Immunostimulatory Effect of Flagellin on MDR-Klebsiella-Infected Human Airway Epithelial Cells
Abstract
:1. Introduction
2. Results
2.1. Flagellin and Meropenem Induce the Expression of Antimicrobial Proteins in MDR-Kpneu-Infected HBE Cells
2.2. Flagellin and Meropenem Induce the Secretion of Inflammatory Mediators by MDR-Kpneu-Infected HBE Cells
2.3. Secretion of Inflammatory Mediators by HBE Cells Activates Polymorphonuclear Cells and Monocytes
3. Discussion
4. Materials and Methods
4.1. HBE Cell Culture
4.2. Treatment of HBE Cells
4.3. ELISA
4.4. mRNA Analysis
4.5. Peripheral Blood Leukocyte Activation
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kyu, H.H.; Vongpradith, A.; Sirota, S.B.; Novotney, A.; Troeger, C.E.; Doxey, M.C.; Bender, R.G.; Ledesma, J.R.; Biehl, M.H.; Albertson, S.B.; et al. Age–Sex Differences in the Global Burden of Lower Respiratory Infections and Risk Factors, 1990–2019: Results from the Global Burden of Disease Study 2019. Lancet Infect. Dis. 2022, 22, 1626–1647. [Google Scholar] [CrossRef] [PubMed]
- Torres, A.; Cilloniz, C.; Niederman, M.S.; Menéndez, R.; Chalmers, J.D.; Wunderink, R.G.; van der Poll, T. Pneumonia. Nat. Rev. Dis. Prim. 2021, 7, 25. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Huh, K.; Chung, D.R. Community-Acquired Pneumonia in the Asia-Pacific Region. Semin. Respir. Crit. Care Med. 2016, 37, 839–854. [Google Scholar] [CrossRef] [PubMed]
- Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Robles Aguilar, G.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [PubMed]
- Hewitt, R.J.; Lloyd, C.M. Regulation of Immune Responses by the Airway Epithelial Cell Landscape. Nat. Rev. Immunol. 2021, 21, 347–362. [Google Scholar] [CrossRef]
- Invernizzi, R.; Lloyd, C.M.; Molyneaux, P.L. Respiratory Microbiome and Epithelial Interactions Shape Immunity in the Lungs. Immunology 2020, 160, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Hiemstra, P.S.; Tetley, T.D.; Janes, S.M. Airway and Alveolar Epithelial Cells in Culture. Eur. Respir. J. 2019, 54, 1900742. [Google Scholar] [CrossRef] [PubMed]
- Fulcher, M.L.; Randell, S.H. Human Nasal and Tracheo-Bronchial Respiratory Epithelial Ell Culture. In Epithelial Cell Culture Protocols; Humana Press: Totowa, NJ, USA, 2012; pp. 109–121. [Google Scholar] [CrossRef]
- Leiva-Juárez, M.M.; Kolls, J.K.; Evans, S.E. Lung Epithelial Cells: Therapeutically Inducible Effectors of Antimicrobial Defense. Mucosal Immunol. 2018, 11, 21–34. [Google Scholar] [CrossRef]
- Vijayan, A.; Rumbo, M.; Carnoy, C.; Sirard, J.C. Compartmentalized Antimicrobial Defenses in Response to Flagellin. Trends Microbiol. 2018, 26, 423–435. [Google Scholar] [CrossRef]
- Tseng, J.; Do, J.; Widdicombe, J.H.; Machen, T.E. Innate Immune Responses of Human Tracheal Epithelium to Pseudomonas Aeruginosa Flagellin, TNF-α, and IL-1β. Am. J. Physiol. Cell Physiol. 2006, 290, 678–690. [Google Scholar] [CrossRef]
- Ramirez-Moral, I.; Yu, X.; Butler, J.M.; van Weeghel, M.; Otto, N.A.; Ferreira, B.L.; Van Maele, L.; Sirard, J.C.; de Vos, A.F.; de Jong, M.D.; et al. MTOR-Driven Glycolysis Governs Induction of Innate Immune Responses by Bronchial Epithelial Cells Exposed to the Bacterial Component Flagellin. Mucosal Immunol. 2021, 14, 594–604. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Louboutin, J.P.; Weiner, D.J.; Goldberg, J.B.; Wilson, J.M. Human Airway Epithelial Cells Sense Pseudomonas Aeruginosa Infection via Recognition of Flagellin by Toll-like Receptor 5. Infect. Immun. 2005, 73, 7151–7160. [Google Scholar] [CrossRef] [PubMed]
- Van Maele, L.; Fougeron, D.; Janot, L.; Didierlaurent, A.; Cayet, D.; Tabareau, J.; Rumbo, M.; Corvo-Chamaillard, S.; Boulenouar, S.; Jeffs, S.; et al. Airway Structural Cells Regulate TLR5-Mediated Mucosal Adjuvant Activity. Mucosal Immunol. 2014, 7, 489–500. [Google Scholar] [CrossRef] [PubMed]
- Janot, L.; Sirard, J.C.; Secher, T.; Noulin, N.; Fick, L.; Akira, S.; Uematsu, S.; Didierlaurent, A.; Hussell, T.; Ryffel, B.; et al. Radioresistant Cells Expressing TLR5 Control the Respiratory Epithelium’s Innate Immune Responses to Flagellin. Eur. J. Immunol. 2009, 39, 1587–1596. [Google Scholar] [CrossRef] [PubMed]
- Siemieniuk, R.A.C.; Meade, M.O.; Alonso-Coello, P.; Briel, M.; Evaniew, N.; Prasad, M.; Alexander, P.E.; Fei, Y.; Vandvik, P.O.; Loeb, M.; et al. Corticosteroid Therapy for Patients Hospitalized With Community-Acquired Pneumonia: A Systematic Review and Meta-Analysis. Ann. Intern. Med. 2015, 163, 519–528. [Google Scholar] [CrossRef] [PubMed]
- Matarazzo, L.; Casilag, F.; Porte, R.; Wallet, F.; Cayet, D.; Faveeuw, C.; Carnoy, C.; Sirard, J.C. Therapeutic Synergy between Antibiotics and Pulmonary Toll-like Receptor 5 Stimulation in Antibiotic-Sensitive or -Resistant Pneumonia. Front. Immunol. 2019, 10, 723. [Google Scholar] [CrossRef] [PubMed]
- Porte, R.; Fougeron, D.; Muñoz-Wolf, N.; Tabareau, J.; Georgel, A.F.; Wallet, F.; Paget, C.; Trottein, F.; Chabalgoity, J.A.; Carnoy, C.; et al. A Toll-like Receptor 5 Agonist Improves the Efficacy of Antibiotics in Treatment of Primary and Influenza Virus-Associated Pneumococcal Mouse Infections. Antimicrob. Agents Chemother. 2015, 59, 6064–6072. [Google Scholar] [CrossRef]
- Baldwin, C.M.; Lyseng-Williamson, K.A.; Keam, S.J. Meropenem: A Review of Its Use in the Treatment of Serious Bacterial Infections. Drugs 2008, 68, 803–838. [Google Scholar] [CrossRef]
- Achouiti, A.; Vogl, T.; Urban, C.F.; Röhm, M.; Hommes, T.J.; van Zoelen, M.A.D.; Florquin, S.; Roth, J.; van ’t Veer, C.; de Vos, A.F.; et al. Myeloid-Related Protein-14 Contributes to Protective Immunity in Gram-Negative Pneumonia Derived Sepsis. PLoS Pathog. 2012, 8, e1002987. [Google Scholar] [CrossRef]
- Kotsiou, O.S.; Papagiannis, D.; Papadopoulou, R.; Gourgoulianis, K.I. Calprotectin in Lung Diseases. Int. J. Mol. Sci. 2021, 22, 1706. [Google Scholar] [CrossRef]
- Wang, J.E.; JØrgensen, P.F.; Almlöf, M.; Thiemermann, C.; Foster, S.J.; Aasen, A.O.; Solberg, R. Peptidoglycan and Lipoteichoic Acid from Staphylococcus Aureus Induce Tumor Necrosis Factor Alpha, Interleukin 6 (IL-6), and IL-10 Production in Both T Cells and Monocytes in a Human Whole Blood Model. Infect. Immun. 2000, 68, 3965–3970. [Google Scholar] [CrossRef] [PubMed]
- Paczosa, M.K.; Mecsas, J. Klebsiella Pneumoniae: Going on the Offense with a Strong Defense. Microbiol. Mol. Biol. Rev. 2016, 80, 629–661. [Google Scholar] [CrossRef] [PubMed]
- Hoogerwerf, J.J.; De Vos, A.F.; Bresser, P.; Van Der Zee, J.S.; Pater, J.M.; De Boer, A.; Tanck, M.; Lundell, D.L.; Her-Jenh, C.; Draing, C.; et al. Lung Inflammation Induced by Lipoteichoic Acid or Lipopolysaccharide in Humans. Am. J. Respir. Crit. Care Med. 2008, 178, 34–41. [Google Scholar] [CrossRef] [PubMed]
- Moranta, D.; Regueiro, V.; March, C.; Llobet, E.; Margareto, J.; Larrate, E.; Garmendia, J.; Bengoechea, J.A. Klebsiella Pneumoniae Capsule Polysaccharide Impedes the Expression of β-Defensins by Airway Epithelial Cells. Infect. Immun. 2010, 78, 1135–1146. [Google Scholar] [CrossRef] [PubMed]
- Mondemé, M.; Carnoy, C.; Sirard, J.C.; Faveeuw, C. Treatment of Bacterial Infections with B-Lactams: Cooperation with Innate Immunity. Infect. Immun. 2023, 91, e0050322. [Google Scholar] [CrossRef] [PubMed]
- Liang, M.D.; Bagchi, A.; Warren, H.S.; Tehan, M.M.; Trigilio, J.A.; Beasley-Topliffe, L.K.; Tesini, B.L.; Lazzaroni, J.C.; Fenton, M.J.; Hellman, J. Bacterial Peptidoglycan-Associated Lipoprotein: A Naturally Occurring Toll-like Receptor 2 Agonist That Is Shed into Serum and Has Synergy with Lipopolysaccharide. J. Infect. Dis. 2005, 191, 939–948. [Google Scholar] [CrossRef]
- Hsieh, P.F.; Liu, J.Y.; Pan, Y.J.; Wu, M.C.; Lin, T.L.; Huang, Y.T.; Wang, J.T. Klebsiella Pneumoniae Peptidoglycan-Associated Lipoprotein and Murein Lipoprotein Contribute to Serum Resistance, Antiphagocytosis, and Proinflammatory Cytokine Stimulation. J. Infect. Dis. 2013, 208, 1580–1589. [Google Scholar] [CrossRef]
- Mayer, A.K.; Muehmer, M.; Mages, J.; Gueinzius, K.; Hess, C.; Heeg, K.; Bals, R.; Lang, R.; Dalpke, A.H. Differential Recognition of TLR-Dependent Microbial Ligands in Human Bronchial Epithelial Cells. J. Immunol. 2007, 178, 3134–3142. [Google Scholar] [CrossRef]
- Davis, J.D.; Wypych, T.P. Cellular and Functional Heterogeneity of the Airway Epithelium. Mucosal Immunol. 2021, 14, 978–990. [Google Scholar] [CrossRef]
- Zhang, Z.; Cherryholmes, G.; Chang, F.; Rose, D.M.; Schraufstatter, I.; Shively, J.E. Evidence That Cathelicidin Peptide LL-37 May Act as a Functional Ligand for CXCR2 on Human Neutrophils. Eur. J. Immunol. 2009, 39, 3181–3194. [Google Scholar] [CrossRef]
- Palmer, L.D.; Maloney, K.N.; Boyd, K.L.; Goleniewska, A.K.; Toki, S.; Maxwell, C.N.; Chazin, W.J.; Peebles, R.S.J.; Newcomb, D.C.; Skaar, E.P. The Innate Immune Protein S100A9 Protects from T-Helper Cell Type 2-Mediated Allergic Airway Inflammation. Am. J. Respir. Cell Mol. Biol. 2019, 61, 459–468. [Google Scholar] [CrossRef] [PubMed]
- Hood, M.I.; Mortensen, B.L.; Moore, J.L.; Zhang, Y.; Kehl-Fie, T.E.; Sugitani, N.; Chazin, W.J.; Caprioli, R.M.; Skaar, E.P. Identification of an Acinetobacter Baumannii Zinc Acquisition System That Facilitates Resistance to Calprotectin-Mediated Zinc Sequestration. PLoS Pathog. 2012, 8, 20–24. [Google Scholar] [CrossRef] [PubMed]
- Xiong, H.; Carter, R.A.; Leiner, I.M.; Tang, Y.W.; Chen, L.; Kreiswirth, B.N.; Pamer, E.G. Distinct Contributions of Neutrophils and CCR2+ Monocytes to Pulmonary Clearance of Different Klebsiella Pneumoniae Strains. Infect. Immun. 2015, 83, 3418–3427. [Google Scholar] [CrossRef] [PubMed]
- Stroncek, D.F.; Shankar, R.A.; Skubitz, K.M. The Subcellular Distribution of Myeloid-Related Protein 8 (MRP8) and MRP14 in Human Neutrophils. J. Transl. Med. 2005, 3, 36. [Google Scholar] [CrossRef] [PubMed]
- Hirche, T.O.; Gaut, J.P.; Heinecke, J.W.; Belaaouaj, A. Myeloperoxidase Plays Critical Roles in Killing Klebsiella Pneumoniae and Inactivating Neutrophil Elastase: Effects on Host Defense1. J. Immunol. 2005, 174, 1557–1565. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wu, P.; Wang, Y.; Liu, Y.; Yang, H.; Zhou, G.; Wu, X.; Wen, Q. Application of Precision-Cut Lung Slices as an In Vitro Model for Research of Inflammatory Respiratory Diseases. Bioengineering 2022, 9, 767. [Google Scholar] [CrossRef]
- Van der Weide, H.; Ten Kate, M.T.; Vermeulen-De Jongh, D.M.C.; Van Der Meijden, A.; Wijma, R.A.; Boers, S.A.; Van Westreenen, M.; Hays, J.P.; Goessens, W.H.F.; Bakker-Woudenberg, I.A.J.M. Successful High-Dosage Monotherapy of Tigecycline in a Multidrug-Resistant Klebsiella Pneumoniae Pneumonia-Septicemia Model in Rats. Antibiotics 2020, 9, 109. [Google Scholar] [CrossRef]
- Qin, W.; Liu, Z.; van der Poll, T.; De Vos, A.F. Induction of Acute or Disseminating Bacterial Pneumonia in Mice and Sampling of Infected Organs for Studying the Host Response to Bacterial Pneumonia. Bio-Protocol 2022, 12, e4287. [Google Scholar] [CrossRef]
- Biedma, M.E.; Cayet, D.; Tabareau, J.; Rossi, A.H.; Ivičak-Kocjan, K.; Moreno, G.; Errea, A.; Soulard, D.; Parisi, G.; Jerala, R.; et al. Recombinant Flagellins with Deletions in Domains D1, D2, and D3: Characterization as Novel Immunoadjuvants. Vaccine 2019, 37, 652–663. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
HPRT | GGATTTGAAATTCCAGACAAGTTT | GCGATGTCAATAGGACTCCAG |
CXCL1 | GCATACTGCCTTGTTTAATGGT | CCAGTAAAGGTAGCCCTTGTTTC |
CXCL8 | AACCTTTCCACCCCAAATTTAT | AAAACTTCTCCACAACCCTCTG |
CCL20 | TGCTGTACCAAGAGTTTGCTC | CGCACACAGACAACTTTTTCTTT |
DEFB4A | CTCCTCTTCTCGTTCCTCTTCA | GCAGGTAACAGGATCGCCTAT |
S100A8 | GGGAATTTCCATGCCGTCTA | GACGTCTGCACCCTTTTTCC |
S100A9 | GAACCAGGGGGAATTCAAAG | CCAGGTCCTCCATGATGTGT |
PI3 | TTGATCGTGGTGGTGTTCCT | GAACACGGCCTTTGACAGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
van Linge, C.C.A.; Hulme, K.D.; Peters-Sengers, H.; Sirard, J.-C.; Goessens, W.H.F.; de Jong, M.D.; Russell, C.A.; de Vos, A.F.; van der Poll, T. Immunostimulatory Effect of Flagellin on MDR-Klebsiella-Infected Human Airway Epithelial Cells. Int. J. Mol. Sci. 2024, 25, 309. https://doi.org/10.3390/ijms25010309
van Linge CCA, Hulme KD, Peters-Sengers H, Sirard J-C, Goessens WHF, de Jong MD, Russell CA, de Vos AF, van der Poll T. Immunostimulatory Effect of Flagellin on MDR-Klebsiella-Infected Human Airway Epithelial Cells. International Journal of Molecular Sciences. 2024; 25(1):309. https://doi.org/10.3390/ijms25010309
Chicago/Turabian Stylevan Linge, Christine C. A., Katina D. Hulme, Hessel Peters-Sengers, Jean-Claude Sirard, Wil H. F. Goessens, Menno D. de Jong, Colin A. Russell, Alex F. de Vos, and Tom van der Poll. 2024. "Immunostimulatory Effect of Flagellin on MDR-Klebsiella-Infected Human Airway Epithelial Cells" International Journal of Molecular Sciences 25, no. 1: 309. https://doi.org/10.3390/ijms25010309