Rhodophyta DNA Barcoding: Ribulose-1, 5-Bisphosphate Carboxylase Gene and Novel Universal Primers
Abstract
:1. Introduction
2. Results
3. Discussion
3.1. Primer Design and Property Analysis
3.2. Red Algae Identification Based on Ribulose-1, 5-bisphosphate Carboxylase
4. Materials and Methods
4.1. rbcL Sequence Alignment
4.2. Universal Primer Design for Amplification of the Red Algae rbcL Gene
4.3. rbcL Primer Universality Assessment for Barcoding Red Algae
4.4. Sample Collection
4.5. Amplification and Sequencing of Red Algae Ribulose-1, 5-bisphosphate Carboxylase (rbcL) Gene
4.6. Species Identification Using DNA Barcoding and Phylogenetic Analyses
4.7. Pairwise Genetic Distance Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Robba, L.; Russell, S.J.; Barker, G.L.; Brodie, J. Assessing the use of the mitochondrial cox1 marker for use in DNA barcoding of red algae (Rhodophyta). Am. J. Bot. 2006, 93, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, Z.; Pniewski, F.; Latała, A. DNA barcoding–A new device in phycologist’s toolbox. Ecol. Hydrobiol. 2019, 19, 417–427. [Google Scholar] [CrossRef]
- Sithranga Boopathy, N.; Kathiresan, K.J.J.O. Anticancer drugs from marine flora: An overview. J. Oncol. 2010, 2010, 214186. [Google Scholar] [CrossRef] [PubMed]
- Neethu, P.V.; Suthindhiran, K.; Jayasri, M.A. Antioxidant and antiproliferative activity of Asparagopsis taxiformis. Pharmacogn. Res. 2017, 9, 238–246. [Google Scholar]
- Knott, M.G. Isolation, structural Characterisation & Evaluation of Cytotoxic Activity of Natural Products From selected South African Marine Red Algae. Ph.D. Thesis, Rhodes University, Grahamstown, South Africa, 2012. South East Academic Libraries System (SEALS). Available online: http://hdl.handle.net/10962/d1015460 (accessed on 19 May 2019).
- Thomsen, P.F.; Willerslev, E. Environmental DNA–An emerging tool in conservation for monitoring past and present biodiversity. Biol. Conserv. 2015, 183, 4–18. [Google Scholar] [CrossRef]
- Wijayawardene, N.N.; Bahram, M.; Sánchez-Castro, I.; Dai, D.Q.; Ariyawansa, K.G.; Jayalal, U.; Suwannarach, N.; Tedersoo, L. Current insight into culture-dependent and culture-independent methods in discovering Ascomycetous Taxa. J. Fungi 2021, 7, 703. [Google Scholar] [CrossRef] [PubMed]
- Hebert, P.D.; Ratnasingham, S.; De Waard, J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. J. Biol. Sci. 2003, 270, 96–99. [Google Scholar] [CrossRef] [PubMed]
- García-Morales, A.E.; Elías-Gutiérrez, M. DNA barcoding of freshwater Rotifera in Mexico: Evidence of cryptic speciation in common rotifers. Mol. Ecol. Resour. 2013, 13, 1097–1107. [Google Scholar] [CrossRef]
- Trivedi, S.; Aloufi, A.A.; Ansari, A.A.; Ghosh, S.K. Role of DNA barcoding in marine biodiversity assessment and conservation: An update. Saudi J. Biol. Sci. 2016, 23, 161–171. [Google Scholar] [CrossRef]
- Saddhe, A.A.; Kumar, K. DNA barcoding of plants: Selection of core markers for taxonomic groups. Plant Sci. Today 2018, 5, 9–13. [Google Scholar] [CrossRef]
- Saunders, G.W. Applying DNA barcoding to red macroalgae: A preliminary appraisal holds promise for future applications. J. Biol. Sci. 2005, 360, 1879–1888. [Google Scholar] [CrossRef] [PubMed]
- Saunders, G.W. A DNA barcode examination of the red algal family Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1. The foliose Dilsea-Neodilsea complex and Weeksia. J. Bot. 2008, 86, 773–789. [Google Scholar] [CrossRef]
- Saunders, G.W.; Moore, T.E. Refinements for the amplification and sequencing of red algal DNA barcode and RedToL phylogenetic markers: A summary of current primers, profiles and strategies. Algae 2013, 28, 31–43. [Google Scholar] [CrossRef]
- Saunders, G.W.; Millar, K. A DNA barcode survey of the red algal genus Mazzaella in British Columbia reveals overlooked diversity and new distributional records: Descriptions of M. dewreedei sp. nov. and M. macrocarpa sp. nov. J. Bot. 2014, 92, 223–231. [Google Scholar] [CrossRef]
- Hasebe, M.; Omori, T.; Nakazawa, M.; Sano, T.; Kato, M.; Iwatsuki, K. rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. Proc. Natl. Acad. Sci. USA 1994, 91, 5730–5734. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Liu, J.; Yu, J.; Wang, L.; Zhou, S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS ONE. 2012, 7, e35071. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, M.; Piekut, T.; Prendecki, M.; Sodel, A.; Kozubski, W.; Dorszewska, J. Mitochondrial and nuclear DNA oxidative damage in physiological and pathological aging. DNA Cell Biol. 2020, 39, 1410–1420. [Google Scholar] [CrossRef]
- Freshwater, D.W.; Rueness, J. Phylogenetic relationships of some European Gelidium (Gelidiales, Rhodophyta) species, based on rbcL nucleotide sequence analysis. Phycologia 1994, 33, 187–194. [Google Scholar] [CrossRef]
- Vis, M.L.; Sheath, R. A molecular investigation of the systematic relationships of Sirodotia species (Batrachospermales, Rhodophyta) in North America. Phycologia 1999, 38, 261–266. [Google Scholar] [CrossRef]
- Provan, J.; Murphy, S.; Maggs, C.A. Universal plastid primers for Chlorophyta and Rhodophyta. Eur. J. Phycol. 2004, 39, 43–50. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Ratnasingham, S.; Hebert, P.D. BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Mol. Eccol. Notes 2007, 7, 355–364. [Google Scholar] [CrossRef] [PubMed]
- Ratnasingham, S.; Hebert, P.D. BOLD the Barcode of Life Data System. 2007. Available online: https://www.boldsystems.org/index.php/IDS_OpenIdEngine (accessed on 12 November 2023).
- Jing, Y.U.; Jian-Hua, X.U.E.; Shi-Liang, Z. New universal matK primers for DNA barcoding angiosperms. J. Syst. Evol. 2011, 49, 176–181. [Google Scholar]
- Prezioso, V.R. General Notes on Primer Design in PCR. Encyclopedia 2006, 2, 022012–022037. [Google Scholar]
- Green, M.R.; Sambrook, J. Polymerase chain reaction. Cold Spring Harb. Protoc. 2019, 6, 436–456. [Google Scholar] [CrossRef] [PubMed]
- Augspurger, C.K.; Bartlett, E.A. Differences in leaf phenology between juvenile and adult trees in a temperate deciduous forest. Tree Physiol. 2003, 23, 517–525. [Google Scholar] [CrossRef] [PubMed]
- Hiruma, K.; Kaneko, Y. Hormonal regulation of insect metamorphosis with special reference to juvenile hormone biosynthesis. Curr. Top. Dev. Biol. 2013, 103, 73–100. [Google Scholar]
- Duran, C.; Appleby, N.; Clark, T.; Wood, D.; Imelfort, M.; Batley, J.; Edwards, D. AutoSNPdb: An annotated single nucleotide polymorphism database for crop plants. Nucleic Acids Res. 2008, 37, 951–953. [Google Scholar] [CrossRef]
- DeSalle, R.; Egan, M.G.; Siddall, M. The unholy trinity: Taxonomy, species delimitation and DNA barcoding. Phil. Trans. R. Soc. Lon. B Biol. Sci. 2005, 360, 1905–1916. [Google Scholar] [CrossRef]
- Li, Y.; Tong, Y.; Xing, F. DNA barcoding evaluation and its taxonomic implications in the recently evolved genus Oberonia Lindl. (Orchidaceae) in China. Front. Plant Sci. 2016, 7, 1791. [Google Scholar] [CrossRef]
- Dai, Q.Y.; Gao, Q.; Wu, C.S.; Chesters, D.; Zhu, C.D.; Zhang, A.B. Phylogenetic reconstruction and DNA barcoding for closely related pine moth species (Dendrolimus) in China with multiple gene markers. PLoS ONE 2012, 7, 32544. [Google Scholar] [CrossRef] [PubMed]
- Tahir, A.; Hussain, F.; Ahmed, N.; Ghorbani, A.; Jamil, A. Assessing universality of DNA barcoding in geographically isolated selected desert medicinal species of Fabaceae and Poaceae. PeerJ 2018, 6, 4499. [Google Scholar] [CrossRef] [PubMed]
- Benson, D.; Lipman, D.J.; Ostell, J. GenBank. Nucleic Acids Res. 1993, 21, 2963–2965. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Buquicchio, F.; Spruyt, M. Gene Runner. 1992. Available online: http://www.generunner.net (accessed on 1 March 2017).
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MRBAYES 3.2: Efficient Bayesian phylogenetic inference and model selection across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed]
- Available online: https://www.researchgate.net/post/Whats-the-difference-between-neighbor-joining-maximum-likelihood-maximum-parsimony-and-Bayesian-inference (accessed on 19 November 2023).
- Meier, R.; Shiyang, K.; Vaidya, G.; Ng, P.K. DNA barcoding and taxonomy in Diptera: A tale of high intraspecific variability and low identification success. Syst. Biol. 2006, 55, 715–728. [Google Scholar] [CrossRef] [PubMed]
- Knott, M.G.; Mkwananzi, H.; Arendse, C.E.; Hendricks, D.T.; Bolton, J.J.; Beukes, D.R. Plocoralides A–C, polyhalogenated monoterpenes from the marine alga Plocamium corallorhiza. Phyto. Chem. 2005, 66, 1108–1112. [Google Scholar]
- McCombs, J.D.; Blunt, J.W.; Chambers, M.V.; Munro, M.H.; Robinson, W.T. Novel 2 (5H)-furanones from the red marine alga Delisea elegans (Lamouroux). Tetrahedron 1998, 44, 1489–1502. [Google Scholar] [CrossRef]
- Kladi, M.; Vagias, C.; Roussis, V. Volatile halogenated metabolites from marine red algae. Phytochem. Rev. 2004, 3, 337–366. [Google Scholar] [CrossRef]
Primer | Primer Sequence (5′-3′) | Primer Length (bp) | Tm (°C) | GC% |
---|---|---|---|---|
RFrbcLf1 | GTCTAACTCTGTAGAAGAAC | 20 | 56 | 40.0 |
RFrbcLr2 | GCCCAATCTTGTTCAAAG | 18 | 52 | 44.4 |
Sample ID | Barcode of Life Data (Top%Speciesid) | E-Value | Collection Data | |||
---|---|---|---|---|---|---|
Location | Geographic Coordinates | Date | Genbank Accession Numbers | |||
1 | Callithamnion corymbosum (93.50) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939833 |
2 | Antithamnion pectinatum (96.90) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939834 |
4 | Hypnea spinella (91.80) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939835 |
5 | Gelidium pristoides (95.10) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939836 |
6 | Delisea flaccida (100.00) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939837 |
7 | Erythroclonium angustatum (90.50) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939838 |
8 | Plocamium coleorhiza (99.70) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939839 |
9 | Delisea flaccida (99.90) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939840 |
10 | Gelidium amansii (100.00) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 10 September 2016 | OR939841 |
K6 | Antithamnion pectinatum (96.80) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939842 |
K7 | Gymnogongrus sp. (92.30) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939843 |
K8 | Callithamnion bailey (92.80) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939844 |
K9 | Ceramium obsoletum (97.20) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939845 |
K10 | Erythroclonium angustatum (91.50) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939846 |
K11 | Plocamium coleorhiza (96.30) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939847 |
K12 | Gelidium pristoides (99.70) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939848 |
K13 | Gelidium amansii (100.00) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939849 |
K17 | Ceramium obsoletum (98.40) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939850 |
K18 | Ceramium obsoletum (96.70) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939851 |
K19 | Laurencia glomerata (98.24) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939852 |
K20 | Laurencia glomerata (99.686.20) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939853 |
K21 | Callithamnion collabens (95.50) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939854 |
K22 | Hypnea spinella (93.90) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939855 |
K26 | Hypnea flexicaulis (97.60) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939856 |
K27 | Gymnogongrus sp. (99.90) | 0.0 | South Africa | 33.6806° S, 26.6701° E | 24 November 2017 | OR939857 |
Order | Family | Genus | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | Ceremiales | Rhodomeiaceae | Laurencia | |||||||||||
2 | Ceremiales | Callithamniaceae | Calithamnion | 14.72 | ||||||||||
3 | Ceremiales | Ceramiaceae | Ceramium | 13.52 | 12.46 | |||||||||
4 | Gelidiales | Ceramiaceae | Antithamnion | 13.32 | 12.48 | 11.14 | ||||||||
5 | Gigartinales | Gelidiaceae | Gelidium | 17.23 | 16.15 | 15.12 | 15.98 | |||||||
6 | Gigartinales | Hypneaceae | Hypnea | 17.95 | 16.60 | 16.42 | 16.49 | 16.65 | ||||||
7 | Gigartinales | Areschougiaceae | Erythroclonium | 17.16 | 16.15 | 15.93 | 16.14 | 17.63 | 11.94 | |||||
8 | Gigartinales | Caulacanthaceae | Heringia | 17.36 | 15.68 | 15.74 | 16.66 | 17.16 | 12.64 | 8.67 | ||||
9 | Gigartinales | Phyllophoraceae | Gymnogongrus | 17.44 | 15.66 | 16.09 | 15.98 | 17.68 | 14.41 | 13.26 | 14.35 | |||
10 | Plocamiales | Plocamiaceae | Plocamium | 17.71 | 15.88 | 14.50 | 15.46 | 16.97 | 15.87 | 15.08 | 14.18 | 15.23 | ||
11 | Bonnemaisoniales | Bonnemaisoniaceae | Delisea | 15.55 | 15.43 | 14.41 | 14.13 | 16.77 | 15.60 | 15.70 | 15.73 | 14.30 | 12.54 | |
12 | Outgroup | 20.75 | 19.47 | 19.14 | 19.64 | 20.47 | 19.55 | 19.46 | 19.17 | 20.00 | 19.77 | 19.40 |
%Distance | SE | |
---|---|---|
Calithamnion | 8.67 | 0.62 |
Antithamnion | 4.86 | 0.55 |
Gelidium | 5.90 | 0.50 |
Heringia | 9.05 | 1.05 |
Delisea | 3.74 | 0.44 |
Ceramium | 7.72 | 0.62 |
Plocamium | 5.15 | 0.51 |
Erythroclonium | 8.29 | 0.81 |
Laurencia | 4.27 | 0.43 |
Hypnea | 7.32 | 0.56 |
Gymnogongrus | 9.20 | 0.71 |
Outgroup | 10.11 | 0.74 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mshiywa, F.M.; Edwards, S.; Bradley, G. Rhodophyta DNA Barcoding: Ribulose-1, 5-Bisphosphate Carboxylase Gene and Novel Universal Primers. Int. J. Mol. Sci. 2024, 25, 58. https://doi.org/10.3390/ijms25010058
Mshiywa FM, Edwards S, Bradley G. Rhodophyta DNA Barcoding: Ribulose-1, 5-Bisphosphate Carboxylase Gene and Novel Universal Primers. International Journal of Molecular Sciences. 2024; 25(1):58. https://doi.org/10.3390/ijms25010058
Chicago/Turabian StyleMshiywa, Faith Masilive, Shelley Edwards, and Graeme Bradley. 2024. "Rhodophyta DNA Barcoding: Ribulose-1, 5-Bisphosphate Carboxylase Gene and Novel Universal Primers" International Journal of Molecular Sciences 25, no. 1: 58. https://doi.org/10.3390/ijms25010058