Role of Berberine Thermosensitive Hydrogel in Periodontitis via PI3K/AKT Pathway In Vitro
Abstract
:1. Introduction
2. Results
2.1. Characterization of Hydrogel
2.2. Cytotoxicity
2.3. Berberine Thermosensitive Hydrogel Mediates Anti-inflammatory Effect via PI3K/AKT Pathway
2.4. Berberine Thermosensitive Hydrogel Mediates Osteogenesis Effect via PI3K/AKT Pathway
3. Discussion
4. Materials and Methods
4.1. Synthesis of Hydrogel
4.2. Characterizations of Hydrogel
4.2.1. Morphological Characteristics
4.2.2. FTIR
4.2.3. Drug Release Rate
4.3. Cytotoxicity Assay
4.4. Anti-Inflammatory Effect
4.4.1. qRT-PCR
4.4.2. Western Blotting
4.5. Osteogenesis
4.5.1. qRT-PCR
4.5.2. ALP Staining
4.5.3. Western Blotting
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kaufman, J.; Kalaitzandonakes, N. The economic potential of plant-made pharmaceuticals in the manufacture of biologic pharmaceuticals. J. Commer. Biotechnol. 2011, 17, 173–182. [Google Scholar] [CrossRef]
- Van Dyke, T.E.; Serhan, C.N. Resolution of inflammation: A new paradigm for the pathogenesis of periodontal diseases. J. Dent. Res. 2003, 82, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Galimanas, V.; Hall, M.W.; Singh, N.; Lynch, M.D.; Goldberg, M.; Tenenbaum, H.; Cvitkovitch, D.G.; Neufeld, J.D.; Senadheera, D.B. Bacterial community composition of chronic periodontitis and novel oral sampling sites for detecting disease indicators. Microbiome 2014, 2, 32. [Google Scholar] [CrossRef]
- Xue, P.; Li, B.; An, Y.; Sun, J.; He, X.; Hou, R.; Dong, G.; Fei, D.; Jin, F.; Wang, Q.; et al. Decreased MORF leads to prolonged endoplasmic reticulum stress in periodontitis-associated chronic inflammation. Cell Death Differ. 2016, 23, 1862–1872. [Google Scholar] [CrossRef] [PubMed]
- Gao, C.; Peng, S.; Feng, P.; Shuai, C. Bone biomaterials and interactions with stem cells. Bone Res. 2017, 5, 253–285. [Google Scholar] [CrossRef]
- Liu, J.; Zhao, X.; Pei, D.; Sun, G.; Li, Y.; Zhu, C.; Qiang, C.; Sun, J.; Shi, J.; Dong, Y.; et al. The promotion function of Berberine for osteogenic differentiation of human periodontal ligament stem cells via ERK-FOS pathway mediated by EGFR. Sci. Rep. 2018, 8, 2848–2910. [Google Scholar] [CrossRef]
- Zhang, R.; Yang, J.; Wu, J.; Xiao, L.; Miao, L.; Qi, X.; Li, Y.; Sun, W. Berberine promotes osteogenic differentiation of mesenchymal stem cells with therapeutic potential in periodontal regeneration. Eur. J. Pharmacol. 2019, 851, 144–150. [Google Scholar] [CrossRef]
- Xia, Z.; Li, Q.; Tang, Z. Network pharmacology, molecular docking, and experimental pharmacology explored Ermiao wan protected against periodontitis via the PI3K/AKT and NF-κB/MAPK signal pathways. J. Ethnopharmacol. 2023, 303, 115900. [Google Scholar] [CrossRef]
- Ren, S.; Cai, Y.; Hu, S.; Liu, J.; Zhao, Y.; Ding, M. Berberine exerts anti-tumor activity in diffuse large B-cell lymphoma by modulating c-myc/CD47 axis. Biochem. Pharmacol. 2021, 188, 114576. [Google Scholar] [CrossRef]
- Chen, X.; Guo, H.; Li, Q.; Zhang, Y.; Liu, H.; Zhang, X. Protective effect of berberine on aconite-induced myocardial injury and the associated mechanisms. Mol. Med. Rep. 2018, 18, 4468–4476. [Google Scholar] [CrossRef]
- Jin, H.; Li, J.; Zhang, M.; Luo, R.; Lu, P.; Zhang, W.; Zhang, J.; Pi, J.; Zheng, W.; Mai, Z.; et al. Berberine-Loaded biomimetic nanoparticles attenuate inflammation of experimental allergic asthma via enhancing IL-12 expression. Front. Pharmacol. 2021, 12, 724525. [Google Scholar] [CrossRef] [PubMed]
- Steinberg, D.; Friedman, M. Sustained-release delivery of antimicrobial drugs for the treatment of periodontal diseases: Fantasy or already reality? Periodontology 2000 2020, 84, 176–187. [Google Scholar] [CrossRef] [PubMed]
- Russo, E.; Villa, C. Poloxamer hydrogels for biomedical applications. Pharmaceutics 2019, 11, 671. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, T.; Sun, M.; Cheng, Z.; Jia, W.; Jiao, K.; Wang, S.; Jiang, K.; Yang, Y.; Dai, Z.; et al. ZIF-8 modified multifunctional injectable photopolymerizable GelMA hydrogel for the treatment of periodontitis. Acta Biomater. 2022, 146, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Rajeshwari, H.R.; Dhamecha, D.; Jagwani, S.; Rao, M.; Jadhav, K.; Shaikh, S.; Puzhankara, L.; Jalalpure, S. Local drug delivery systems in the management of periodontitis: A scientific review. J. Control. Release 2019, 307, 393–409. [Google Scholar]
- Bagher, Z.; Ehterami, A.; Nasrolahi, M.; Azimi, M.; Salehi, M. Hesperidin promotes peripheral nerve regeneration based on tissue engineering strategy using alginate/chitosan hydrogel: In vitro and in vivo study. Int. J. Polym. Mater. Polym. Biomater. 2021, 70, 299–308. [Google Scholar] [CrossRef]
- Garakani, S.S.; Khanmohammadi, M.; Atoufi, Z.; Kamrava, S.K.; Setayeshmehr, M.; Alizadeh, R. Fabrication of chitosan/agarose scaffolds containing extracellular matrix for tissue engineering applications. Int. J. Biol. Macromol. 2020, 143, 533–545. [Google Scholar] [CrossRef]
- Williams, D.F. There is no such thing as a biocompatible material. Biomaterials 2014, 35, 10009–10014. [Google Scholar] [CrossRef]
- Wang, G.; Wang, X.; Huang, L. Feasibility of chitosan-alginate (Chi-Alg) hydrogel used as scaffold for neural tissue engineering: A pilot study in vitro. Biotechnol. Biotechnol. Equip. 2017, 31, 766–773. [Google Scholar] [CrossRef]
- Torelli-Souza, R.R.; Cavalcante Bastos, L.A.; Nunes, H.G.; Camara, C.A.; Amorim, R.V.S. Sustained release of an antitumoral drug from alginate-chitosan hydrogel beads and its potential use as colonic drug delivery. J. Appl. Polym. Sci. 2012, 126 (Suppl. 1), E409–E418. [Google Scholar] [CrossRef]
- Gu, L.; Ke, Y.; Gan, J.; Li, X. Berberine suppresses bone loss and inflammation in ligature-induced periodontitis through promotion of the G protein-coupled estrogen receptor-mediated inactivation of the p38MAPK/NF-κB pathway. Arch. Oral Biol. 2021, 122, 104992. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Huang, X.; He, J.; Song, C.; Peng, L.; Chen, T. Plantamajoside attenuates inflammatory response in LPS-stimulated human gingival fibroblasts by inhibiting PI3K/AKT signaling pathway. Microb. Pathog. 2019, 127, 208–211. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.M.; Chen, P.C.; Li, T.M.; Fong, Y.C.; Tang, C.H. Si-Wu-tang extract stimulates bone formation through PI3K/AKT /NF-κB signaling pathways in osteoblasts. BMC Complement. Altern. Med. 2013, 13, 277. [Google Scholar] [CrossRef] [PubMed]
- Moon, J.B.; Kim, J.H.; Kim, K.; Youn, B.U.; Lee, Y.; Kin, N. AKT induces osteoclast differentiation through regulating the GSK3β/NFATc1 signaling cascade. J. Immunol. 2012, 188, 163–169. [Google Scholar] [CrossRef]
- Braz-Silva, P.H.; Bergamini, M.L.; Mardegan, A.P.; De Rosa, C.S.; Hasseus, B.; Jonasson, P. Inflammatory profile of chronic apical periodontitis: A literature review. Acta Odontol. Scand. 2019, 77, 173–180. [Google Scholar] [CrossRef]
- Ghosh-Choudhury, N.; Abboud, S.L.; Nishimura, R.; Celeste, A.; Mahimainathan, L.; Choudhury, G.G. Requirement of BMP-2-induced phosphatidylinositol 3-kinase and AKT serine/ threonine kinase in osteoblast differentiation and smad-dependent BMP-2gene transcription. J. Biol. Chem. 2002, 277, 33361–33368. [Google Scholar] [CrossRef]
- Zheng, Z.; He, Y.; Long, L.; Gan, S.; Chen, S.; Zhang, M.; Xu, J.; Fu, R.; Liao, Y.; Zhu, Z.; et al. Involvement of PI3K/AKT signaling pathway in promoting osteogenesis on titanium implant surfaces modified with novel non-thermal atmospheric plasma. Front. Bioeng. Biotechnol. 2022, 10, 975840. [Google Scholar] [CrossRef]
- Lin, C.; Shao, Y.; Zeng, C.; Zhao, C.; Fang, H.; Wang, L. Blocking PI3K/AKT signaling inhibits bone sclerosis in subchondral bone and attenuates post-traumatic osteoarthritis. J. Cell. Physiol. 2018, 233, 6135–6147. [Google Scholar] [CrossRef]
- Greenstein, G. Nonsurgical periodontal therapy in 2000: A literature review. J. Am. Dent. Assoc. 2000, 131, 1580–1592. [Google Scholar] [CrossRef]
- Webber, M.J.; Appel, E.A.; Meijer, E.W.; Langer, R. Supramolecular biomaterials. Nat. Mater. 2016, 15, 13–26. [Google Scholar] [CrossRef]
- Shi, Z.; Gao, X.; Ullah, M.W.; Li, S.; Wang, Q.; Yang, G. Electroconductive natural polymer-based hydrogels. Biomaterials 2016, 111, 40–54. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.S.; Kim, G. Three-dimensional electrospun polycaprolactone (PCL)/alginate hybrid composite scaffolds. Carbohydr. Polym. 2014, 114, 213–221. [Google Scholar] [CrossRef]
- Kantak, M.N.; Bharate, S.S. Analysis of clinical trials on biomaterial and therapeutic applications of chitosan: A review. Carbohydr. Polym. 2022, 278, 118999. [Google Scholar] [CrossRef] [PubMed]
- Konkel, J.E.; O’Boyle, C.; Krishnan, S. Distal Consequences of Oral Inflammation. Front. Immunol. 2019, 10, 1403. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.-N.; Nabende, W.Y.; Jeong, H.; Hahn, D.; Jeong, G.-S. The marine-derived natural product epiloliolide isolated from sargassum horneri regulates NLRP3 via PKA/CREB, promoting proliferation and anti-inflammatory effects of human periodontal ligament cells. Mar. Drugs 2021, 19, 388–402. [Google Scholar] [CrossRef] [PubMed]
- Romero-Castro, N.S.; Vázquez-Villamar, M.; Muñoz-Valle, J.F.; Reyes-Fernández, S.; Serna-Radilla, V.O.; García-Arellano, S. Relationship between TNF-α, MMP-8, and MMP-9 levels in gingival crevicular fluid and the subgingival microbiota in periodontal disease. Odontology 2020, 108, 25–33. [Google Scholar] [CrossRef]
- Wang, Q.; Sun, L.; Gong, Z.; Du, Y. Veratric acid inhibits LPS-induced IL-6 and IL-8 production in human gingival fibroblasts. Inflammation 2016, 39, 237–242. [Google Scholar] [CrossRef]
- Chen, J.; Huang, Y.; Bian, X.; He, Y. Berberine Ameliorates Inflammation in Acute Lung Injury via NF-κB/Nlrp3 Signaling Pathway. Front. Nutr. 2022, 9, 851255. [Google Scholar] [CrossRef]
- Choi, J.K.; Kim, S.W.; Kim, D.S.; Lee, J.Y.; Lee, S.; Oh, H.M.; Ha, Y.S.; Yoo, J.; Park, P.H.; Shin, T.Y.; et al. Oleanolic acid acetate inhibits rheumatoid arthritis by modulating T cell immune responses and matrix-degrading enzymes. Toxicol. Appl. Pharmacol. 2016, 290, 1–9. [Google Scholar] [CrossRef]
- Jia, Q.; Cheng, W.; Yue, Y.; Hu, Y.; Zhang, J.; Pan, X.; Xu, Z.; Zhang, P. Cucurbitacin E inhibits TNF-α-induced inflammatory cytokine production in human synoviocyte MH7A cells via suppression of PI3K/AKT /NF-κB pathways. Int. Immunopharmacol. 2015, 29, 884–890. [Google Scholar] [CrossRef]
- Nardone, V.; D’Asta, F.; Brandi, M.L. Pharmacological management of osteogenesis. Clinics 2014, 69, 438–446. [Google Scholar] [CrossRef] [PubMed]
- Singh, N.; Sharma, B. Toxicological effects of berberine and sanguinarine. Front. Mol. Biosci. 2018, 5, 21. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Zhu, B.; Tian, X.Y.; Yu, H.Y.; Qiao, B.; Zhao, L.S.; Zhang, B. Exosomes derived from human umbilical cord mesenchymal stem cells enhance the osteoblastic differentiation of periodontal ligament stem cells under high glucose conditions through the PI3K/AKT signaling pathway. Biomed. Environ. Sci. 2022, 35, 811–820. [Google Scholar] [PubMed]
- Sartori, E.M.; Magro-Filho, O.; Silveira Mendonca, D.B.; Li, X.; Fu, J.; Mendonca, G. Modulation of micro RNA expression and osteoblast differentiation by nanotopography. Int. J. Oral Maxillofac. Implant. 2018, 33, 269–280. [Google Scholar] [CrossRef] [PubMed]
- Van Straalen, J.P.; Sanders, E.; Prummel, M.F.; Sanders, G.T. Bone-alkaline phosphatase as indicator of bone formation. Clin. Chim. Acta Int. J. Clin. Chem. 1991, 201, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Beck, G.R., Jr. Inorganic phosphate as a signaling molecule in osteoblast differentiation. J. Cell. Biochem. 2003, 90, 234–243. [Google Scholar] [CrossRef]
- Chenite, A.; Chaput, C.; Wang, D.; Combes, C.; Buschmann, M.D.; Hoemann, C.D.; Leroux, J.C.; Atkinson, B.L.; Binette, F.; Selmani, A. Novel injectable neutral solutions of chitosan form biodegradable gels in situ. Biomaterials 2000, 21, 2155–2161. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, C.; Wang, C.; Zhang, Q.; Qu, X.; Liang, C.; Si, C.; Wang, L. Treatment of periodontal inflammation in diabetic rats with IL-1ra thermosensitive hydrogel. Int. J. Mol. Sci. 2022, 23, 13939. [Google Scholar] [CrossRef]
- Xu, X.; Gu, Z.; Chen, X.; Shi, C.; Liu, C.; Liu, M.; Wang, L.; Sun, M.; Zhang, K.; Liu, Q.; et al. An injectable and thermosensitive hydrogel: Promoting periodontal regeneration by controlled-release of aspirin and erythropoietin. Acta Biomater. 2019, 86, 235–246. [Google Scholar] [CrossRef]
- Qiao, S.; Li, B.; Cai, Q.; Li, Z.; Yin, Z.; He, J.; Li, Y.; Meng, W. Involvement of ferroptosis in Porphyromonas gingivalis lipopolysaccharide-stimulated periodontitis in vitro and in vivo. Oral Dis. 2022, 6, 1–12. [Google Scholar] [CrossRef]
Gene | Sequence of Primers (5′→3′) |
---|---|
β-actin | F: GGAGATTACTGCCCTGGCTCCTA R: GACTCATCGTACTCCTGCTTGCTG |
IL-6 | F: AAGCCAGAGCTGCAGGATGAGTA R: TGTCCTGCAGCCACTGGTTC |
TNF-α | F: TTCCAATGGGCTTTCGGAAC R: AGACATCTTCAGCAGCCTTGTGAG |
IL-1β | F: CCCTGAACTCAACTGTGAAATAGCA R: CCCAAGTCAAGGGCTTGGAA |
Gene | Sequence of Primers (5′→3′) |
---|---|
β-actin | F: CATCCGTAAAGACCTCTATGCCAAC R: ATGGAGCCACCGATCCACA |
ALP | F: GCAGTATGAATTGAATCGGAACAC R: ATGGCCTGGTCCATCTCCAC |
COL-1 | F: GACATGTTCAGCTTTGTGGACCTC R: GGGACCCTTAGGCCATTGTGTA |
OCN | F: AGCAGCTTGGCCCAGACCTA R: TAGCGCCGGAGTCTGTTCACTAC |
Runx-2 | F: TGCAAGCAGTATTTACAACAGAGG R: GGCTCACGTCGCTCATCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, C.; Liu, C.; Liang, C.; Qu, X.; Zou, X.; Du, S.; Zhang, Q.; Wang, L. Role of Berberine Thermosensitive Hydrogel in Periodontitis via PI3K/AKT Pathway In Vitro. Int. J. Mol. Sci. 2023, 24, 6364. https://doi.org/10.3390/ijms24076364
Wang C, Liu C, Liang C, Qu X, Zou X, Du S, Zhang Q, Wang L. Role of Berberine Thermosensitive Hydrogel in Periodontitis via PI3K/AKT Pathway In Vitro. International Journal of Molecular Sciences. 2023; 24(7):6364. https://doi.org/10.3390/ijms24076364
Chicago/Turabian StyleWang, Chang, Chang Liu, Chen Liang, Xingyuan Qu, Xinying Zou, Siyu Du, Qian Zhang, and Lei Wang. 2023. "Role of Berberine Thermosensitive Hydrogel in Periodontitis via PI3K/AKT Pathway In Vitro" International Journal of Molecular Sciences 24, no. 7: 6364. https://doi.org/10.3390/ijms24076364