). The high levels of H₂O₂ and SA could be the primary reasons for the auto-immune phenotype observed on the silenced plants. Blast searching using the 360 bp fragment inserted in the BPMV-2 vector against the soybean genome (Phytozome 12) revealed that there are two paralogous genes in the soybean genome that share the highest homology (~80%) with the Arabidopsis SAUL1 (senescence-associated E3 ubiquitin ligase, also known as PUB44/At1G20780). Therefore, we referred to these two genes as GmSAUL1a (Glyma.04G016500) and GmSAUL1b (Glyma.06G016500), respectively. GmSAUL1a and GmSAUL1b share 98.6% identity at the nucleotide level. As the VIGS approach can simultaneously silence genes sharing 85% identity at the nucleotide level [39,44,45,46,47], we believe that the auto-immune phenotype was a result of silencing both GmSAUL1a and GmSAUL1b (Figure 1F, upper gel). These results proved again that VIGS is a robust tool in gene function studies in paleotetraploidy soybean plants [41,42].

2.2. Silencing GmSAUL1a/1b Leads to Enhanced Resistance to Biotrophic Bacterial and Viral Pathogens

The auto-immune phenotype is usually associated with enhanced resistance. To examine whether the GmSAUL1a/1b-silenced plants exhibit enhanced resistance to biotrophic pathogens, we performed disease resistance assays on both the vector control plants (BPMV-0) and the GmSAUL1a/1b-silenced plants. Firstly, we inoculated three individual leaves detached from both the BPMV-0 plants and GmSAUL1a/1b-silenced plants, respectively, with a SMV (soybean mosaic virus) strain tagged with the GUS (β-glucuronidase) protein (SMV-N-GUS) [48] via biolistic bombardment. At 5 days post inoculation (dpi), the SMV-N-GUS infection was visualized by GUS staining. As shown in Figure 3A,B, the GUS foci on the GmSAUL1a/1b-silenced plants were much smaller than on the BPMV-0 plants, indicating that GmSAUL1a/1b plays a negative role in SMV resistance.

To examine the effects of GmSAUL1 silencing on the resistance of soybean against bacterial pathogens, the Pseudomonas syringae pv. glycinea (Psg) R4 strain was inoculated by directly spraying bacterial solutions on the leaves of both the BPMV-0 and the GmSAUL1a/1b-silenced plants, respectively. As shown in Figure 3C, the multiplication of Psg was significantly higher on the BPMV-0 leaves than on the leaves of the GmSAUL1a/1b-silenced plants. Together, these results indicated that silencing GmSAUL1a/1b enhances the resistance of soybean plants to both viral and bacterial pathogens.

2.3. Autoimmune Phenotype of GmSAUL1a/1b-Silenced Plants Is Significantly Suppressed by Higher Temperature Treatment

Autoimmunity resulting from R gene activation is usually suppressed at high temperatures [49,50,51]. To further examine whether the autoimmunity of the GmSAUL1a/1b-silenced plants is a result of NLR activation, the GmSAUL1a/1b-silenced plants were subjected to treatment at 30 °C. As expected, the autoimmune phenotype of the GmSAUL1a/1b-silenced plants was significantly alleviated at a higher temperature (30 °C) (Figure 4). Accordingly, the induction of PR1 expression was also significantly lower at 30 °C than at 24 °C (Figure 4C), confirming that the autoimmunity observed in the GmSAUL1a/1b-silenced plants is likely to be a result of the activation of NLR protein(s).

2.4. Silencing GmSAUL1a/1b Exhibits Opposite Effects on the Activation of GmMPK3 and GmMPK6 in Response to flg22 Treatment

The activated defense responses are usually associated with the downstream MAPK signaling pathway [28]. To examine the effect of the GmSAUL1a/1b silencing on the MAPK signaling activation, the kinase activity assay was performed for the leaf discs collected from both the BPMV-0 and the GmSAUL1a/1b-silenced plants treated with flg22, a 22 amino acid peptide at the N-terminus of the flagellin protein that is recognized by FLS2 [52], for a different period of time using Phospho-p44/42 MAP Erk1/2 antibody raised from human cells that can specifically recognize the phosphorylation of Arabidopsis MPK3/4/6 [53]. As shown in Figure 5, in response to flg22 elicitation, the activation of the GmMPK6 was significantly reduced in the GmSAUL1a/1b-silenced plants relative to the BPMV-0 plants, whereas the activation of the GmMPK3 was significantly elevated in the GmSAUL1a/1b-silenced plants, indicating that GmSAUL1a/1b positively regulates the activation of the GmMPK6, but negatively regulates the activation of GmMPK3.

2.5. GmSAUL1a Is a Bona Fide E3 Ubiquitin Ligase

To examine whether GmSAUL1a has ubiquitin E3 ligase activity, we incubated the E. coli-expressed recombinant protein MBP-GmSAUL1a in the presence of ubiquitin, the E1 ubiquitin-activating enzyme SlUBA2, and the E2 ubiquitin-conjugating enzyme SlUBC12 [14]. As shown in Figure 6, a clear E3 ligase activity was detected for the MBP-GmSAUL1a, indicating that GmSAUL1a is a bona fide E3 ubiquitin ligase.

3. Discussion

3.1. Function of SAUL1 Homologs Is Conserved across Plant Species

In Arabidopsis, the loss function of SAUL1 leads to auto-immune phenotypes [20,21,23]. Here, we showed that silencing GmSAUL1a/1b in soybean resulted in similar autoimmune phenotypes (Figure 1, Figure 2 and Figure 3). The autoimmune phenotypes of the saul1-1 mutant fully depend on PAD4 and EDS1 [20,21], suggesting that the autoimmune phenotypes of the saul1-1 mutant are SA-dependent. Similarly, we found that both the free SA and conjugated SA levels were significantly higher in the GmSAUL1a/1b-silenced plants than in vector control plants (Figure 2C,D), implying that the autoimmunity in GmSAUL1a/1b-silenced plants is also SA-dependent. Consistent with the auto-immune phenotypes, the soybean GmSAUL1a/1b-silenced plants displayed an enhanced resistance to different types of biotrophic pathogens (Figure 3), indicating that the function of SAUL1 homologs is highly conserved between Arabidopsis and soybean.

3.2. Roles of GmSAUL1s in PTI and ETI

Silencing GmSAUL1a/1b in soybean resulted in enhanced resistance to virulent pathogens, which are considered as PTI (Figure 3). If the homeostasis of GmSAUL1 is similarly guarded by NLR immune receptors such as SOC3-TN2 and SOC3-CHS1 pairs in Arabidopsis [23,24], then the activated immunity observed in the GmSAUL1a/1b-silenced soybean plants could actually be a consequence of activated NLRs. Higher temperature treatment significantly reversed the autoimmune phenotype observed in the GmSAUL1a/1b-silenced plants (Figure 4), suggesting that certain NLRs function as guards to monitor the homeostasis of GmSAUL1s in soybean. Because PTI and ETI share common components and mutually potentiate each other to achieve stronger immunity [54,55], it is not surprising that the enhanced PTI observed in the GmSAU1a/1b-silenced soybean plants (Figure 3) could originate from the activated ETI. It is worthwhile to further examine whether the same pairs of SOC3-TN2 and SOC3-CHS1 homologs function to guard GmSAUL1s in soybean.

3.3. Silencing of GmSAUL1a/1b in Soybean Activates Immunity through Activating GmMPK3

Silencing GmSAUL1a/1b leads to the reduced activation of GmMPK6, but the enhanced activation of GmMPK3 in response to flg22 treatment (Figure 5), indicating that GmSAUL1a/1b positively regulates GmMPK6 activation and negatively regulates GmMPK3. The enhanced resistance is usually correlated with the elevated activation of MPK3/MPK6 activity and reduced activation of MPK4, respectively [28,29,30,31,35,36,37,38]. We previously showed that the elevated activation of GmMPK3 was associated with the cell death observed in the GmMPK4-, GmMPK6-, and GmMEKK1-silenced plants [45], which is consistent with the finding that the enhanced activation of MPK3 resulted in cell death [56]. Therefore, it is likely that the cell death that occurred on the leaves of the GmSAUL1a/1b-silenced plants was a result of the enhanced activation of GmMPK3. It has been reported that, in Arabidopsis, the activation MPK6 is elevated in loss-of-function mutants of MPK3 and vice versa [57], suggesting that MPK3 and MPK6 can mutually compensate for each other’s function. If this holds true in soybean, the elevated activation of GmMPK3 might compensate for the reduced activation of GmMPK6 in GmSAUL11a/1b-silenced plants (Figure 5), which is responsible for the enhanced disease resistance observed in the GmSAUL1a/1b-silenced plants (Figure 3). Collectively, our results indicated that silencing GmSAUL1a/1b activates immune responses through activating GmMPK3 (Figure 7). It remains to be determined whether the activated immunity in the GmSAUL1a/1b-silenced plants is a result of the activation of an NLR.

3.4. Conclusions

Using the BPMV-VIGS system in soybean, we demonstrated that GmSAUL1a/1b plays a negative role in in soybean immunity. The fact that the activated immune responses could be rescued by high temperature treatment suggests that the activated immunity observed in the silenced plant is probably guarded by one or more NLR proteins. Unexpectedly, we found that silencing GmSAUL1a/1b resulted in the activation of GmMPK3, but the repression of GmMPK6. Most importantly, we showed that GmSAUL1a is a bona fide U-box E3 ligase. In sum, our results indicated that GmSAUL1a/1b plays a negative role in regulating immunity, likely through repressing the activation of GmMPK3.

4. Materials and Methods

4.1. Plant Materials

Seeds of soybean (Glycine max ‘Williams 82) were provided by Prof. Steven Whitham at Iowa State University and used in this study. Soybean plants were maintained in the growth room or growth chamber at 22 °C with a photoperiod of 16 h light/8 h dark, unless indicated otherwise.

4.2. BPMV-Mediated VIGS

The BPMV-VIGS system and its usage have been described previously [58,59]. The GmSAUL1 orthologs were identified by BLASTn searches (cutoff value < 0.001) in the Phytozome database on 6 October 2019 (www.phytozome.org). A 360 bp fragment of GmSAUL1a was amplified by PCR using the following primers: GmSAUL1a-F (Glyma.04G016500), 5′-aagGGATCCGTTATGCGTGATCCTGTTACTTTAGA-3′, and GmSAUL1a-R: 5′-ttgGGTACCCCTTCAGCATGTCAACAATCATTG-3′. The bold sequences represent BamHI and KpnI restriction sites for the cloning purpose, respectively.

4.3. RNA Isolation and RT-qPCR

RNA isolation and RT-qPCR were performed as described [40]. The RT-qPCR tests were performed using an ABI550 Real-Time PCR machine (Applied Biosystems, Thermo Fisher Scientific, Austin, TX, USA) and the 2x SYBR Green qPCR Mix (Aidlab, Beijing, China). The primers used for verification of the effects of silencing of GmSAUL1a/1b, were:

GmSAUL1a/1b-V-F: ATGATGGCTGCGAGCT;

GmSAUL1a/1b-V-R: CTCATGTGAAAGGAATTTTACTAC.

The additional primers used in this study were:

GmSAUL1a/1b-F: ATGATGGCTGCGAGCT;

GmSAUL1a/1b-R: CTCATGTGAAAGGAATTTTACTAC;

GmELF1b-F: ACCGAAGAGGGCATCAAATCCC;

GmELF1b-R: CTCAACTGTCAAGCGTTCCTC;

GmELF1b-F (RT-qPCR): GTTGAAAAGCCAGGGGACA;

GmELF1b-R (RT-qPCR): TCTTACCCCTTGAGCGTGG;

GmPR1-F (RT-qPCR): ATGGGGTTGTGCAAGGTT;

GmPR1-R (RT-qPCR): CTAGTAGGGTCTTTGGCCAA.

4.4. SMV-N-GUS Inoculation, GUS Staining, and GUS Foci Measurements

The SMV-N-GUS inoculation, GUS staining, and GUS foci measurements followed the previously described protocols [39,48,60].

4.5. Inoculation of Pseudomonas syringae pv. glycinea (Psg)

The Psg inoculation and growth assay was performed as described [46].

4.6. Construction of MBP-GmSAUL1a Fusion Protein and In Vitro Ubiquitination Assay

The full-length cDNA of GmSAUL1a was cloned into pMAL-c2 vector (New England Biolabs, Ipswich, MA, USA). The primers used for the making the construct were:

pMAL-SAUL1 -BamH I-F:

aaaGGATCCATGATGGCTGCGAGCT.

pMAL-MBP-HinD III-R:

tttAAGCTTTCATCCCATGTTTGGAAAGATTC.

The construct was transformed into E. coli strain BL21 Star (DE3) (Invitrogen) and protein expression and purification were performed as described previously [61]. The in vitro ubiquitination assay was carried out as described previously with some modifications [16,17]. Briefly, 3 μg of ubiquitin, 40 ng of E1 (GST- SlUBA2), an optimal amount (50–250 ng) of E2 (6xHis-SlUBC12), and 2 μg of MBP-GmSAUL1 were added to a 30 mL reaction in the presence of ubiquitination assay buffer (50 mM Tris-HCl, pH 7.5, 5 mM ATP, 5 mM MgCl₂, 2 mM DTT, 3 mM creatine phosphate, and 5 μg/mL creatine phosphokinase). The reactions were incubated at 30 °C for 1.5 h and then terminated by SDS sample loading buffer with 100 mM DTT. The samples were heated at 95 °C for 5 min and then separated using 10% SDS-PAGE and analyzed by immunoblotting using mouse monoclonal anti-ubiquitin M2-peroxidase-conjugated (horseradish peroxidase, HRP) antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) to detect the polyubiquitin signal. The MBP and polyubiquitinated form of MBP-GmSAUL1 were detected using murine anti-MBP monoclonal antibody (HRP conjugated) (NEB).

4.7. MAPK Activity Assay

MAPK activity assay was performed as described [45].

4.8. Histochemical Assays

The visualization of cell death on the leaves the soybean plants were stained with trypan blue in lactophenol and ethanol as described [62]. The accumulation of H₂O₂ was stained using the 3,3-diaminobenzidine tetrahydrochloride (DAB) staining procedure (Sigma-Aldrich; [62]).

4.9. SA Quantification

SA was quantified using an Agilent 1260 HPLC system (Agilent Technologies, Santa Clara, CA, USA) with a diode array detector, a fluorescence detector, and a column, as described previously [63].