Cycloastragenol: A Novel Senolytic Agent That Induces Senescent Cell Apoptosis and Restores Physical Function in TBI-Aged Mice
Abstract
:1. Introduction
2. Results
2.1. CAG Is a Potential Senolytic Agent
2.2. CAG Induces Senescent Cell Apoptosis by Inhibiting the Antiapoptotic Bcl-2 Family and PI3K/AKT/mTOR Pathway
2.3. CAG Suppresses the SASP and Decreases Senescence and Cell Migration Induced by SCs
2.4. CAG Can Synergistically Eliminate SCs with ABT263
2.5. CAG Delays Age-Related Symptoms and Organ Aging in TBI-Aged Mice
2.6. CAG Decreases the Burden of Senescent Cells and Reduces SASP in TBI-Aged Mice
3. Discussion
4. Material and Methods
4.1. Cell Culture, SC Induction, and Reagents
4.2. SA-β-Galactosidase Staining of Cultured Cells and Adipose Tissue
4.3. Assay to Identify Senolytic Agents
4.4. Apoptosis Assay
4.5. Western Immunoblotting
4.6. Quantitative Polymerase Chain Reaction (qRT-PCR)
4.7. Cell Migration Assay
4.8. Total-Body Irradiation (TBI) and CAG Treatment
4.9. Open-Field Test
4.10. Micro-CT Analysis
4.11. Immunohistochemistry Staining
4.12. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- LeBrasseur, N.K.; Tchkonia, T.; Kirkland, J.L. Cellular Senescence and the Biology of Aging, Disease, and Frailty. Nestle Nutr. Inst. Workshop Ser. 2015, 83, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Partridge, L.; Deelen, J.; Slagboom, P.E. Facing up to the global challenges of ageing. Nature 2018, 561, 45–56. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Otin, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. The hallmarks of aging. Cell 2013, 153, 1194–1217. [Google Scholar] [CrossRef] [PubMed]
- Pignolo, R.J.; Passos, J.F.; Khosla, S.; Tchkonia, T.; Kirkland, J.L. Reducing Senescent Cell Burden in Aging and Disease. Trends Mol. Med. 2020, 26, 630–638. [Google Scholar] [CrossRef] [PubMed]
- Gorgoulis, V.; Adams, P.D.; Alimonti, A.; Bennett, D.C.; Bischof, O.; Bishop, C.; Campisi, J.; Collado, M.; Evangelou, K.; Ferbeyre, G.; et al. Cellular Senescence: Defining a Path Forward. Cell 2019, 179, 813–827. [Google Scholar] [CrossRef]
- Childs, B.G.; Durik, M.; Baker, D.J.; van Deursen, J.M. Cellular senescence in aging and age-related disease: From mechanisms to therapy. Nat. Med. 2015, 21, 1424–1435. [Google Scholar] [CrossRef]
- Xu, M.; Palmer, A.K.; Ding, H.; Weivoda, M.M.; Pirtskhalava, T.; White, T.A.; Sepe, A.; Johnson, K.O.; Stout, M.B.; Giorgadze, N.; et al. Targeting senescent cells enhances adipogenesis and metabolic function in old age. eLife 2015, 4, e12997. [Google Scholar] [CrossRef]
- Zhu, Y.; Tchkonia, T.; Pirtskhalava, T.; Gower, A.C.; Ding, H.; Giorgadze, N.; Palmer, A.K.; Ikeno, Y.; Hubbard, G.B.; Lenburg, M.; et al. The Achilles’ heel of senescent cells: From transcriptome to senolytic drugs. Aging Cell 2015, 14, 644–658. [Google Scholar] [CrossRef]
- Zhu, Y.; Tchkonia, T.; Fuhrmann-Stroissnigg, H.; Dai, H.M.; Ling, Y.Y.; Stout, M.B.; Pirtskhalava, T.; Giorgadze, N.; Johnson, K.O.; Giles, C.B.; et al. Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors. Aging Cell 2016, 15, 428–435. [Google Scholar] [CrossRef]
- Fuhrmann-Stroissnigg, H.; Ling, Y.Y.; Zhao, J.; McGowan, S.J.; Zhu, Y.; Brooks, R.W.; Grassi, D.; Gregg, S.Q.; Stripay, J.L.; Dorronsoro, A.; et al. Identification of HSP90 inhibitors as a novel class of senolytics. Nat. Commun. 2017, 8, 422. [Google Scholar] [CrossRef]
- Justice, J.N.; Nambiar, A.M.; Tchkonia, T.; LeBrasseur, N.K.; Pascual, R.; Hashmi, S.K.; Prata, L.; Masternak, M.M.; Kritchevsky, S.B.; Musi, N.; et al. Senolytics in idiopathic pulmonary fibrosis: Results from a first-in-human, open-label, pilot study. EBioMedicine 2019, 40, 554–563. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Nimmer, P.M.; Tahir, S.K.; Chen, J.; Fryer, R.M.; Hahn, K.R.; Iciek, L.A.; Morgan, S.J.; Nasarre, M.C.; Nelson, R.; et al. Bcl-2 family proteins are essential for platelet survival. Cell Death Differ. 2007, 14, 943–951. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Doornebal, E.J.; Pirtskhalava, T.; Giorgadze, N.; Wentworth, M.; Fuhrmann-Stroissnigg, H.; Niedernhofer, L.J.; Robbins, P.D.; Tchkonia, T.; Kirkland, J.L. New agents that target senescent cells: The flavone, fisetin, and the BCL-XL inhibitors, A1331852 and A1155463. Aging 2017, 9, 955–963. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chang, J.; Liu, X.; Zhang, X.; Zhang, S.; Zhang, X.; Zhou, D.; Zheng, G. Discovery of piperlongumine as a potential novel lead for the development of senolytic agents. Aging 2016, 8, 2915–2926. [Google Scholar] [CrossRef]
- Li, W.; He, Y.; Zhang, R.; Zheng, G.; Zhou, D. The curcumin analog EF24 is a novel senolytic agent. Aging 2019, 11, 771–782. [Google Scholar] [CrossRef]
- Shen, C.Y.; Jiang, J.G.; Yang, L.; Wang, D.W.; Zhu, W. Anti-ageing active ingredients from herbs and nutraceuticals used in traditional Chinese medicine: Pharmacological mechanisms and implications for drug discovery. Br. J. Pharmacol. 2017, 174, 1395–1425. [Google Scholar] [CrossRef]
- Yu, Y.; Zhou, L.; Yang, Y.; Liu, Y. Cycloastragenol: An exciting novel candidate for age-associated diseases. Exp. Ther. Med. 2018, 16, 2175–2182. [Google Scholar] [CrossRef]
- Salvador, L.; Singaravelu, G.; Harley, C.B.; Flom, P.; Suram, A.; Raffaele, J.M. A Natural Product Telomerase Activator Lengthens Telomeres in Humans: A Randomized, Double Blind, and Placebo Controlled Study. Rejuvenation Res. 2016, 19, 478–484. [Google Scholar] [CrossRef]
- Liu, J.; Gao, D.; Dan, J.; Liu, D.; Peng, L.; Zhou, R.; Luo, Y. The protective effect of cycloastragenol on aging mouse circadian rhythmic disorder induced by d-galactose. J. Cell Biochem. 2019, 120, 16408–16415. [Google Scholar] [CrossRef]
- Astle, M.V.; Hannan, K.M.; Ng, P.Y.; Lee, R.S.; George, A.J.; Hsu, A.K.; Haupt, Y.; Hannan, R.D.; Pearson, R.B. AKT induces senescence in human cells via mTORC1 and p53 in the absence of DNA damage: Implications for targeting mTOR during malignancy. Oncogene 2012, 31, 1949–1962. [Google Scholar] [CrossRef]
- Cuollo, L.; Antonangeli, F.; Santoni, A.; Soriani, A. The Senescence-Associated Secretory Phenotype (SASP) in the Challenging Future of Cancer Therapy and Age-Related Diseases. Biology 2020, 9, 485. [Google Scholar] [CrossRef] [PubMed]
- Birch, J.; Gil, J. Senescence and the SASP: Many therapeutic avenues. Genes Dev. 2020, 34, 1565–1576. [Google Scholar] [CrossRef] [PubMed]
- Shoji, H.; Miyakawa, T. Age-related behavioral changes from young to old age in male mice of a C57BL/6J strain maintained under a genetic stability program. Neuropsychopharmacol. Rep. 2019, 39, 100–118. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zhang, J.; Han, X.; Fan, S. Total body irradiation induced mouse small intestine senescence as a late effect. J. Radiat. Res. 2019, 60, 442–450. [Google Scholar] [CrossRef] [PubMed]
- Van Deursen, J.M. The role of senescent cells in ageing. Nature 2014, 509, 439–446. [Google Scholar] [CrossRef] [PubMed]
- Childs, B.G.; Gluscevic, M.; Baker, D.J.; Laberge, R.M.; Marquess, D.; Dananberg, J.; van Deursen, J.M. Senescent cells: An emerging target for diseases of ageing. Nat. Rev. Drug Discov. 2017, 16, 718–735. [Google Scholar] [CrossRef]
- Ge, M.; Hu, L.; Ao, H.; Zi, M.; Kong, Q.; He, Y. Senolytic targets and new strategies for clearing senescent cells. Mech. Ageing Dev. 2021, 195, 111468. [Google Scholar] [CrossRef]
- Cang, S.; Iragavarapu, C.; Savooji, J.; Song, Y.; Liu, D. ABT-199 (venetoclax) and BCL-2 inhibitors in clinical development. J. Hematol. Oncol. 2015, 8, 129. [Google Scholar] [CrossRef]
- Siddiqui, W.A.; Ahad, A.; Ahsan, H. The mystery of BCL2 family: Bcl-2 proteins and apoptosis: An update. Arch. Toxicol. 2015, 89, 289–317. [Google Scholar] [CrossRef]
- Hu, L.; Li, H.; Zi, M.; Li, W.; Liu, J.; Yang, Y.; Zhou, D.; Kong, Q.P.; Zhang, Y.; He, Y. Why Senescent Cells Are Resistant to Apoptosis: An Insight for Senolytic Development. Front. Cell Dev. Biol. 2022, 10, 822816. [Google Scholar] [CrossRef]
- Weichhart, T. mTOR as Regulator of Lifespan, Aging, and Cellular Senescence: A Mini-Review. Gerontology 2018, 64, 127–134. [Google Scholar] [CrossRef]
- Inci, N.; Akyildiz, E.O.; Bulbul, A.A.; Turanli, E.T.; Akgun, E.; Baykal, A.T.; Colak, F.; Bozaykut, P. Transcriptomics and Proteomics Analyses Reveal JAK Signaling and Inflammatory Phenotypes during Cellular Senescence in Blind Mole Rats: The Reflections of Superior Biology. Biology 2022, 11, 1253. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Tchkonia, T.; Ding, H.; Ogrodnik, M.; Lubbers, E.R.; Pirtskhalava, T.; White, T.A.; Johnson, K.O.; Stout, M.B.; Mezera, V.; et al. JAK inhibition alleviates the cellular senescence-associated secretory phenotype and frailty in old age. Proc. Natl. Acad. Sci. USA 2015, 112, E6301–E6310. [Google Scholar] [CrossRef] [PubMed]
- Lopes-Paciencia, S.; Saint-Germain, E.; Rowell, M.C.; Ruiz, A.F.; Kalegari, P.; Ferbeyre, G. The senescence-associated secretory phenotype and its regulation. Cytokine 2019, 117, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Moiseeva, O.; Deschenes-Simard, X.; St-Germain, E.; Igelmann, S.; Huot, G.; Cadar, A.E.; Bourdeau, V.; Pollak, M.N.; Ferbeyre, G. Metformin inhibits the senescence-associated secretory phenotype by interfering with IKK/NF-kappaB activation. Aging Cell 2013, 12, 489–498. [Google Scholar] [CrossRef]
- Xu, Q.; Fu, Q.; Li, Z.; Liu, H.; Wang, Y.; Lin, X.; He, R.; Zhang, X.; Ju, Z.; Campisi, J.; et al. The flavonoid procyanidin C1 has senotherapeutic activity and increases lifespan in mice. Nat. Metab. 2021, 3, 1706–1726. [Google Scholar] [CrossRef]
- Yousefzadeh, M.J.; Zhu, Y.; McGowan, S.J.; Angelini, L.; Fuhrmann-Stroissnigg, H.; Xu, M.; Ling, Y.Y.; Melos, K.I.; Pirtskhalava, T.; Inman, C.L.; et al. Fisetin is a senotherapeutic that extends health and lifespan. EBioMedicine 2018, 36, 18–28. [Google Scholar] [CrossRef]
- Baker, D.J.; Jeganathan, K.B.; Cameron, J.D.; Thompson, M.; Juneja, S.; Kopecka, A.; Kumar, R.; Jenkins, R.B.; de Groen, P.C.; Roche, P.; et al. BubR1 insufficiency causes early onset of aging-associated phenotypes and infertility in mice. Nat. Genet. 2004, 36, 744–749. [Google Scholar] [CrossRef]
- Kumar, P.; Nagarajan, A.; Uchil, P.D. Analysis of Cell Viability by the MTT Assay. Cold Spring Harb. Protoc. 2018, 2018, pdb-rot095505. [Google Scholar] [CrossRef]
- Kraeuter, A.K.; Guest, P.C.; Sarnyai, Z. The Open Field Test for Measuring Locomotor Activity and Anxiety-Like Behavior. Methods Mol. Biol. 2019, 1916, 99–103. [Google Scholar] [CrossRef]
- Kim, Y.; Brodt, M.D.; Tang, S.Y.; Silva, M.J. MicroCT for Scanning and Analysis of Mouse Bones. Methods Mol. Biol. 2021, 2230, 169–198. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Guan, Z.; Jin, X.; Zhao, J.; Chen, G.; Ding, J.; Ren, Y.; Zhai, X.; Zhou, Q.; Guan, Z. Reversal of alopecia areata, osteoporosis follow treatment with activation of Tgr5 in mice. Biosci. Rep. 2021, 41, BSR20210609. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer 5′ to 3′ | Reverse Primer 5′ to 3′ |
---|---|---|
IL6 | TCTATACCACTTCACAAGTCGGAG | AGAATTGCCATTGCACAACTCTTT |
IL8 | ACTGAGAGTGATTGAGAGTGGAC | AACCCTCTGCACCCAGTTTTC |
IL1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
CXCL5 | AGCTGCGTTGCGTTTGTTTAC | TGGCGAACACTTGCAGATTAC |
CXCL10 | AGAACGGTGCGCTGCAC | CCTATGGCCCTGGGTCTC |
IGFBP7 | CGAGCAAGGTCCTTCCATAGT | GGTGTCGGGATTCCGATGAC |
GAPDH | GTCTTCACCACCATGGAGAAGGC | TTGTTGTCATGGATGACCTTGGCC |
Gene | Forward Primer 5′ to 3′ | Reverse Primer 5′ to 3′ |
---|---|---|
p16 | TACCCCGATTCAGGTGAT | TTGAGCAGAAGAGCTGCTACGT |
IL6 | GCCATCTTTGGAAGGTTCAGGTTG | ACTCACCTCTTCAGAACGAATTGCCA |
CXCL5 | TGCGTTGTGTTTGCTTAACCG | CTTCCACCGTAGGGCACTG |
CXCL10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA |
GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Gao, D.; Yuan, Y.; Zheng, R.; Sun, M.; Jia, S.; Liu, J. Cycloastragenol: A Novel Senolytic Agent That Induces Senescent Cell Apoptosis and Restores Physical Function in TBI-Aged Mice. Int. J. Mol. Sci. 2023, 24, 6554. https://doi.org/10.3390/ijms24076554
Zhang Y, Gao D, Yuan Y, Zheng R, Sun M, Jia S, Liu J. Cycloastragenol: A Novel Senolytic Agent That Induces Senescent Cell Apoptosis and Restores Physical Function in TBI-Aged Mice. International Journal of Molecular Sciences. 2023; 24(7):6554. https://doi.org/10.3390/ijms24076554
Chicago/Turabian StyleZhang, Yanghuan, Dongxiao Gao, Yang Yuan, Runzi Zheng, Manting Sun, Shuting Jia, and Jing Liu. 2023. "Cycloastragenol: A Novel Senolytic Agent That Induces Senescent Cell Apoptosis and Restores Physical Function in TBI-Aged Mice" International Journal of Molecular Sciences 24, no. 7: 6554. https://doi.org/10.3390/ijms24076554