Studies on the Anticancer and Antioxidant Activities of Resveratrol and Long-Chain Fatty Acid Esters
Abstract
:1. Introduction
2. Results and Discussion
2.1. Preparation of Esters of Resveratrol and Fatty Acids
2.2. RES Esters Inhibit Growth of Various Cancer Cell Lines
2.3. Apoptosis
2.4. Antioxidant Activity
3. Materials and Methods
3.1. Materials
3.2. Methods of Analysis
3.3. Synthesis of CLA Chloride
3.4. Synthesis of Lipid Derivatives of Resveratrol (2a-c-3a)
3.4.1. Tri-O-palmitoylresveratrol (tri-RES-PA) (2a)
3.4.2. Di-O-palmitoylresveratrol (di-RES-PA) (2b)
3.4.3. Mono-O-palmitoylresveratrol (mono-RES-PA) (2c)
3.4.4. Tri-O-oleoylresveratrol (tri-RES-OA) (3a)
3.4.5. Di-O-oleoylresveratrol (di-RES-OA) (3b)
3.4.6. Mono-O-oleoylresveratrol (mono-RES-OA) (3c)
3.4.7. Mono-O-(conjugated)linoleoylresveratrol (mono-RES-CLA) (3a)
3.5. Cell Lines and Cell Culture
3.6. Determination of Cell Viability
3.7. Analysis of Apoptosis
3.8. RNA Extraction and Real-Time Reverse Transcription PCR (qRT-PCR)
3.9. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vestergaard, M.; Ingmer, H. Antibacterial and antifungal properties of resveratrol. Int. J. Antimicrob. Agents 2019, 53, 716–723. [Google Scholar] [CrossRef] [PubMed]
- Chastang, T.; Pozzobon, V.; Taidi, B.; Courot, E.; Clément, C.; Pareau, D. Resveratrol production by grapevine cells in fed-batch bioreactor: Experiments and modelling. Biochem. Eng. J. 2018, 131, 9–16. [Google Scholar] [CrossRef]
- Gambini, J.; Inglés, M.; Olaso, G.; Lopez-Grueso, R.; Bonet-Costa, V.; Gimeno-Mallench, L.; Mas-Bargues, C.; Abdelaziz, K.M.; Gomez-Cabrera, M.C.; Vina, J.; et al. Properties of resveratrol: In vitro and in vivo studies about metabolism, bioavailability, and biological effects in animal models and humans. Oxid. Med. Cell. Longev. 2015, 2015, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elshaer, M.; Chen, Y.; Wang, X.J.; Tang, X. Resveratrol: An overview of its anti-cancer mechanisms. Life Sci. 2018, 207, 340–349. [Google Scholar] [CrossRef]
- Boocock, D.J.; Patel, K.R.; Faust, G.E.S.; Normolle, D.P.; Marczylo, T.H.; Crowell, J.A.; Brenner, D.E.; Booth, T.D.; Gescher, A.; Steward, W.P. Quantitation of trans-resveratrol and detection of its metabolites in human plasma and urine by high performance liquid chromatography. J. Chromatogr. B 2007, 848, 182–187. [Google Scholar] [CrossRef] [Green Version]
- Zhong, Y.; Shahidi, F. Lipophilized epigallocatechin gallate (EGCG) derivatives as novel antioxidants. J. Agric. Food Chem. 2011, 59, 6526–6533. [Google Scholar] [CrossRef]
- Panya, A.; Laguerre, M.; Bayrasy, C.; Lecomte, J.; Villeneuve, P.; McClements, D.J.; Decker, E.A. An investigation of the versatile antioxidant mechanisms of action of rosmarinate alkyl esters in oil-in-water emulsions. J. Agric. Food Chem. 2012, 60, 2692–2700. [Google Scholar] [CrossRef]
- Zhong, Y.; Chiou, Y.S.; Pan, M.H.; Shahidi, F. Anti-inflammatory activity of lipophilic epigallocatechin gallate (EGCG) derivatives in LPS-stimulated murine macrophages. Food Chem. 2012, 134, 742–748. [Google Scholar] [CrossRef]
- Oh, W.Y.; Shahidi, F. Antioxidant activity of resveratrol ester derivatives in food and biological model systems. Food Chem. 2018, 261, 267–273. [Google Scholar] [CrossRef]
- Savio, M.; Ferraro, D.; Maccario, C.; Vaccarone, R.; Jensen, L.D.; Corana, F.; Mannucci, B.; Bianchi, L.; Cao, L.; Stivala, L.A. Resveratrol analogue 4, 4′-dihydroxy-trans-stilbene potently inhibits cancer invasion and metastasis. Sci. Rep. 2016, 6, 19973. [Google Scholar] [CrossRef] [Green Version]
- Murias, M.; Jäger, W.; Handler, N.; Erker, T.; Horvath, Z.; Szekeres, T.; Nohl, H.; Gille, L. Antioxidant, prooxidant and cytotoxic activity of hydroxylated resveratrol analogues: Structure-activity relationship. Biochem. Pharmacol. 2005, 69, 903–912. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Jheng, L.C.; Chang, S.K.C.; Chen, Y.W.; Huang, L.T.; Liao, J.X.; Hou, C.Y. Synthesis and Characterization of Novel Resveratrol Butyrate Esters That Have the Ability to Prevent Fat Accumulation in a Liver Cell Culture Model. Molecules 2020, 25, 4199. [Google Scholar] [CrossRef] [PubMed]
- Biasutto, L.; Marotta, E.; De Marchi, U.; Zoratti, M.; Paradisi, C. Ester-based precursors to increase the bioavailability of quercetin. J. Med. Chem. 2007, 50, 241–253. [Google Scholar] [CrossRef]
- Pokorski, M.; Marczak, M.; Dymecka, A.; Suchocki, P. Ascorbyl palmitate as a carrier of ascorbate into neural tissues. J. Biomed. Sci. 2003, 10, 193–198. [Google Scholar] [CrossRef] [PubMed]
- Dasilva, G.; Boller, M.; Medina, I.; Storch, J. Relative levels of dietary EPA and DHA impact gastric oxidation and essential fatty acid uptake. JNB 2018, 55, 68–75. [Google Scholar] [CrossRef]
- Gu, C.; Suleria, H.A.; Dunshea, F.R.; Howell, K. Dietary lipids influence bioaccessibility of polyphenols from black carrots and affect microbial diversity under simulated gastrointestinal digestion. Antioxidants 2020, 9, 762. [Google Scholar] [CrossRef] [PubMed]
- Crauste, C.; Rosell, M.; Durand, T.; Vercauteren, J. Omega-3 polyunsaturated lipophenols, how and why? Biochimie 2016, 120, 62–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Méndez, L.; Medina, I. Polyphenols and fish oils for improving metabolic health: A revision of the recent evidence for their combined nutraceutical effects. Molecules 2021, 26, 2438. [Google Scholar] [CrossRef]
- Jang, M.; Cai, L.; Udeani, G.O.; Slowing, K.V.; Thomas, C.F.; Beecher, C.W.; Farnsworth, N.R.; Kinghorn, A.D.; Mehta, R.G.; Moon, R.C.; et al. Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 1997, 275, 218–220. [Google Scholar] [CrossRef] [Green Version]
- Oh, W.Y.; Chiou, Y.S.; Pan, M.H.; Shahidi, F. Lipophilised resveratrol affects the generation of reactive nitrogen species in murine macrophages and cell viability of human cancer cell lines. JFB 2019, 7, 201. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Fu, J.; Shurlknight, K.L.; Soroka, D.N.; Hu, Y.; Chen, X.; Sang, S. Novel resveratrol-based aspirin prodrugs: Synthesis, metabolism, and anticancer activity. J. Med. Chem. 2015, 58, 6494–6506. [Google Scholar] [CrossRef] [PubMed]
- Peterson, J.A.; Doughty, H.P.; Eells, A.J.; Johnson, T.A.; Hastings, J.P.; Crowther, C.M.; Andrus, M.B.; Kenealey, J.D. The effects of 4′-esterified resveratrol derivatives on calcium dynamics in breast cancer cells. Molecules 2017, 22, 1968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Islam, M.N.; Rauf, A.; Fahad, F.I.; Emran, T.B.; Mitra, S.; Olatunde, A.; Shariati, M.A.; Rengasamy, M.R.; Mubarak, M.S. Superoxide dismutase: An updated review on its health benefits and industrial applications. Crit. Rev. Food Sci. Nutr. 2022, 62, 7282–7300. [Google Scholar] [CrossRef]
- Shih, M.K.; Tain, Y.L.; Cheng, C.M.; Hsu, C.N.; Chen, Y.W.; Huang, H.T.; Chang, C.I.; Hou, C.Y. Separation and identification of resveratrol butyrate ester complexes and their bioactivity in HepG2 cell models. Int. J. Mol. Sci. 2021, 22, 13539. [Google Scholar] [CrossRef] [PubMed]
- Cheung, E.C.; Vousden, K.H. The role of ROS in tumour development and progression. Nat. Rev. Cancer. 2022, 22, 280–297. [Google Scholar] [CrossRef] [PubMed]
- Yousef, M.; Vlachogiannis, I.A.; Tsiani, E. Effects of resveratrol against lung cancer: In vitro and in vivo studies. Nutrients 2017, 9, 1231. [Google Scholar] [CrossRef] [Green Version]
- Zheng, X.; Jia, B.; Tian, X.T.; Song, X.; Wu, M.L.; Kong, Q.Y.; Li, H.; Liu, J. Correlation of reactive oxygen species levels with resveratrol sensitivities of anaplastic thyroid cancer cells. Oxid. Med. Cell. Longev. 2018, 2018, 12. [Google Scholar] [CrossRef] [Green Version]
- Komorowska, D.; Gajewska, A.; Hikisz, P.; Bartosz, G.; Rodacka, A. Comparison of the effects of resveratrol and its derivatives on the radiation response of MCF-7 breast cancer cells. Int. J. Mol. Sci. 2021, 22, 9511. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′–>3′) |
---|---|
BAX | F: CGAGTGGCAGCTGAGATGTT |
R: AAGGAAGTCCAGTGTCCAGC | |
BCL2 | F: ATCGCCCTGTGGATGACTGAG |
R: CAGCCAGGAGAAATCAAACAGAGG | |
p21 | F: TGCCGAAGTCAGTTCCTTGT |
R: GTTCTGACATGGCGCCTCC | |
p53 | F: TTTCGACATAGCGTGGTGGT |
R: CTCAAAGCTGTTCCGTCCCA | |
SOD1 | F: CATTCCATCATTGGCCGCAC |
R: GAGCGATCCCAATCACACCA | |
SOD2 | F: GGACAAACCTGAGCCCCAAT |
R: TTGGACACCAGCCGATACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szczepańska, P.; Rychlicka, M.; Groborz, S.; Kruszyńska, A.; Ledesma-Amaro, R.; Rapak, A.; Gliszczyńska, A.; Lazar, Z. Studies on the Anticancer and Antioxidant Activities of Resveratrol and Long-Chain Fatty Acid Esters. Int. J. Mol. Sci. 2023, 24, 7167. https://doi.org/10.3390/ijms24087167
Szczepańska P, Rychlicka M, Groborz S, Kruszyńska A, Ledesma-Amaro R, Rapak A, Gliszczyńska A, Lazar Z. Studies on the Anticancer and Antioxidant Activities of Resveratrol and Long-Chain Fatty Acid Esters. International Journal of Molecular Sciences. 2023; 24(8):7167. https://doi.org/10.3390/ijms24087167
Chicago/Turabian StyleSzczepańska, Patrycja, Magdalena Rychlicka, Sylwia Groborz, Angelika Kruszyńska, Rodrigo Ledesma-Amaro, Andrzej Rapak, Anna Gliszczyńska, and Zbigniew Lazar. 2023. "Studies on the Anticancer and Antioxidant Activities of Resveratrol and Long-Chain Fatty Acid Esters" International Journal of Molecular Sciences 24, no. 8: 7167. https://doi.org/10.3390/ijms24087167