Next Article in Journal
Evaluation of Flathead Grey Mullets (Mugil cephalus) Immunization and Long-Term Protection against Vibrio harveyi Infection Using Three Different Vaccine Preparations
Next Article in Special Issue
Analysis of Raffinose Synthase Gene Family in Bread Wheat and Identification of Drought Resistance and Salt Tolerance Function of TaRS15-3B
Previous Article in Journal
From Pathogenesis to Intervention: The Importance of the Microbiome in Oral Mucositis
Previous Article in Special Issue
Environmental Stimuli: A Major Challenge during Grain Filling in Cereals
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 9
10.3390/ijms24098276
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

InDel and SCoT Markers for Genetic Diversity Analysis in a Citrus Collection from the Western Caucasus

by
Raisa Kulyan
1,
Lidiia Samarina
1,2,*,
Ruset Shkhalakhova
1,
Alexandr Kuleshov
1,
Yulia Ukhatova
2,3,
Olga Antonova
2,
Natalia Koninskaya
1,
Alexandra Matskiv
1,
Valentina Malyarovskaya
1 and
Alexey Ryndin
1
1
Federal Research Centre the Subtropical Scientific Centre of the Russian Academy of Sciences, 354002 Sochi, Russia
2
“Sirius University of Science and Technology”, Olimpiyskiy Ave. b.1, 354340 Sirius, Kransnodar Region, Russia
3
Federal Research Center N. I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR), 190000 Saint Petersburg, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(9), 8276; https://doi.org/10.3390/ijms24098276
Submission received: 11 April 2023 / Revised: 30 April 2023 / Accepted: 2 May 2023 / Published: 5 May 2023
(This article belongs to the Special Issue Abiotic Stress in Plant: From Gene to the Fields 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Citrus collections from extreme growing regions can be an important source of tolerant germplasms for the breeding of cold-tolerant varieties. However, the efficient utilization of these germplasms requires their genetic background information. Thus, efficient marker systems are necessary for the characterization and identification of valuable accessions. In this study, the efficiency of 36 SCoT markers and 60 InDel markers were evaluated as part of the broad citrus collection of the Western Caucasus. The interspecific and intraspecific genetic diversity and genetic structures were analyzed for 172 accessions, including 31 species and sets of the locally derived cultivars. Single markers, such as SCoT18 (0.84), SCoT20 (0.93), SCoT23 (0.87), SCoT31 (0.88), SCoT36 (0.87) и LG 1-4 (0.94), LG 4-3 (0.86), LG 7-11 (0.98), and LG 8-10 (0.83), showed a high discriminating power, indicating the good applicability of these markers to assess intraspecific diversity of the genus Citrus. Overall, SCoT markers showed a higher level of polymorphism than InDel markers. According to analysis of population structure, SCoT and InDel markers showed K = 9 and K = 5 genetic clusters, respectively. The lowest levels of genetic admixtures and diversity were observed among the locally derived satsumas and lemons. The highest level of genetic admixtures was observed in the lime group. Phylogenetic relationships indicated a high level of interspecific genetic diversity but a low level of intraspecific diversity in locally derived satsumas and lemons. The results provide new insight into the origin of citrus germplasms and their distribution in colder regions. Furthermore, they are important for implementing conservation measures, controlling genetic erosion, developing breeding strategies, and improving breeding efficiency.

1. Introduction

Commercially important cultivars of the genus Citrus L. are the most produced fruits in the world with over 153 million tons of production in 2018 [1,2].
The Western Caucasus is one of the most northerly Citrus growing areas in the world where the winter temperatures can fall below minus 5 °C and the absolute minimum temperature is minus 11 °C [3]. It makes this region unique for the cultivation and breeding of cold-tolerant citrus genotypes. Citrus germplasm was introduced here in 1902 from the Mediterranean, USA, Turkey, Iran, and Japan. As a result of the conventional breeding, dozens of locally adapted cultivars of lemon, mandarin, pomelo, etc. have been developed over the past 80 years. Currently, this citrus collection consists of more than 200 accessions maintained in the FRC SSC RAS, which were phenotypically characterized over decades [4]. The sets of locally derived accessions are of unknown origin, some of them forming from asexual reproduction [5,6] and others from free pollination and controlled hybridization. Among them are a broad set of frost-tolerant lemon and mandarin genotypes [4]. To understand the mechanisms of the domestication of Citrus germplasm in this extreme environment, the genetic origin and relationships among accessions have to be elaborated. In addition, the genetic background information of this germplasm is necessary for its efficient utilization. However, a high level of polyembryony is a serious breeding constraint for many citrus varieties, thus it is necessary to find efficient DNA markers with high discriminative power for intraspecific fingerprinting.
Different DNA markers (AFLP, IRAP, SSR, CAPS, SCoT, InDel) were evaluated to characterize the genetic diversity in the Citrus germplasm collections worldwide [7,8,9,10,11,12,13]. These studies indicated that each marker type has its advantages and disadvantages. Thus, the combination of different markers can be an efficient tool to characterize the genetic diversity in collections. Among the different DNA markers, the insertion–deletion (InDel) markers were recently developed based on the full genome sequencing of satsuma mandarin to identify hybrid embryos [9]. The advantage of these markers is that they can distinguish heterozygous and homozygous genotypes using a simple and inexpensive method of agarose gel electrophoresis. However, the efficiency of these markers for other Citrus species has still not been sufficiently evaluated [10]. Additionally, the start codon-targeted (SCoT) markers are based on polymorphisms in the short, conserved region of plant genes surrounding the ATG translation initiation codon and are codominant due to insertion–deletion mutations [14]. Since the region flanking the ATG start codon is highly conserved in all plant species, it was predicted that the SCoT method would be useful for generating DNA markers in diverse plant species [15].
The objective of this study was to evaluate the efficiency of InDel and SCoT markers for the interspecific and intraspecific analysis of different citrus species and to evaluate the relationships and genetic background of one of the northernmost citrus collections. The results provide new insight into the citrus germplasm’s origin and distribution in colder regions, and they are important for implementing conservation measures, controlling genetic erosion, developing breeding strategies, and improving breeding efficiency.

2. Results

2.1. Efficiency of SCoT and InDel Primers for Genetic Diversity Analysis of the Citrus Germplasm Collection

Out of 36 SCoT primers, 24 primers showed low amplification quality with weak or fuzzy bands and were therefore removed from the analysis. The remaining 12 SCoT primers showed reproducible results with clear polymorphisms and resolution within the citrus genotypes (SCoT2, SCoT6, SCoT9, SCoT12, SCoT13, SCoT14, SCoT18, SCoT20, SCoT21, SCoT23, SCoT31, SCoT36) (Table S2). With the 12 SCoTs, a total of 322 bands were detected in 172 genotypes, ranging from 19 (for SCoT36) to 35 (for SCoT12) bands with the mean diversity index H = 0.43 (Table 1). An average PIC = 0.34 was detected with the highest value being 0.39 for SCoT2 and the lowest value being 0.32 for SCoT18. The mean discriminating power D = 0.52 was detected with the highest value ranging from 0.84 to 0.93 for SCoT18, SCoT20, SCoT23, SCoT31, and SCoT36.
Out of 60 InDel primers, 51 primers showed a low amplification quality with weak or fuzzy bands and were therefore removed from the analysis. The remaining 9 InDel primers showed reproducible results with clear polymorphisms and resolution within Citrus genotypes (LG 1-4, LG 2-6, LG3-14, LG4-2, LG 4-3, LG 5-20, LG 7-11, LG 8-10, LG 9-2) (Table S2).
For the 9 InDels, a total of 40 bands were detected in 172 genotypes, ranging from 2 (for LG 2-6, LG3-14) to 11 (for LG 7-11) with the mean diversity index H = 0.38 (Table 2). An average PIC = 0.41 was detected, with the highest value being 0.46 for LG 2-6 and the lowest value being 0.37 for LG 8-10. The mean D = 0.64 was observed with the highest value ranging from 0.83 to 0.98 for LG 1-4, LG 4-3, LG 7-11, and LG 8-10.

2.2. Genetic Structure of the Citrus Germplasm Collection Based on SCoT and InDel Polymorphisms

Following STRUCTURE HARVESTER analysis using the 12 SCoT marker data, the 172 accessions were grouped into nine genetic clusters (K = 9) (Figure 1). The genetic structure based on SCoT markers showed clear clustering of citrus species. Overall, each genetic cluster consisted of several species of the genus Citrus. The highest level of homogeneity was observed in the clusters 1, 2, 5, 6, and 7. Interestingly, 40 cultivars of satsuma mandarin (C. × aurantium var. unshiu) were divided into two clusters: cluster 1 (mostly combined new locally derived breeding forms) and cluster 3 (mostly combined old locally derived cultivars). Among them, a set of the genotypes with genetic admixtures was identified, for example, Hybrid 98-9, Clone 31, Sentyabrskii, Olimpiyskii2014, Kodorskii, Kelasurskii, Clone#33, Hybrid 99-4, Clone#22, Izeki Wase, Sochinskii23, Slava Vavilova, or Pioneer80. These genotypes can be an important source of diversity and will be useful for further breeding programs to increase the genetic diversity of mandarins in colder regions. All true lemons (C. × limon var. limon), along with the ancestral species C. medica and its hybrids, comprised the green cluster 2 and all oranges comprised the purple cluster 5. Several genotypes with genetic admixtures of about 10–50% were observed in each of these clusters.
The highest level of genetic admixtures was observed in Cluster 4 (yellow color). This cluster combined C. maxima accessions and its hybrid species, citron, bitter orange, and hybrids of C. × junos. The remaining 8 clusters mostly consisted of sweet limes and sour limes with their respective ancestral species (brown color). Most lime accessions contained a high percentage of genetic admixtures of the other citrus groups.
The InDel markers showed less clear genetic structure as compared to the SCoT markers. As a result, several secondary species and interspecific hybrids were combined into the same clusters (Figure 2). In particular, red cluster-combined accessions belonged to several species: sweet oranges (C. × aurantium var. sinensis) and limes (C. × latifolia var. latifolia and C. × limon var. limetta, C. aurantifolia). Green cluster-combined Fortunella spp. Accessions combined grapefruits (C. × aurantium var. paradisi) and its hybrids. Finally, the last two clusters consisted of the lemons (C. × limon var. limon) (blue cluster) and mandarins (C. × aurantium var. unshiu) (yellow cluster) with a low level of genetic admixtures. Additionally, two varieties of bitter orange (C. × aurantium L. var. aurantium) and C. ×junos joined the mandarin group.
To summarize, both SCoT and InDel marker data showed efficient discrimination of satsuma mandarins and lemons, which were grouped into separate clusters and showed a homogeneous genetic structure with a low level of admixtures. Additionally, SCoT markers allowed for the separation of orange, kumquat, and lime accessions, showing a greater level of polymorphisms as compared to InDel markers. However, both marker types showed a low level of genetic admixtures in C. × aurantium var. unshiu, C. × aurantium var. sinensis, and C. × limon var. limon, except for the few accessions showing 5 to 20% admixtures.

2.3. Phylogenetic Analysis of the Citrus Germplasm Collection Based on SCoT and InDel Polymorphisms

The results of the neighbor joining analysis based on the combined SCoT and InDel data resulted in three main branches divided into seven sub-branches. These are presented on a phylogenetic tree (Figure 3). The first branch divided into two sub-branches. Sub-branch 1.1 combined 33 accessions, 31 of which belonged to the lemon group, including old local cultivars such as “Odishi”, “Novoafonskii”, “Beskolyuchii”, “Udarnik”, “Hybrid3252”, etc. Their probable closely related hybrids of citron and mandarin joined this group. Sub-branch 1.2 combined 25 accessions of sweet lime varieties, as well as hybrids and the ancestral species of C. medica and C. maxima, indicating their close relationship.
The most abundant branch 2 combined three sub-branches of mandarins and oranges. Sub-branch 2.1 combined 38 accessions. Particularly, 12 accessions of sweet and bitter oranges and 14 accessions of satsuma mandarin of foreign and local origin joined this group. In addition, several accessions of pomelos and grapefruits were closely grouped with them. Sub-branch 2.2 combined 26 accessions of C. × aurantium var. unshiu of local breeding with non-presentable genetic distances among them. Sub-branch 2.3 combined 18 accessions of C. reticulata and its hybrids and C. × leiocarpa.
Finally, Branch 3 showed the greatest genetic distances among accessions and was divided into two sub-branches: Sub-branch 3.1 contained accessions of Fortunella spp., Poncirus spp., and wild relatives. Sub-branch 3.2 grouped several lime accessions of C. × limon var. limetta, C. × latifolia var. latifolia, and C. aurantifolia.
To summarize the results of the neighbor joining analysis, the combination of SCoT and InDel markers resulted in plausible positioning of the species on the tree. The clear separation of citrus species and the low level of genetic diversity in the locally derived cultivars, especially in satsuma mandarins and lemons («Millenium1», «Shirokolistnyy», «Yubileinii», «Iveriya», «Sochinskii23» «Slava Vavilova», «Pioneer80», «Sakharny», «Millenium 2», «Оcho Wase», «Kolkhidskii», «Kelasurskii», «Sentyabrskii», «Krasnodarskii83», «Olimpiyskii2014», «Georgievskii», «Krupnoplodny», etc. and «Odishi», «Novoafonskii», «Beskolyuchii», «Kuznera», «Novogruzinskii», «Maykopskii», «Krupnoplodny», «Udarnik», «Gonio», «Dioskuriya», «Gagrinskii» etc.) were revealed. The highest level of genetic diversity was observed in Branch 3 (wild relatives), Sub-branch 2.3 (mandarins), and Sub-branch 1.2 (limes). These results show the necessity of interspecific hybridization to increase genetic diversity in the local lemon and satsuma genotypes.

3. Discussion

The collection of the FRC SSC RAS is located on the Black Sea coast of the Western Caucasus and is represented by the genetic and ecological–geographical diversity of wild, introduced citrus species and cultivars, including locally derived cultivars. This is a unique border region for the cultivation and breeding of new cold-tolerant citrus varieties. One of the most important problems associated with the efficient utilization of citrus genetic resources is the insufficient use of modern germplasm characterization tools [16,17]. In this study, we analyzed the efficiency of SCoT and InDel markers to assess the genetic structure and diversity of the local citrus collection of 172 accessions.

3.1. Efficiency of SCoT and InDel Markers for Genetic Diversity Analysis of the Citrus Germplasm Collection

The genome of some citrus species has only recently been published, particularly the genome of the satsuma mandarin [18,19,20]. Based on the satsuma genome, InDel markers were recently developed to identify closely related accessions in the satsuma collection [9,10]. The satsumas are the most cold hardy mandarin varieties, and a high level of polyembryony is a serious biological constraint. Thus, it is necessary to find efficient markers with high discriminative power for intraspecific fingerprinting. In this study, we also selected SCoT markers, which can also be useful for QTL mapping due to advantages such as low cost and ease of use, as well as a connection with the sites of transcription initiation. Despite the wide use of SCoT markers, studies on citrus are insufficient and usually conducted on a small number of accessions [12,13,21].
For the first time, we have evaluated the efficiency of SCoT and InDel markers on a wide range of citrus species and cultivars.
Polymorphism information content (PIC) and discriminating power (D) characterize the degree of capabilities, efficiency, and potential of marker systems [22]. The PIC corresponds to its ability to detect polymorphisms among the individuals in a population [23]. The maximum PIC value for dominant markers is 0.5 [24,25,26,27,28,29]. Our results from the dominant SCoT markers showed a mean PIC = 0.3. For co-dominant markers, the efficient PIC is believed to be 0.5–1.0 [30]. Our results from the co-dominant InDel markers showed a mean PIC = 0.4, indicating a poor ability to indicate polymorphisms in the broad range of citrus species. The low PIC values for InDel markers were also reported in several other studies [31,32].
The D represents the probability that two randomly chosen individuals have different allelic patterns, and thus are distinguishable from one another [30]. The mean D value was 0.52 for SCoT and 0.64 for InDel markers. Several markers showed especially high values of D, namely SCoT18 (D = 0.84), SCoT20 (D = 0.93), SCoT23 (D = 0.87), SCoT31 (D = 0.88), SCoT36 (D = 0.87) и LG 1-4 (D = 0.94), LG 4-3 (D = 0.86), LG 7-11 (D = 0.98), and LG 8-10 (D = 0.83), indicating a good applicability of these markers to assess intraspecific diversity in the genus Citrus.

3.2. Genetic Structure of the Citrus Germplasm Collection Based on SCoT and InDel Polymorphisms

Following a STRUCTURE HARVESTER, the SCoT and InDel markers showed K = 9 and K = 5 genetic clusters, respectively. A different number of K can be explained by different discriminating powers and different genome target regions amplified by InDel and SCoT markers [33].
We suggested that InDel markers would be efficient to reveal the detailed genetic structure of the satsuma collection and identify hybrids because these markers were designed for satsuma species [10]. However, a low level of genetic admixtures was observed in satsuma clusters in particular, which is consistent with our previous study conducted with SSR markers [34]. Another study reported that InDel markers showed a low intraspecific diversity in several citrus species [35]. In general, a discrepancy between the morphological diversity and genetic homogeneity of cultivars within a species is common [34,35,36,37] since most varieties of secondary species originated from a clonal breeding and the fixation of somatic mutations [19,38,39]. Apomixis in mandarins, oranges, and lemons is also a possible reason for the low intraspecific genetic diversity.
Based on the selected SCoT and InDel markers, the genetic admixtures in several genotypes of mandarin («Sakharny», «Sochinskii23», «Clone33», «Hybrid 99-4», «Slava Vavilova»), lemon («Moskovskii», «Udarnik», «Gonio»), sweet orange («Washington Navel», «Washington Navel dwart», «Sukhumskii», «Hamlin»), and pomelo («Yubileinyy», «Asahikan», «Metelyova», «Grushevidnyy», «Sambokan») were clearly identified. These genotypes will be useful for further controlled hybridization to increase intraspecific genetic diversity in these species. Additionally, there was a significant introgression in the lime group with a genetic admixture of micranta and citron, which is consistent with other studies [12,40]. The admixtures of lemon, tangerine, lime, and orange were observed in pomelo and citron varieties and trifoliate orange. This indicates that sexual reproduction more frequently occurs in mono-embryonic wild relatives and ancestral citrus species rather than in secondary hybrid species, which is consistent with other studies [6,19,33].

3.3. Phylogenetic Analysis of the Citrus Germplasm Collection Based on SCoT and InDel Polymorphisms

The phylogenetic relationships between citrus and its relatives were successfully identified based on the selected SCoT and InDel markers. Accessions of wild Poncirus spp. And Fortunella spp., as well as the ancestral species C. maxima, C. medica, C. reticulata, and C. micrantha showed a comparable genetic distance to other citrus species.
The first branch showed an ancestral relationship to C. limon var. limon and C. × limon var. limetta. The origin of lemons and limes is complex and has different phylogenetic roots. It is suggested that C. lemon var. limon originated from the hybridization of C. × aurantium (C. maxima × C. reticulata) × C. medica or was obtained through a mutation of the original hybrid [19]. Sweet lime C. × limon var. limetta is believed to have the same parents as C. limon var. limon, but is thought to be derived from an independent reticulation event [40]. Our results are consistent with these data and demonstrate the close relations of C. limon var. limon, C. × limon var. limetta, C. maxima, and C. medica. Additionally, sour lime accessions (C. × latifolia var. latifolia) indicated close relationships with C. aurantifolia and C. micrantha and as such, they were placed in the third branch of the phylogenetic tree. C.× latifolia var. latifolia was derived from the pollination of the haploid ovule of C. limon var. limon by the diploid gamete of C. aurantifolia. In turn, C. aurantifolia was derived from the natural hybridization of C. micrantha as a female parent and C. medica as a male parent [40,41,42]. However, despite the fact that C. × limon var. limetta mainly contains the genetic contributions of C. maxima, C. reticulata, and C. medica, several accessions of sweet lime were located in the same branch with C. × latifolia var. latifolia. This could happen due to the low number of lime accessions in our dataset.
It is interesting that almost all locally derived cultivars of satsuma mandarin grouped into a separate sub-branch of the phylogenetic tree. It is assumed that satsuma mandarin (C. × aurantium var. unshiu) is a Japanese breeding line of the mandarin C. reticulata var. austera, which originated from the crossing of different species of mandarin and a number of independent somatic mutations [41,43]. Sweet orange (C. × aurantium var. sinensis) is placed nearby satsuma mandarins and it is considered a hybrid of the two ancestral species of C. reticulata var. austera and C. maxima [44]. Hybrid species C. × aurantium var. clementina and C. × junos were placed closer to C. × aurantium var. unshiu on the phylogenetic tree. These species presumably originated from crosses between C. × aurantium var. sinensis × C. reticulata var. austera and C. reticulata var. austera × C. cavaleriei, respectively [44]. Our results are consistent with other phylogenetic studies where C. maxima, C. × aurantium var. sinensis, C. cavaleriei, and C. reticulata var. austera acted as the common genetic contributors to mandarin-related species [44,45]. According to the neighbor joining analysis, C. × yuko and C. × leiocarpa grouped in the same sub-branch, which is consistent with the assumption that C. × yuko is a cross between C. × kinokuni and C. × leiocarpa [46]. Thus, differentiation between the gene pools of the original species C. maxima, C. medica, C. reticulata, and C. micrantha acted as a structuring factor of the analyzed edible citrus germplasm. Secondary species and modern varieties, in general, were intermediate between the main taxa, confirming their hybrid status.

4. Materials and Methods

4.1. The Plant Material and DNA Extraction

The plant material of 172 Citrus genotypes, including 31 species, 43 local cultivars, and 22 locally derived hybrids, was obtained from the germplasm bank of the FRC SSC RAS (Table S1). The fresh samples of young leaves were obtained from a healthy plant of each genotype. The plants were 5–30 years old and were maintained in the field and greenhouse collection. One sample per genotype was taken as a biological replicate. An amount of 70–100 mg of each sample was ground and mixed into a liquid nitrogen. DNA extraction was performed using CTAB protocol [47]. DNA quality was checked by agarose gel electrophoresis and spectrophotometrically using BioDrop μLite (Biodrop, Cambridge, UK). All samples were diluted to 20 ng μL−1 and stored at −20 °C.

4.2. PCR Analysis and Visualization

Since the 36 SCoT primers were originally developed for Oryza sativa [14] and 60 InDel primers were developed for C. × unshiu [9], we first assessed the transferability of these primers to 11 citrus accessions. The efficient SCoT and InDel markers were selected for further evaluation (Table S2).
The SCoT PCR reaction mixture consisted of a 10 μL 2×HS-TaqPCR reaction buffer (Biolabmix, Novosibirsk, Russia) containing Hot Start Taq-Polymerase, 0.4 μL of primer (10 µM), 2 μL of DNA (20 ng μL−1), and DEPC-treated water in a total PCR volume of 20 μL. Amplification was carried out in the MiniAmp thermal cycler (Thermo Fisher Scientific, MA, USA) with the following program: primary denaturation for 5 min at 95 °C, annealing for 35 cycles, denaturation at 95 °C for 1 min, annealing at 52 °C for 1 min, elongation at 72 °C for 2 min, and the final elongation at 72 °C for 5 min. The separation of SCoT fragments was performed on a 2% agarose gel for 2.5 h at 90 V in 1 × TAE buffer.
TIe InDel PCR reaction mixture consisted of 10 μL of 2×HS-TaqPCR reaction buffer (Biolabmix, Novosibirsk, Russia) containing Hot Start Taq-Polymerase, 0.4 μL of primer (10 µM), 2 μL of DNA (20 ng μL−1), and DEPC-treated water in a total PCR volume of 20 μL. Amplification was carried out in the MiniAmp thermal cycler (Thermo Fisher Scientific, MA, USA) with the following program: primary denaturation 5 min at 95 °C, annealing 35 cycles, denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, elongation at 72 °C for 30 s, and the final elongation at 72 °C for 2 min. The separation of InDel fragments was performed on a 3% agarose gel for 2.5 h at 90 V in 1 × TAE buffer.

4.3. Statistical Analysis

Genetic diversity parameters were calculated for each SCoT and InDel marker in the citrus collection using the software GeneAlex ver. 6.5 (https://biology-assets.anu.edu.au/GenAlEx/Download.html, 10 April 2023) [48,49] and the online resource [50]. The analysis function ‘Matches’ in GeneAlex ver. 6.5 [48,49] was used to identify genotypes with identical allelic patterns within the dataset. One biological replicate (one tree per genotype) and three technical replicates were assayed for each analyzed parameter. The following parameters were assessed: Na—total number of bands, PIC—polymorphism information content, D—discriminating power, and H—genetic diversity. Subsequently, the model-based clustering method was applied using the software STRUCTURE ver. 2.3.4. (Oxford, UK) [51] to verify the genetic structure within the Citrus collection. The parameters included 50,000 burn-in periods and 50,000 Markov Chain Monte Carlo repetitions using the admixture model with correlated allele models. The software STRUCTURE HARVESTER (https://taylor0.biology.ucla.edu/structureHarvester/, 10 April 2023) [52] was used to detect the most likely value for K based on Evanno’s ΔK method [53]. Phylogenetic trees were drawn based on the dissimilarity matrix using DARWIN ver.6.0 [54].

5. Conclusions

In our study, the efficiency of SCoT and InDel markers were evaluated in a wide range of citrus species and cultivars including 172 genotypes and 31 species. The highest discriminating power was observed in the following markers: SCoT18 (D = 0.84), SCoT20 (D = 0.93), SCoT23 (D = 0.87), SCoT31 (D = 0.88), SCoT36 (D = 0.87) и LG 1-4 (D = 0.94), LG 4-3 (D = 0.86), LG 7-11 (D = 0.98), and LG 8-10 (D = 0.83), indicating their strong applicability to assess the intraspecific diversity of the genus Citrus. The highest levels of genetic admixtures were detected in lime accessions. A low level of intraspecific diversity was detected in satsuma and lemon accessions. However, 10–50% of genetic admixtures were detected in some locally derived accessions, such as satsuma, lemon, sweet orange, and pomelo. These genotypes will be useful for further controlled hybridization to increase intraspecific genetic diversity in the aforementioned species.
Additionally, these results are valuable for further collection management and show the necessity of interspecific hybridization to increase intraspecific genetic diversity in colder regions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24098276/s1.

Author Contributions

Conceptualization, Y.U., O.A. and R.K.; methodology, L.S., Y.U. and R.K.; software, L.S.; validation, R.S., N.K. and Y.U.; formal analysis, Y.U. and O.A.; investigation, A.K., R.S., A.M. and N.K.; resources, R.K., V.M. and A.R.; data curation, R.K. and Y.U.; writing—original draft preparation, L.S. and R.S.; writing—review and editing, Y.U., R.K. and O.A.; visualization, L.S. and R.S.; supervision, R.K., Y.U. and O.A.; project administration, Y.U., R.K. and A.R.; funding acquisition, Y.U., O.A. and R.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research on the mandarin genotypes was funded by the Grant of the Ministry of Science and Higher Education of The Russian Federation (Project No 075-15-2021-1050). The research on the rest of the species in the citrus collection (lemons, pomelos, oranges, grapefruits et al.) was supported by the Ministry of Science and Higher Education of the Russian Federation (program No FGRW-2021-0006).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The citrus collection for this study was provided by the program of the Ministry of Science and Higher Education of the Russian Federation (program No FGRW-2021-0008).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Statista. Business Data Platform. Available online: https://www.statista.com (accessed on 5 April 2023).
  2. Food and Agriculture Organization of the United Nation. Available online: http://www.fao.org (accessed on 5 April 2023).
  3. Kulyan, R.V.; Samarina, L.S.; Rakhmangulov, R.S.; Kikavskii, I.V.; Alehna, A.I. Citrus genetic resources in Russia, Ukraine, Belarus: Conservation and management. Vavilov J. Genet. Breed. 2017, 21, 506–514. [Google Scholar] [CrossRef]
  4. Volk, G.; Samarina, L.; Kulyan, R.; Gorshkov, V.; Malyarovskaya, V.; Ryndin, A.; Polek, M.; Krueger, R.; Stover, E. Citrus genebank collections: International collaboration opportunities between the US and Russia. Genet. Resour. Crop. Evol. 2018, 65, 433–447. [Google Scholar] [CrossRef]
  5. Jeong, H.; Yun, Y.B.; Jeong, S.Y.; Cho, Y.; Kim, S. Characterization of miniature inverted repeat transposable elements inserted in the CitRWP gene controlling nucellar embryony and development of molecular markers for reliable genotyping of CitRWP in Citrus species. Sci. Hortic. 2023, 315, 112003. [Google Scholar] [CrossRef]
  6. Distefano, G.; Las Casas, G.; Deng, X.; Chai, L. Citrus Reproductive Biology from Flowering to Fruiting. In The Citrus Genome. Compendium of Plant Genomes; Gentile, A., La Malfa, S., Deng, Z., Eds.; Springer: Cham, Switzerland, 2020; pp. 167–176. [Google Scholar] [CrossRef]
  7. Abouzari, A.; Solouki, M.; Golein, B.; Fakheri, B.A.; Sabouri, A.; Dadras, A.R. Screening of molecular markers associated to cold tolerance-related traits in Citrus. Sci. Hortic. 2020, 263, 109145. [Google Scholar] [CrossRef]
  8. Nonaka, K.; Fujii, H.; Kita, M.; Shimada, T.; Endo, T.; Yoshioka, T.; Omura, M. Identification and Parentage Analysis of Citrus Cultivars Developed in Japan by CAPS Markers. Hortic. J. 2017, 86, 208–221. [Google Scholar] [CrossRef]
  9. Noda, T.; Daiou, K.; Mihara, T.; Nagano, Y. Development of Indel markers for the selection of Satsuma mandarin (Citrus unshiu Marc.) hybrids that can be used for low-cost genotyping with agarose gels. Euphytica 2020, 216, 179–187. [Google Scholar] [CrossRef]
  10. Noda, T.; Daiou, K.; Mihara, T.; Nagano, Y. Potential application of simple easy-to-use insertion-deletion (InDel) markers in citrus cultivar identification. Breed. Sci. 2021, 71, 601–608. [Google Scholar] [CrossRef]
  11. Samarina, L.S.; Malyarovskaya, V.I.; Reim, S.; Yakushina, L.G.; Koninskaya, N.G.; Klemeshova, K.V.; Shkhalakhova, R.M.; Matskiv, A.O.; Shurkina, E.A.; Gabueva, T.Y.; et al. Transferability of ISSR, SCoT and SSR Markers for Chrysanthemum × Morifolium Ramat and Genetic Relationships Among Commercial Russian Cultivars. Plants 2021, 10, 1302. [Google Scholar] [CrossRef]
  12. Juibary, P.L.; Seyedmehdi, F.S.; Sheidai, M.; Noormohammadi, Z.; Koohdar, F. Genetic structure analysis and genetic finger printing of sweet orange cultivars (Citrus sinensis (L.) Osbeck) by using SCoT molecular markers. Genet. Resour. Crop Evol. 2021, 68, 1645–1654. [Google Scholar] [CrossRef]
  13. Zanganeh, F.; Sheidai, M. Population genetic diversity and genetic affinity analyses of sweet orange cultivars (Citrus sinensis (L.) Osbeck) by using IRAP molecular markers. Genet. Resour. Crop Evol. 2022, 69, 2437–2446. [Google Scholar] [CrossRef]
  14. Collard, B.C.Y.; Mackill, D.J. Start Codon Targeted (SCoT) Polymorphism: A simple, novel DNA marker technique for generating gene-targeted markers in plants. Plant Mol. Biol. Rep. 2009, 27, 86–93. [Google Scholar] [CrossRef]
  15. Etminan, A.; Pour-Aboughadareh, A.; Mohammadi, R.; Ahmadi-Rad, A.; Noori, A.; Mahdavian, Z.; Moradi, Z. Applicability of start codon targeted (SCoT) and inter-simple sequence repeat (ISSR) markers for genetic diversity analysis in durum wheat genotypes. Biotechnol. Biotechnol. Equip. 2016, 30, 1075–1081. [Google Scholar] [CrossRef]
  16. Volk, G.M. Widespread applications of citrus cryopreservation. Citrograph 2015, 6, 42–44. [Google Scholar]
  17. Wang, Y.; Zhou, L.; Yu, X.; Stover, E.; Luo, F.; Duan, Y. Transcriptome Profiling of Huanglongbing (HLB) Tolerant and Susceptible Citrus Plants Reveals the Role of Basal Resistance in HLB Tolerance. Front. Plant Sci. 2016, 7, 933. [Google Scholar] [CrossRef]
  18. Wang, X.; Xu, Y.; Zhang, S.; Cao, L.; Huang, Y.; Cheng, J.; Wu, G.; Tian, S.; Chen, C.; Liu, Y.; et al. Genomic analyses of primitive, wild and cultivated citrus provide insights into asexual reproduction. Nat. Genet. 2017, 49, 765–772. [Google Scholar] [CrossRef] [PubMed]
  19. Wu, G.A.; Terol, J.; Ibanez, V.; López-García, A.; Pérez-Román, E.; Borreda´, C.; Domingo, C.; Tadeo, F.R.; Carbonell-Caballero, J.; Alonso, R.; et al. Genomics of the origin and evolution of Citrus. Nature 2018, 554, 311–316. [Google Scholar] [CrossRef]
  20. Liu, T.J.; Li, Y.P.; Zhou, J.J.; Hu, C.G.; Zhang, J.Z. Genome-wide genetic variation and comparison of fruit-associated traits between kumquat (Citrus japonica) and Clementine mandarin (Citrus clementina). Plant Mol. Biol. 2018, 96, 493–507. [Google Scholar] [CrossRef]
  21. Wu, X.; Zheng, F.; Xu, C.; Tang, W. Genetic diversity analysis of Shatangju mandarin (Citrus reticulata) by SCoT-PCR. Agric. Sci. Technol. 2016, 17, 34. [Google Scholar]
  22. Etminan, A.; Pour-Aboughadareh, A.; Noori, A.; Ahmadi-Rad, A.; Shooshtari, L.; Mahdavian, Z.; Yousefiazar-Khanian, M. Genetic relationships and diversity among wild Salvia accessions revealed by ISSR and SCoT markers. Biotechnol. Biotechnol. Equip. 2018, 32, 610–617. [Google Scholar] [CrossRef]
  23. Serrote, C.M.L.; Reiniger, L.R.S.; Silva, K.B.; Rabaiolli, S.M.D.S.; Stefanel, C.M.; Lemos, S.C.M.; Silveira, R.L.R.; Buuron, S.K.; Dos Santos, R.S.M.; Moro, S.C. Determining the Polymorphism Information Content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef]
  24. Giachino, R.R.A. Investigation of the genetic variation of anise (Pimpinella anisum L.) using RAPD and ISSR markers. Genet. Resour. Crop. Evol. 2019, 67, 763–780. [Google Scholar] [CrossRef]
  25. Ismail, N.A.; Rafii, M.Y.; Mahmud, T.M.M.; Hanafi, M.M.; Miah, G. Genetic diversity of torch ginger (Etlingera elatior) Germplasm Revealed by ISSR and SSR Markers. BioMed Res. Int. 2019, 2019, 5904804. [Google Scholar] [CrossRef] [PubMed]
  26. Abdelaziz, S.M.; Medraoui, L.; Alami, M.; Pakhrou, O.; Makkaoui, M.; Boukhary, A.O.M.S.; Filali-Maltouf, A. Inter simple sequence repeat markers to assess genetic diversity of the desert date (Balanites aegyptiaca Del.) for Sahelian ecosystem restoration. Sci. Rep. 2020, 10, 14948. [Google Scholar] [CrossRef] [PubMed]
  27. Tilwari, A.; Sharma, R. Random amplified polymorphic DNA and inter simple sequence repeat markers reveals genetic diversity between micro propagated, wild and field cultivated genotypes of Gloriosa superba: An endangered medicinal plant. Mol. Biol. Rep. 2021, 48, 2437–2452. [Google Scholar] [CrossRef] [PubMed]
  28. Sharma, V.; Thakur, M. Applicability of SCoT markers for detection of variations in Fusarium yellows resistant lines of ginger (Zingiber officinale Rosc.) induced through gamma irradiations. S. Afr. J. Bot. 2021, 140, 454–460. [Google Scholar] [CrossRef]
  29. Ghobadi, G.; Etminan, A.; Mehrabi, A.M.; Shooshtari, L. Molecular diversity analysis in hexaploid wheat (Triticum aestivum L.) and two Aegilops species (Aegilops crassa and Aegilops cylindrica) using CBDP and SCoT markers. J. Genet. Eng. Biotechnol. 2021, 19, 56. [Google Scholar] [CrossRef]
  30. Guzmán, F.A.; Moore, S.; De Vicente, M.C.; Jahn, M.M. Microsatellites to enhance characterization, conservation and breeding value of Capsicum germplasm. Genet. Resour. Crop. Evol. 2019, 67, 569–585. [Google Scholar] [CrossRef]
  31. García-Lor, A.; Luro, F.; Navarro, L.; Ollitrault, P. Comparative use of InDel and SSR markers in deciphering the interspecific structure of cultivated citrus genetic diversity: A perspective for genetic association studies. Mol. Genet. Genomics 2012, 287, 77–94. [Google Scholar] [CrossRef]
  32. Luro, F.L.; Costantino, G.; Terol, J.; Argout, X.; Allario, T.; Wincker, P.; Talon, M.; Ollitrault, P.; Morillon, R. Transferability of the EST-SSRs developed on Nules clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mapping. BMC Genom. 2008, 9, 287. [Google Scholar] [CrossRef]
  33. Ramadugu, C.; Pfeil, B.E.; Keremane, M.L.; Lee, R.F.; Maureira-Butler, I.J.; Roose, M.L. A six nuclear gene phylogeny of Citrus (Rutaceae) taking into account hybridization and lineage sorting. PLoS ONE 2013, 8, e68410. [Google Scholar] [CrossRef]
  34. Samarina, L.S.; Kulyan, R.V.; Koninskaya, N.G.; Gorshkov, V.M.; Ryndin, A.V.; Hanke, M.-V.; Flachowsky, H.; Reim, S. Genetic diversity and phylogenetic relationships among citrus germplasm in the Western Caucasus assessed with SSR and organelle DNA markers. Sci. Hortic. 2021, 288, 110355. [Google Scholar] [CrossRef]
  35. Ollitrault, P.; Garcia-Lor, A.; Terol, J.; Curk, F.; Ollitrault, F.; Talón, M.; Navarro, L. Comparative values of SSRs, SNPs and InDels for citrus genetic diversity analysis. Acta Hortic. 2015, 1065, 457–466. [Google Scholar] [CrossRef]
  36. Jannati, M.; Fotouhi, R.; Abad, A.P.; Salehi, Z. Genetic diversity analysis of Iranian citrus varieties using micro satellite (SSR) based markers. J. Hortic. For. 2009, 1, 120–125. [Google Scholar]
  37. Abedinpour, H.; Babaeian Jelodar, N.A.; Ranjbar, G.A.; Golein, B. Study of genetic diversities and relatedness of Iranian citrus genotypes using morphological and molecular markers. J. Plant Mol. Breed. 2015, 3, 35–49. [Google Scholar] [CrossRef]
  38. Caruso, M.; Smith, M.W.; Froelicher, Y.; Russo, G.; Gmitter Jr, F.G. Chapter 7–Traditional breeding. In The Genus Citrus; Talon, M., Caruso, M., Gmitter, F.G., Jr, Eds.; Woodhead Publishing: Sawston, UK, 2020; pp. 129–148. [Google Scholar] [CrossRef]
  39. Noda, T.; Daiou, K.; Mihara, T.; Murakami, H.; Nagano, Y. Efficient method for generating citrus hybrids with polyembryonic Satsuma mandarin as the female parent. Mol. Breed. 2022, 42, 51. [Google Scholar] [CrossRef]
  40. Curk, F.; Ollitrault, F.; Garcia-Lor, A.; Luro, F.; Navarro, L.; Ollitrault, P. Phylogenetic origin of limes and lemons revealed by cytoplasmic and nuclear markers. Ann. Bot. 2016, 117, 565–583. [Google Scholar] [CrossRef]
  41. Froelicher, Y.; Mouhaya, W.; Bassene, J.B.; Costantino, G.; Kamiri, M.; Luro, F.; Morillon, R.; Ollitrault, P. New universal mitochondrial PCR markers reveal new information on maternal citrus phylogeny. Tree Genet. Genomes 2011, 7, 49–61. [Google Scholar] [CrossRef]
  42. Yu, Y.; Chen, C.; Huang, M.; Yu, Q.; Du, D.; Mattia, M.R.; Gmitter, F.G. Genetic Diversity and Population Structure Analysis of Citrus Germplasm with Single Nucleotide Polymorphism Markers. J. Amer. Soc. Hort. Sci. 2018, 143, 399–408. [Google Scholar] [CrossRef]
  43. Fujii, H.; Ohta, S.; Nonaka, K.; Katayose, Y.; Matsumoto, T.; Endo, T.; Yoshioka, T.; Omura, М.; Shimada, T. Parental diagnosis of satsuma mandarin (Citrus unshiu Marc.) revealed by nuclear and cytoplasmic markers. Breed. Sci. 2016, 66, 683–691. [Google Scholar] [CrossRef]
  44. Ollitrault, P.; Curk, F.; Krueger, R. Chapter 4-Citrus taxonomy. In The Genus Citrus; Talon, M., Caruso, M., Gmitter, F.G., Jr., Eds.; Woodhead Publishing: Sawston, UK, 2020; pp. 57–81. [Google Scholar] [CrossRef]
  45. Sun, Y.L.; Kang, H.M.; Han, S.H.; Park, Y.C.; Hong, S.K. Taxonomy and phylogeny of the genus Citrus based on the nuclear ribosomal DNA its region sequence. Pak. J. Bot. 2015, 47, 95–101. [Google Scholar]
  46. Shimizu, T.; Kitajima, A.; Nonaka, K.; Yoshioka, T.; Ohta, S.; Goto, S.; Toyoda, A.; Fujiyama, A.; Mochizuki, T.; Nagasaki, Н.; et al. Hybrid Origins of Citrus Varieties Inferred from DNA Marker Analysis of Nuclear and Organelle Genomes. PLoS ONE 2016, 11, e0166969. [Google Scholar] [CrossRef]
  47. Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 39–40. [Google Scholar]
  48. Peakall, R.; Smouse, P.E. genalex 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  49. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  50. Amiryousefi, A.; Hyvönen, J.; Poczai, P. iMEC: Online Marker Efficiency Calculator. Appl. Plant Sci. 2018, 6, e1159. [Google Scholar] [CrossRef] [PubMed]
  51. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  52. Earl, D.A.; Vonholdt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2011, 4, 359–361. [Google Scholar] [CrossRef]
  53. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
  54. DARwin–Dissimilarity Analysis and Representation for Windows. Available online: https://darwin.cirad.fr/overview (accessed on 5 April 2023).
Ijms 24 08276 g001 550
Figure 1. Genetic structure among 172 citrus accessions based on SCoT data. Each colored segment represents the estimated membership fraction of each genetic cluster. The yellow color in the table indicates the most reliable K value (number of genetic clusters) in the collection.
Figure 1. Genetic structure among 172 citrus accessions based on SCoT data. Each colored segment represents the estimated membership fraction of each genetic cluster. The yellow color in the table indicates the most reliable K value (number of genetic clusters) in the collection.
Ijms 24 08276 g001
Ijms 24 08276 g002 550
Figure 2. Genetic structure among 172 citrus accessions based on InDel data. Each colored segment represents the estimated membership fraction of each genetic cluster. The yellow color in the table indicates the most reliable K value (number of genetic clusters) in the collection.
Figure 2. Genetic structure among 172 citrus accessions based on InDel data. Each colored segment represents the estimated membership fraction of each genetic cluster. The yellow color in the table indicates the most reliable K value (number of genetic clusters) in the collection.
Ijms 24 08276 g002
Ijms 24 08276 g003 550
Figure 3. Phylogenetic relationships among 172 citrus genotypes calculated by 12 SCoT and 9 InDel marker data. The numbers on the figure indicate the related branches.
Figure 3. Phylogenetic relationships among 172 citrus genotypes calculated by 12 SCoT and 9 InDel marker data. The numbers on the figure indicate the related branches.
Ijms 24 08276 g003
Table
Table 1. Genetic diversity parameters of 12 SCoT markers (N = 172).
Table 1. Genetic diversity parameters of 12 SCoT markers (N = 172).
SCOTPrimers Sequence 5′-3′NaHPICD
SCoT2CAACAATGGCTACCACCC280.330.390.26
SCoT6CAACAATGGCTACCACGC260.450.340.26
SCoT9CAACAATGGCTACCAGCA290.450.340.21
SCoT12ACGACATGGCGACCAACG350.430.350.28
SCoT13ACGACATGGCGACCATCG310.460.340.24
SCoT14ACGACATGGCGACCACGC340.430.350.27
SCoT18ACCATGGCTACCACCGCC300.480.320.84
SCoT20ACCATGGCTACCACCGCG200.380.370.93
SCoT21ACGACATGGCGACCCACA280.430.350.29
SCoT23CACCATGGCTACCACCAG200.460.330.87
SCoT31CCATGGCTACCACCGCCT220.450.340.88
SCoT36GCAACAATGGCTACCACC190.460.330.87
MEAN 26.830.430.340.52
SD 5.490.040.020.32
Na—amplicon numbers, PIC—polymorphism information content, D—discriminating power; H—genetic diversity. The background color indicates the minimum (green) and maximum (yellow) values.
Table
Table 2. Genetic diversity parameters of 9 InDel markers (N = 172).
Table 2. Genetic diversity parameters of 9 InDel markers (N = 172).
InDelPrimers Sequence 5′-3′NaHPICD
LG 1-4F: TACACAGAACCGCCAAATCA
R: TCTCCCATGAACCAGCTACC		70.360.420.94
LG 2-6F: CGCGTGTTACTTCTTGACAGA
R: CGAGGCATGTGCTTGAATAA		20.220.460.24
LG3-14F: TGCCGGGAGTCTTAAAGATG
R: CGAGATGGCCACCTAGAAAT		20.370.420.44
LG4-2F: GGGTTTCTAAGCATTTGGCCA
R: ACACTCATCTTCTCGAGCAAAGA		30.410.410.41
LG 4-3F: AAGAGGACATAAGAGGCAAGTTT
R: GCCAAGCAAAACTGATAGGG		40.470.380.86
LG 5-20F: GGCATTTGAGCTAGAAATTCGT
R: AACACTGTCAAAAGAAAACCACA		30.440.390.54
LG 7-11F: ATTTTGACACGTTCAGCCGC
R: TGGATTTTGCACTCACCCTT		110.260.450.98
LG 8-10 F: TCTGCTGACCTTGCTTACGA
R: CCCTCACAAGACAGTTGAGGA		40.480.370.83
LG 9-2F: GGTGATTTTGAGTATGAGAGGTGG
R: AGGGTAGTTTTATGATAGTTATCCACA		30.410.400.50
MEAN 4.330.380.410.64
SD 2.920.090.030.27
Na—amplicon numbers, PIC—polymorphism information content, D—discriminating power; H—genetic diversity. The background color indicates the minimum (green) and maximum (yellow) values.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kulyan, R.; Samarina, L.; Shkhalakhova, R.; Kuleshov, A.; Ukhatova, Y.; Antonova, O.; Koninskaya, N.; Matskiv, A.; Malyarovskaya, V.; Ryndin, A. InDel and SCoT Markers for Genetic Diversity Analysis in a Citrus Collection from the Western Caucasus. Int. J. Mol. Sci. 2023, 24, 8276. https://doi.org/10.3390/ijms24098276

AMA Style

Kulyan R, Samarina L, Shkhalakhova R, Kuleshov A, Ukhatova Y, Antonova O, Koninskaya N, Matskiv A, Malyarovskaya V, Ryndin A. InDel and SCoT Markers for Genetic Diversity Analysis in a Citrus Collection from the Western Caucasus. International Journal of Molecular Sciences. 2023; 24(9):8276. https://doi.org/10.3390/ijms24098276

Chicago/Turabian Style

Kulyan, Raisa, Lidiia Samarina, Ruset Shkhalakhova, Alexandr Kuleshov, Yulia Ukhatova, Olga Antonova, Natalia Koninskaya, Alexandra Matskiv, Valentina Malyarovskaya, and Alexey Ryndin. 2023. "InDel and SCoT Markers for Genetic Diversity Analysis in a Citrus Collection from the Western Caucasus" International Journal of Molecular Sciences 24, no. 9: 8276. https://doi.org/10.3390/ijms24098276

APA Style

Kulyan, R., Samarina, L., Shkhalakhova, R., Kuleshov, A., Ukhatova, Y., Antonova, O., Koninskaya, N., Matskiv, A., Malyarovskaya, V., & Ryndin, A. (2023). InDel and SCoT Markers for Genetic Diversity Analysis in a Citrus Collection from the Western Caucasus. International Journal of Molecular Sciences, 24(9), 8276. https://doi.org/10.3390/ijms24098276

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop