Co-Delivery of Ylang Ylang Oil of Cananga odorata and Oxaliplatin Using Intelligent pH-Sensitive Lipid-Based Nanovesicles for the Effective Treatment of Triple-Negative Breast Cancer
Abstract
:1. Introduction
2. Results and Discussion
2.1. GC–MS Peaks Identification in Ylang Ylang Flowers Essential Oil
2.2. Characterization of the pH-Responsive Niosomes
2.3. In Vitro Release Study
2.4. Cytotoxicity (SRB Assay)
2.5. Apoptosis Assay
2.6. RT-qPCR
2.7. Western Blotting
3. Materials and Methods
3.1. Materials
3.2. Methods
3.2.1. Extraction and Identification of Essential Oils from Cananga Odorata Flowers
3.2.2. Preparation of the pH-Responsive Niosomal Nanovesicles
3.2.3. Characterization of the Prepared pH-Responsive Niosomal Nanovesicles
3.2.4. Determination of Entrapment Efficiency % (EE) of Y-Oil and Ox in pH-Responsive Niosomal Nanovesicles
3.2.5. In Vitro Release Study
3.2.6. Cell Culture
3.2.7. Cytotoxicity Assay
3.2.8. Apoptosis Assay
3.2.9. RT-qPCR
RNA Extraction
3.2.10. cDNA Synthesis
3.2.11. qPCR
3.2.12. Western Blotting
3.2.13. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Key, T.J.; Verkasalo, P.K.; Banks, E. Epidemiology of breast cancer. Lancet Oncol. 2001, 2, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Pelley, R.J. Oxaliplatin: A new agent for colorectal cancer. Curr. Oncol. Rep. 2001, 3, 147–155. [Google Scholar] [CrossRef]
- Fahmy, S.A.; Ramzy, A.; Mandour, A.A.; Nasr, S.; Abdelnaser, A.; Bakowsky, U.; Azzazy, H.M.E.-S. PEGylated Chitosan Nanoparticles Encapsulating Ascorbic Acid and Oxaliplatin Exhibit Dramatic Apoptotic Effects against Breast Cancer Cells. Pharmaceutics 2022, 14, 407. [Google Scholar] [CrossRef]
- Berndtsson, M.; Hägg, M.; Panaretakis, T.; Havelka, A.M.; Shoshan, M.C.; Linder, S. Acute apoptosis by cisplatin requires induction of reactive oxygen species but is not associated with damage to nuclear DNA. Int. J. Cancer 2007, 120, 175–180. [Google Scholar] [CrossRef]
- Alcindor, T.; Beauger, N. Oxaliplatin: A review in the era of molecularly targeted therapy. Curr. Oncol. 2011, 18, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Kruidering, M.; Van De Water, B.; De Heer, E.; Mulder, G.J.; Nagelkerke, J.F. Cisplatin-induced nephrotoxicity in porcine proximal tubular cells: Mitochondrial dysfunction by inhibition of complexes I to IV of the respiratory chain. J. Pharmacol. Exp. Ther. 1997, 280, 638–649. [Google Scholar] [PubMed]
- Ibrahim, A.; Hirschfeld, S.; Cohen, M.H.; Griebel, D.J.; Williams, G.A.; Pazdur, R. FDA drug approval summaries: Oxaliplatin. Oncologist 2004, 9, 8–12. [Google Scholar] [CrossRef] [PubMed]
- Grothey, A.; Goldberg, R.M. A review of oxaliplatin and its clinical use in colorectal cancer. Expert Opin. Pharmacother. 2004, 5, 2159–2170. [Google Scholar] [CrossRef]
- McWhinney, S.R.; Goldberg, R.M.; McLeod, H.L. Platinum neurotoxicity pharmacogenetics. Mol. Cancer Ther. 2009, 8, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Herz, R.S. Aromatherapy facts and fictions: A scientific analysis of olfactory effects on mood, physiology and behavior. Int. J. Neurosci. 2009, 119, 263–290. [Google Scholar] [CrossRef]
- Sadgrove, N.; Jones, G. A Contemporary Introduction to Essential Oils: Chemistry, Bioactivity and Prospects for Australian Agriculture. Agriculture 2015, 5, 48–102. [Google Scholar] [CrossRef]
- Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essential oils—A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef] [PubMed]
- Memon, A.; Kim, B.Y.; Kim, S.-E.; Pyao, Y.; Lee, Y.-G.; Kang, S.C.; Lee, W.K. Anti-Inflammatory Effect of Phytoncide in an Animal Model of Gastrointestinal Inflammation. Molecules 2021, 26, 1895. [Google Scholar] [CrossRef] [PubMed]
- Strub, D.J.; Talma, M.; Strub, M.; Rut, W.; Zmudzinski, M.; Brud, W.; Neyts, J.; Vangeel, L.; Zhang, L.; Sun, X.; et al. Evaluation of the anti-SARS-CoV-2 properties of essential oils and aromatic extracts. Sci. Rep. 2022, 12, 14230. [Google Scholar] [CrossRef] [PubMed]
- Raut, J.S.; Karuppayil, S.M. A status review on the medicinal properties of essential oils. Ind. Crops Prod. 2014, 62, 250–264. [Google Scholar] [CrossRef]
- Sharma, M.; Grewal, K.; Jandrotia, R.; Batish, D.R.; Singh, H.P.; Kohli, R.K. Essential oils as anticancer agents: Potential role in malignancies, drug delivery mechanisms, and immune system enhancement. Biomed. Pharmacother. 2022, 146, 112514. [Google Scholar] [CrossRef]
- Al-Otaibi, W.A.; AlMotwaa, S.M. Oxaliplatin-loaded nanoemulsion containing Teucrium polium L. essential oil induces apoptosis in Colon cancer cell lines through ROS-mediated pathway. Drug Deliv. 2022, 29, 2190–2205. [Google Scholar] [CrossRef]
- Núñez, J.G.; Pinheiro, J.S.; Padilha, G.L.; Garcia, H.O.; Porta, V.; Apel, M.A.; Bruno, A.N. Antineoplastic potential and chemical evaluation of essential oils from leaves and flowers of Tagetes ostenii Hicken. An. Acad. Bras. Ciências 2020, 92 (Suppl. S2), e20191143. [Google Scholar] [CrossRef]
- Zhang, Y.; Peng, F.; Yu, C. Therapeutic potential of Curcuma oil and its terpenoids in gynecological cancers. Biomed Pharm. 2023, 157, 114016. [Google Scholar] [CrossRef]
- Goodrich, K.R. Floral scent in Annonaceae. Bot. J. Linn. Soc. 2012, 169, 262–279. [Google Scholar] [CrossRef]
- Tan, L.T.H.; Lee, L.H.; Yin, W.F.; Chan, C.K.; Abdul Kadir, H.; Chan, K.G.; Goh, B.H. Traditional uses, phytochemistry, and bioactivities of Cananga odorata (Ylang-Ylang). Evid.-Based Complement. Altern. Med. 2015, 2015, 896314. [Google Scholar] [CrossRef] [PubMed]
- Indrasetiawan, P.; Aoki-Utsubo, C.; Hanafi, M.; Hartati, S.; Wahyuni, T.S.; Kameoka, M.; Yano, Y.; Hotta, H.; Hayashi, Y. Antiviral activity of cananga odorata against hepatitis B virus. Kobe J. Med. Sci. 2019, 65, E71. [Google Scholar] [PubMed]
- Ahmad, I.; Beg, A.Z. Antimicrobial and phytochemical studies on 45 Indian medicinal plants against multi-drug resistant human pathogens. J. Ethnopharmacol. 2001, 74, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Nguyen-Pouplin, J.; Tran, H.; Tran, H.; Phan, T.A.; Dolecek, C.; Farrar, J.; Tran, T.H.; Caron, P.; Bodo, B.; Grellier, P. Antimalarial and cytotoxic activities of ethnopharmacologically selected medicinal plants from South Vietnam. J. Ethnopharmacol. 2007, 109, 417–427. [Google Scholar] [CrossRef] [PubMed]
- Kusuma, I.W.; Arung, E.T.; Kim, Y.-U. Antimicrobial and antioxidant properties of medicinal plants used by the Bentian tribe from Indonesia. Food Sci. Hum. Wellness 2014, 3, 191–196. [Google Scholar] [CrossRef]
- Pujiarti, R.; Ohtani, Y.; Widowati, T.B.; Wahyudi, W.; Kasmudjo, K.; Herath, N.K.; Wang, C.N. Effect of Melaleuca leucadendron, Cananga odorata and Pogostemon cablin oil odors on human physiological responses. Wood Res. J. 2012, 3, 100–105. [Google Scholar] [CrossRef]
- Li, Y.; Zidorn, C. Seasonal variations of natural products in European herbs. Phytochem. Rev. 2022, 21, 1549–1575. [Google Scholar] [CrossRef]
- Chakira, A.; Garcia, C.; Soria, C.; Minier, J.; Chillet, M. Effect of Flower Development Stages on the Dynamics of Volatile Compounds in Ylang-Ylang (Cananga odorata) Essential Oil. Horticulturae 2022, 8, 986. [Google Scholar] [CrossRef]
- Amiel, E.; Ofir, R.; Dudai, N.; Soloway, E.; Rabinsky, T.; Rachmilevitch, S. β-Caryophyllene, a compound isolated from the biblical balm of gilead (Commiphora gileadensis), is a selective apoptosis inducer for tumor cell lines. Evid.-Based Complement. Altern. Med. 2012, 2012, 872394. [Google Scholar] [CrossRef]
- Ashour, M.L.; El-Readi, M.; Youns, M.; Mulyaningsih, S.; Sporer, F.; Efferth, T.; Wink, M. Chemical composition and biological activity of the essential oil obtained from Bupleurum marginatum (Apiaceae). J. Pharm. Pharmacol. 2009, 61, 1079–1087. [Google Scholar] [CrossRef]
- Woo, S.H.; Reynolds, M.C.; Sun, N.J.; Cassady, J.M.; Snapka, R.M. Inhibition of topoisomerase II by liriodenine. Biochem. Pharmacol. 1997, 54, 467–473. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, T.J.; Chang, F.R.; Chia, Y.C.; Chen, C.Y.; Chiu, H.F.; Wu, Y.C. Cytotoxic constituents of the fruits of Cananga odorata. J. Nat. Prod. 2001, 64, 616–619. [Google Scholar] [CrossRef] [PubMed]
- Youness, R.A.; Al-Mahallawi, A.M.; Mahmoud, F.H.; Atta, H.; Braoudaki, M.; Fahmy, S.A. Oral Delivery of Psoralidin by Mucoadhesive Surface-Modified Bilosomes Showed Boosted Apoptotic and Necrotic Effects against Breast and Lung Cancer Cells. Polymers 2023, 15, 1464. [Google Scholar] [CrossRef] [PubMed]
- Fahmy, S.A.; Mahdy, N.K.; Al Mulla, H.; ElMeshad, A.N.; Issa, M.Y.; Azzazy, H.M.E.-S. PLGA/PEG nanoparticles loaded with cyclodextrin-Peganum harmala alkaloid complex and ascorbic acid with promising antimicrobial activities. Pharmaceutics 2022, 14, 142. [Google Scholar] [CrossRef]
- Fahmy, S.A.; Ponte, F.; Fawzy, I.M.; Sicilia, E.; Azzazy, H.M.E.-S. Betaine host–guest complexation with a calixarene receptor: Enhanced in vitro anticancer effect. RSC Adv. 2021, 11, 24673–24680. [Google Scholar] [CrossRef]
- Fahmy, S.A.; Issa, M.Y.; Saleh, B.M.; Meselhy, M.R.; Azzazy, H.M.E.-S. Peganum harmala alkaloids self-assembled supramolecular nanocapsules with enhanced antioxidant and cytotoxic activities. ACS Omega 2021, 6, 11954–11963. [Google Scholar] [CrossRef]
- Azzazy, H.M.E.-S.; Sawy, A.M.; Abdelnaser, A.; Meselhy, M.R.; Shoeib, T.; Fahmy, S.A. Peganum harmala Alkaloids and Tannic Acid Encapsulated in PAMAM Dendrimers: Improved Anticancer Activities as Compared to Doxorubicin. ACS Appl. Polym. Mater. 2022, 4, 7228–7239. [Google Scholar] [CrossRef]
- Fahmy, S.A.; Ramzy, A.; Sawy, A.M.; Nabil, M.; Gad, M.Z.; El-Shazly, M.; Aboul-Soud, M.A.M.; Azzazy, H.M.E.-S. Ozonated Olive Oil: Enhanced Cutaneous Delivery via Niosomal Nanovesicles for Melanoma Treatment. Antioxidants 2022, 11, 1318. [Google Scholar] [CrossRef]
- Witika, B.A.; Bassey, K.E.; Demana, P.H.; Siwe-Noundou, X.; Poka, M.S. Current advances in specialised niosomal drug delivery: Manufacture, characterization and drug delivery applications. Int. J. Mol. Sci. 2022, 23, 9668. [Google Scholar] [CrossRef]
- Yuge, G.; Hanbin, W.; Yan, Z.; LI, L. Research progress on the mechanisms of chemotherapy resistance to glioblastoma in-duced by hypoxia microenvironment. Chin. J. Clin. Oncol. 2017, 24, 1100–1103. [Google Scholar]
- Hafez, I.M.; Cullis, P.R. Cholesteryl hemisuccinate exhibits pH sensitive polymorphic phase behavior. Biochim. Biophys. Acta-Biomembr. 2000, 1463, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Tambe, E.; Gotmare, S. FTIR & GC-MS analysis of Ylang Ylang oil, comparative study of its chemical composition and concern regarding diethyl phthalate. Int. Res. J. Sci. Eng. Technol. 2020, 10, 35–48. [Google Scholar]
- Guo, X.L.; Kang, X.X.; Wang, Y.Q.; Zhang, X.J.; Li, C.J.; Liu, Y.; Du, L.B. Co-delivery of cisplatin and doxorubicin by covalently conjugating with polyamidoamine dendrimer for enhanced synergistic cancer therapy. Acta Biomater. 2019, 84, 367–377. [Google Scholar] [CrossRef]
- Azzazy, H.M.E.-S.; Abdelnaser, A.; Al Mulla, H.; Sawy, A.M.; Shamma, S.N.; Elhusseiny, M.; Alwahibi, S.; Mahdy, N.K.; Fahmy, S.A. Essential Oils Extracted from Boswellia sacra Oleo Gum Resin Loaded into PLGA–PCL Nanoparticles: Enhanced Cytotoxic and Apoptotic Effects against Breast Cancer Cells. ACS Omega 2022, 8, 1017–1025. [Google Scholar] [CrossRef] [PubMed]
- Fahmy, S.A.; Fawzy, I.M.; Saleh, B.M.; Issa, M.Y.; Bakowsky, U.; Azzazy, H.M.E.-S. Green synthesis of platinum and palladium nanoparticles using Peganum harmala L. seed alkaloids: Biological and computational studies. Nanomaterials 2021, 11, 965. [Google Scholar] [CrossRef]
- Detroja, C.; Chavhan, S.; Sawant, K. Enhanced antihypertensive activity of candesartan cilexetil nanosuspension: Formulation, characterization and pharmacodynamic study. Sci. Pharm. 2011, 79, 635–652. [Google Scholar] [CrossRef]
- Jadon, P.S.; Gajbhiye, V.; Jadon, R.S.; Gajbhiye, K.R.; Ganesh, N. Enhanced oral bioavailability of griseofulvin via niosomes. AAPS Pharmscitech 2009, 10, 1186–1192. [Google Scholar] [CrossRef]
- Chou, T.-C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. J. Pharmacol. Rev. 2006, 58, 621–681. [Google Scholar] [CrossRef] [PubMed]
- Shi, Q.; Tang, J.; Wang, L.; Liu, R.; Giesy, J.P. Combined cytotoxicity of polystyrene nanoplastics and phthalate esters on human lung epithelial A549 cells and its mechanism. Ecotoxicol. Environ. Saf. 2021, 213, 112041. [Google Scholar] [CrossRef]
- Powers, C.N.; Osier, J.L.; McFeeters, R.L.; Brazell, C.B.; Olsen, E.L.; Moriarity, D.M.; Satyal, P.; Setzer, W.N. Antifungal and cytotoxic activities of sixty commercially-available essential oils. Molecules 2018, 23, 1549. [Google Scholar] [CrossRef]
- Malgi, A.P.; Rasal, V.P.; Patil, V.S.; Patil, P.P.; Mallapur, S.P.; Hupparage, V.B.; Patil, S.A. Anticancer activity of ylang-ylang essential oil in Ehrlich Ascites Carcinoma cell-treated mice. Int. J. Res. Pharm. Sci. 2020, 11, 5752–5762. [Google Scholar] [CrossRef]
- Bendaoud, H.; Romdhane, M.; Souchard, J.P.; Cazaux, S.; Bouajila, J. Chemical composition and anticancer and antioxidant activities of Schinus molle L. and Schinus terebinthifolius Raddi berries essential oils. J. Food Sci. 2010, 75, C466–C472. [Google Scholar] [CrossRef] [PubMed]
- Andreidesz, K.; Koszegi, B.; Kovacs, D.; Vantus, V.B.; Gallyas, F.; Kovacs, K. Effect of oxaliplatin, olaparib and LY294002 in combination on triple-negative breast cancer cells. Int. J. Mol. Sci. 2021, 22, 2056. [Google Scholar] [CrossRef] [PubMed]
- William-Faltaos, S.; Rouillard, D.; Lechat, P.; Bastian, G. Cell cycle arrest and apoptosis induced by oxaliplatin (L-OHP) on four human cancer cell lines. Anticancer. Res. 2006, 26, 2093–2099. [Google Scholar] [PubMed]
- Pargi, M.; Jain Raviraj, S.K.; Narayanappa, P.; Urumarudappa, S.K.J.; Malleshappa, P.; Malleshappa, K.H. Antiproliferative effects of Artabotrys odoratissimus fruit extract and its bioactive fraction through upregulation of p53/γH2AX signals and G2/M phase arrest in MIA PaCa-2 cells. Anti-Cancer Agents Med. Chem. 2022, 22, 2998–3008. [Google Scholar]
- Gross, A.; McDonnell, J.M.; Korsmeyer, S.J. BCL-2 family members and the mitochondria in apoptosis. Genes Dev. 1999, 13, 1899–1911. [Google Scholar] [CrossRef]
- Ohtsuka, T.; Ryu, H.; Minamishima, Y.A.; Macip, S.; Sagara, J.; Nakayama, K.I.; Aaronson, S.A.; Lee, S.W. ASC is a Bax adaptor and regulates the p53–Bax mitochondrial apoptosis pathway. Nat. Cell Biol. 2004, 6, 121–128. [Google Scholar] [CrossRef]
- Radogna, F.; Cristofanon, S.; Paternoster, L.; D’alessio, M.; De Nicola, M.; Cerella, C.; Dicato, M.; Diederich, M.; Ghibelli, L. Melatonin antagonizes the intrinsic pathway of apoptosis via mitochondrial targeting of Bcl-2. J. Pineal Res. 2008, 44, 316–325. [Google Scholar] [CrossRef]
- Liang, Y.; Yan, C.; Schor, N.F. Apoptosis in the absence of caspase 3. Oncogene 2001, 20, 6570–6578. [Google Scholar] [CrossRef]
- Finucane, D.M.; Bossy-Wetzel, E.; Waterhouse, N.J.; Cotter, T.G.; Green, D.R. Bax-induced caspase activation and apoptosis via cytochromec release from mitochondria is inhibitable by Bcl-xL. J. Biol. Chem. 1999, 274, 2225–2233. [Google Scholar] [CrossRef]
- Liu, H.; Cheng, X.-H. MiR-29b reverses oxaliplatin-resistance in colorectal cancer by targeting SIRT1. Oncotarget 2018, 9, 12304. [Google Scholar] [CrossRef] [PubMed]
- Liao, B.; Zhang, Y.; Sun, Q.; Jiang, P. Vorinostat enhances the anticancer effect of oxaliplatin on hepatocellular carcinoma cells. Cancer Med. 2018, 7, 196–207. [Google Scholar] [CrossRef] [PubMed]
- Samed, N.; Sharma, V.; Sundaramurthy, A. Hydrogen bonded niosomes for encapsulation and release of hydrophilic and hydrophobic anti-diabetic drugs: An efficient system for oral anti-diabetic formulation. Appl. Surf. Sci. 2018, 449, 567–573. [Google Scholar] [CrossRef]
- Chen, M.-X.; Li, T.; Peng, S.; Tao, D. Supramolecular nanocapsules from the self-assembly of amphiphilic calixarene as a carrier for paclitaxel. New J. Chem. 2016, 40, 9923–9929. [Google Scholar] [CrossRef]
- Qiu, L.; Jing, N.; Jin, Y. Preparation and in vitro evaluation of liposomal chloroquine diphosphate loaded by a transmembrane pH-gradient method. Int. J. Pharm. 2008, 361, 56–63. [Google Scholar] [CrossRef] [PubMed]
Peak No. | Compound Name | RT (min) | RI | Average % (SD) |
---|---|---|---|---|
Alcohols | ||||
1. | Benzyl alcohol | 9.90 | 1031.9 | 2.03 (0.51) |
2. | 2-(2-Hydroxypropoxy)-1-propanol | 10.16 | 1044.8 | 0.72 (0.21) |
3. | 2,2’-oxybis-1-propanol | 10.34 | 1053.1 | 0.68 (0.04) |
4. | β-Linalool | 12.16 | 1105.3 | 9.15 (1.48) |
5. | Phenylethyl Alcohol | 12.58 | 1115.3 | 0.22 (0.12) |
6. | α-Cedrol | 28.69 | 1593.3 | 2.28 (0.60) |
7. | Spathulenol | 29.09 | 1616.7 | 0.14 (0.00) |
8. | α-Cadinol | 30.95 | 1642.4 | 0.22 (0.03) |
Total alcohols | 15.44 | |||
Esters | ||||
9. | Benzyl formate | 11.33 | 1078.5 | 0.21 (0.18) |
10. | Methyl benzoate | 11.93 | 1089.8 | 1.40 (0.45) |
11. | Benzyl acetate | 14.38 | 1175.2 | 10.47 (2.03) |
12. | Methyl salicylate | 15.39 | 1194.2 | 0.17 (0.04) |
13. | Linalyl acetate | 17.49 | 1254.8 | 3.22 (0.90) |
14. | Geranyl acetate | 21.69 | 1379 | 0.39 (0.05) |
15. | Nopyl acetate | 22.98 | 1427.2 | 2.71 (0.45) |
16. | Cinnamyl acetate | 23.59 | 1438.6 | 0.22 (0.05) |
17. | Benzyl Benzoate | 35.89 | 1767.3 | 0.95 (0.08) |
18. | Farnesyl acetate | 38.9 | 1839.9 | 0.48 (0.27) |
19. | Benzyl salicylate | 39.64 | 1862.5 | 0.30 (0.07) |
Total esters | 20.52 | |||
Phthalate esters | ||||
20. | Diethyl Phthalate | 28.62 | 1584.2 | 29.08 (2.67) |
Total glycerols | 29.08 | |||
Monoterpene hydrocarbons | ||||
21. | Limonene | 9.68 | 1029.5 | 0.61 (0.04) |
22. | Allo-Ocimene | 13.12 | 1129.6 | 0.21 (0.03) |
23. | (4E,6Z)-Allo-Ocimene (Neo-allo-ocimene) | 13.55 | 1140.2 | 0.16 (0.06) |
Total monoterpene hydrocarbons | 0.98 | |||
Phenols/ethers | ||||
24. | p-Methyl anisole | 9.41 | 978.2 | 1.47 (0.12) |
25. | Bis(2-hydroxypropyl) ether | 9.55 | 994.8 | 0.48 (0.01) |
26. | Estragole | 15.52 | 1199.6 | 0.51 (0.03) |
27. | Eugenol | 20.85 | 1358.5 | 0.96 (0.07) |
28. | Methyleugenol | 22.37 | 1408.8 | 0.60 (0.15) |
Total phenols/ethers | 4.02 | |||
Sesquiterpene hydrocarbons | ||||
29. | α-Cubebene | 20.59 | 1352 | 0.05 (0.03) |
30. | α-Copaene | 21.45 | 1375.2 | 0.59 (0.03) |
31. | β-Elemene | 21.97 | 1391.6 | 0.17 (0.02) |
32. | Cyperene | 22.2 | 1403.5 | 0.94 (0.26) |
33. | α-Gurjunene | 22.57 | 1410.3 | 11.04 (2.79) |
34. | α-Cedrene | 22.62 | 1413.3 | 0.80 (0.12) |
35. | β-Caryophyllene | 22.84 | 1425.5 | 0.88 (0.27) |
36. | Thujopsene | 23.2 | 1429.5 | 6.83 (1.22) |
37. | Humulene | 23.9 | 1444.7 | 0.21 (0.00) |
38. | Aromandendrene | 24.13 | 1454.5 | 2.45 (0.08) |
39. | γ-Gurjunene | 24.48 | 1471.4 | 1.08 (0.29) |
40. | γ-Muurolene | 24.61 | 1478.3 | 0.35 (0.07) |
41. | Germacrene D | 24.74 | 1481 | 0.22 (0.03) |
42. | Ledene | 25.17 | 1492.2 | 0.33 (0.05) |
43. | α-Muurolene | 25.32 | 1498.1 | 0.15 (0.01) |
44. | Cuparene | 25.49 | 1504.3 | 0.23 (0.15) |
45. | (E,E)-α-Farnesene | 25.54 | 1506.9 | 0.13 (0.04) |
46. | γ-Cadinene | 25.74 | 1509.2 | 0.13 (0.03) |
47. | δ-Cadinene | 26.02 | 1525.8 | 0.75 (0.06) |
Total sesquiterpene hydrocarbons | 27.33 | |||
Others | ||||
48. | Piperonal | 20.03 | 1330.8 | 0.21 (0.03) |
49. | 1,2-Diacetin | 20.68 | 1356.1 | 0.11 (0.00) |
50. | Caryophyllene oxide | 27.97 | 1576.4 | 0.15 (0.11) |
51. | Unidentified | 37.98 | 1812.4 | 0.20 (0.02) |
52. | Benzylidene camphor | 41.65 | 1914.5 | 1.96 (0.27) |
Total volatiles | 100 |
Samples | Mean Particle Size (nm) | PDI | Zeta-Potential (mV) | EE (%) | |
---|---|---|---|---|---|
Y-oil | Ox | ||||
Plain NSs | 94.16 ± 19.0 | 0.12 ± 0.03 | −12.37 ± 1.7 | - | - |
Y@NSs | 129.72 ± 15.5 | 0.16 ± 0.02 | −14.65 ± 1.5 | 93.1 ± 6.1 | - |
Ox@NSs | 126.93 ± 12.5 | 0.15 ± 0.02 | −10.53 ± 1.1 | - | 83.9 ± 4.3 |
Ox-Y@NSs | 159.34 ± 16.9 | 0.19 ± 0.05 | −13.31 ± 1.9 | 91.6 ± 7.5 | 81.1 ± 5.8 |
Sample | IC50 on MDA-MB231 Cell Line # (µg/mL) |
---|---|
Blank NSs | 184.63 |
Y-oil | 29.01 |
Y@NSs | 18.39 |
Ox | 0.05 |
Ox@NSs | 0.006 |
Ox-Y@NSs | 0.0002 |
Apoptotic Stage | Percent Cell Population | |||
---|---|---|---|---|
Control | Ox | Y-Oil | Ox-Y@NSs | |
Necrosis (Q2-1) | 0.58 ± 0.13 | * 1.93 ± 0.59 | ** 2.13 ± 0.19 | ** 5.06 ± 1.14 |
Late apoptosis (Q2-2) | 1.29 ± 0.24 | *** 7.33 ± 0.7 | * 2.3 ± 0.32 | *** 8.38 ± 0.83 |
Viable cells (Q2-3) | 98.02 ± 0.07 | *** 90.29 ± 1.29 | ** 95.45 ± 0.42 | *** 86.34 ± 1.49 |
Early apoptosis (Q2-4) | 0.11 ± 0.02 | *** 0.44 ± 0.03 | 0.11 ± 0.06 | * 0.22 ± 0.06 |
Reaction Component | Amount |
---|---|
RNA | 1 µg |
Random Hexamers | 2.5 µL (from 100 µM stock) |
5X Enzyme Buffer | 5 µL |
dNTP | 1.7 µL (from 40 mM stock) |
AMV-RT (20U) | 2 µL |
RNase free water | XX |
Total volume | 25 µL |
Primer ID | Primer Sequence (5′-3′) | Company |
---|---|---|
β-actin F | CACCATTGGCAATGAGCGGTTC | Metabion International AG |
β-actin R | AGGTCTTTGCGGATGTCCACGT | |
Bax F | TCAGGATGCGTCCACCAAGAAG | |
Bax R | TGTGTCCACGGCGGCAATCATC | |
Bcl-2 F | ATCGCCCTGTGGATGACTGAGT | |
Bcl-2 R | GCCAGGAGAAATCAAACAGAGGC | |
Caspase-7 F | CGGAACAGACAAAGATGCCGAG | |
Caspase-7 R | AGGCGGCATTTGTATGGTCCTC | |
TP53 F | CCTCAGCATCTTATCCGAGTGG | |
TP53 R | TGGATGGTGGTACAGTCAGAGC |
qPCR Reaction Component | Amount |
---|---|
Qiagen Master Mix 2X | 10 µL |
F primer (10 µM) | 1 µL |
R primer (10 µM) | 1 µL |
cDNA | 100 ng |
Complete with RNase free H2O | X |
Total volume | 20 µL |
Ab | Species | Dilution Used | Catalog Number | Company |
---|---|---|---|---|
Caspase-7 | Rabbit | 1:1000 | #9492T | Cell Signaling |
B-actin | Rabbit | 1:1000 | #4970 | |
Anti-rabbit IgG, HRP-linked | Goat | 1:3000 | #7074P2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sedky, N.K.; Abdel-Kader, N.M.; Issa, M.Y.; Abdelhady, M.M.M.; Shamma, S.N.; Bakowsky, U.; Fahmy, S.A. Co-Delivery of Ylang Ylang Oil of Cananga odorata and Oxaliplatin Using Intelligent pH-Sensitive Lipid-Based Nanovesicles for the Effective Treatment of Triple-Negative Breast Cancer. Int. J. Mol. Sci. 2023, 24, 8392. https://doi.org/10.3390/ijms24098392
Sedky NK, Abdel-Kader NM, Issa MY, Abdelhady MMM, Shamma SN, Bakowsky U, Fahmy SA. Co-Delivery of Ylang Ylang Oil of Cananga odorata and Oxaliplatin Using Intelligent pH-Sensitive Lipid-Based Nanovesicles for the Effective Treatment of Triple-Negative Breast Cancer. International Journal of Molecular Sciences. 2023; 24(9):8392. https://doi.org/10.3390/ijms24098392
Chicago/Turabian StyleSedky, Nada K., Nour M. Abdel-Kader, Marwa Y. Issa, Manal M. M. Abdelhady, Samir N. Shamma, Udo Bakowsky, and Sherif Ashraf Fahmy. 2023. "Co-Delivery of Ylang Ylang Oil of Cananga odorata and Oxaliplatin Using Intelligent pH-Sensitive Lipid-Based Nanovesicles for the Effective Treatment of Triple-Negative Breast Cancer" International Journal of Molecular Sciences 24, no. 9: 8392. https://doi.org/10.3390/ijms24098392