Phosphoramidate Azole Oligonucleotides for Single Nucleotide Polymorphism Detection by PCR
Abstract
:1. Introduction
2. Results and Discussion
2.1. Effect of PABA Modification Position at the 3′-Terminus of the Primer on the Elongation Using Taq DNA Polymerase
2.2. Effect of PABA Modification Position in the Template on the Elongation
2.3. Effect of PABA Groups Position at the 3′-Terminus of the Primer on the AS-PCR Results
3. Materials and Methods
3.1. Synthesis and Isolation of Oligonucleotides
3.2. PCR
3.3. Plasmid Standards
3.4. Real-Time PCR
3.5. UV Melting Experiments and Thermodynamic Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Anderson, S.M. Laboratory methods for KRAS mutation analysis. Expert Rev. Mol. Diagn. 2011, 11, 635–642. [Google Scholar] [CrossRef]
- Ishige, T.; Itoga, S.; Matsushita, K. Locked Nucleic Acid Technology for Highly Sensitive Detection of Somatic Mutations in Cancer, 1st ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2018; Volume 83. [Google Scholar]
- Serebriiskii, I.G.; Connelly, C.; Frampton, G.; Newberg, J.; Cooke, M.; Miller, V.; Ali, S.; Ross, J.S.; Handorf, E.; Arora, S.; et al. Comprehensive characterization of RAS mutations in colon and rectal cancers in old and young patients. Nat. Commun. 2019, 10, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Guo, Z.; Wang, F.; Fu, L. KRAS mutation: From undruggable to druggable in cancer. Signal Transduct. Target. Ther. 2021, 6, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.P.; Wu, H.Y.; Yang, X.; Xu, H.Q.; Chen, D.; Huang, Q.; Fu, W.L. Diagnostic accuracy of high resolution melting analysis for detection of KRAS mutations: A systematic review and meta-analysis. Sci. Rep. 2014, 4, 7–9. [Google Scholar] [CrossRef]
- Timar, J.; Kashofer, K. Molecular epidemiology and diagnostics of KRAS mutations in human cancer. Cancer Metastasis Rev. 2020, 39, 1029–1038. [Google Scholar] [CrossRef]
- Arastehfar, A.; Boekhout, T.; Butler, G.; Buda De Cesare, G.; Dolk, E.; Gabaldón, T.; Hafez, A.; Hube, B.; Hagen, F.; Hovhannisyan, H.; et al. Recent trends in molecular diagnostics of yeast infections: From PCR to NGS. FEMS Microbiol. Rev. 2019, 43, 517–547. [Google Scholar] [CrossRef]
- van Dijk, E.L.; Jaszczyszyn, Y.; Naquin, D.; Thermes, C. The Third Revolution in Sequencing Technology. Trends Genet. 2018, 34, 666–681. [Google Scholar] [CrossRef] [PubMed]
- Rejali, N.A.; Moric, E.; Wittwer, C.T. The effect of single mismatches on primer extension. Clin. Chem. 2018, 64, 801–809. [Google Scholar] [CrossRef]
- Liu, J.; Huang, S.; Sun, M.; Liu, S.; Liu, Y.; Wang, W.; Zhang, X.; Wang, H.; Hua, W. An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods 2012, 8, 34. [Google Scholar] [CrossRef]
- Aggarwal, A.; Mehta, S.; Gupta, D.; Sheikh, S.; Pallagatti, S.; Singh, R.; Singla, I. Clinical & immunological erythematosus patients characteristics in systemic lupus Maryam. J. Dent. Educ. 2012, 76, 1532–1539. [Google Scholar]
- Chang, Y.-H.; Wu, M.-W.; Chen, Y.-J.; Vu, C.-A.; Hong, C.-Y.; Chen, W.-Y. Phosphate-Methylated Oligonucleotides as a Novel Primer for PCR and RT-PCR. In PCR Primer Design; Springer: Berlin/Heidelberg, Germany, 2001; Volume 2, pp. 261–272. ISBN 9781071617984. [Google Scholar]
- Navarro, E.; Serrano-Heras, G.; Castaño, M.J.; Solera, J. Real-time PCR detection chemistry. Clin. Chim. Acta 2015, 439, 231–250. [Google Scholar] [CrossRef] [PubMed]
- Li, T.L.; Wu, M.W.; Lin, W.C.; Lai, C.H.; Chang, Y.H.; Su, L.J.; Chen, W.Y. Designed phosphate-methylated oligonucleotides as PCR primers for SNP discrimination. Anal. Bioanal. Chem. 2019, 411, 3871–3880. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.L.; Jiang, H.J.; Fang, W.Y.; Xu, Y.Y.; Li, K.; Zhang, J.; Liao, D.F.; He, F.C. High fidelity PCR with an off/on switch mediated by proofreading polymerases combining with phosphorothioate-modified primer. Biochem. Biophys. Res. Commun. 2005, 328, 265–272. [Google Scholar] [CrossRef] [PubMed]
- D’Agata, R.; Giuffrida, M.C.; Spoto, G. Peptide Nucleic Acid-Based Biosensors for Cancer Diagnosis. Molecules 2017, 22, 1951. [Google Scholar] [CrossRef]
- Gupta, A.; Mishra, A.; Puri, N. Peptide nucleic acids: Advanced tools for biomedical applications. J. Biotechnol. J. 2017, 259, 148–159. [Google Scholar] [CrossRef]
- Saarbach, J.; Sabale, P.M.; Winssinger, N. Peptide nucleic acid (PNA) and its applications in chemical biology, diagnostics, and therapeutics. Curr. Opin. Chem. Biol. 2019, 52, 112–124. [Google Scholar] [CrossRef]
- Ballantyne, K.N.; van Oorschot, R.A.H.; Mitchell, R.J. Locked nucleic acids in PCR primers increase sensitivity and performance. Genomics 2008, 91, 301–305. [Google Scholar] [CrossRef]
- Kupryushkin, M.S.; Pyshnyi, D.V.; Stetsenko, D.A. Phosphoryl guanidines: A new type of nucleic acid analogues. Acta Naturae 2014, 6, 116–118. [Google Scholar] [CrossRef]
- Chubarov, A.S.; Oscorbin, I.P.; Filipenko, M.L.; Lomzov, A.A.; Pyshnyi, D.V. Allele-specific PCR for KRAS mutation detection using phosphoryl guanidine modified primers. Diagnostics 2020, 10, 872. [Google Scholar] [CrossRef]
- Liu, Y.; Andreucci, A.; Iwamoto, N.; Yin, Y.; Yang, H.; Liu, F.; Bulychev, A.; Hu, X.S.; Lin, X.; Lamore, S.; et al. Preclinical evaluation of WVE-004, aninvestigational stereopure oligonucleotide forthe treatment of C9orf72-associated ALS or FTD. Mol. Ther. Nucleic Acids 2022, 28, 558–570. [Google Scholar] [CrossRef]
- Kandasamy, P.; Liu, Y.; Aduda, V.; Akare, S.; Alam, R.; Andreucci, A.; Boulay, D.; Bowman, K.; Byrne, M.; Cannon, M.; et al. Impact of guanidine-containing backbone linkages on stereopure antisense oligonucleotides in the CNS. Nucleic Acids Res. 2022, 50, 5401–5423. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Iwamoto, N.; Marappan, S.; Luu, K.; Tripathi, S.; Purcell-Estabrook, E.; Shelke, J.D.; Shah, H.; Lamattina, A.; Pan, Q.; et al. Impact of stereopure chimeric backbone chemistries on the potency and durability of gene silencing by RNA interference. Nucleic Acids Res. 2023, 51, 4126–4147. [Google Scholar] [CrossRef] [PubMed]
- Monian, P.; Shivalila, C.; Lu, G.; Shimizu, M.; Boulay, D.; Bussow, K.; Byrne, M.; Bezigian, A.; Chatterjee, A.; Chew, D.; et al. Endogenous ADAR-mediated RNA editing in non-human primates using stereopure chemically modified oligonucleotides. Nat. Biotechnol. 2022, 40, 1093–1102. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Dodart, J.C.; Tran, H.; Berkovitch, S.; Braun, M.; Byrne, M.; Durbin, A.F.; Hu, X.S.; Iwamoto, N.; Jang, H.G.; et al. Variant-selective stereopure oligonucleotides protect against pathologies associated with C9orf72-repeat expansion in preclinical models. Nat. Commun. 2021, 12, 847. [Google Scholar] [CrossRef]
- Chubarov, A.S.; Oscorbin, I.P.; Novikova, L.M.; Filipenko, M.L.; Lomzov, A.A.; Pyshnyi, D.V. Allele-Specific PCR for PIK3CA Mutation Detection Using Phosphoryl Guanidine Modified Primers. Diagnostics 2023, 13, 250. [Google Scholar] [CrossRef]
- Vasilyeva, S.V.; Baranovskaya, E.E.; Dyudeeva, E.S.; Lomzov, A.A.; Pyshnyi, D.V. Synthesis of Oligonucleotides Carrying Inter-nucleotide N-(Benzoazole)-phosphoramide Moieties. ACS Omega 2022, 8, 1556–1566. [Google Scholar] [CrossRef]
- Golyshev, V.M.; Yushin, I.I.; Gulyaeva, O.A.; Baranovskaya, E.E.; Lomzov, A.A. Properties of phosphoramide benzoazole oligonucleotides (PABAOs). I. Structure and hybridization efficiency of N-benzimidazole derivatives. Biochem. Biophys. Res. Commun. 2023, 693, 149390. [Google Scholar] [CrossRef]
- Mergny, J.L.; Lacroix, L. Analysis of Thermal Melting Curves. Oligonucleotides 2003, 13, 515–537. [Google Scholar] [CrossRef]
- Petruska, J.; Goodman, M.F. Enthalpy-entropy compensation in DNA melting thermodynamics. J. Biol. Chem. 1995, 270, 746–750. [Google Scholar] [CrossRef]
- Tsai, Y.C.; Chen, W.Y.; Chiu, C.C. Molecular effects of site-specific phosphate-methylated primer on the structure and motions of Taq DNA polymerase. Comput. Struct. Biotechnol. J. 2023, 21, 1820–1827. [Google Scholar] [CrossRef]
- Wang, H.; Jiang, J.; Mostert, B.; Sieuwerts, A.; Martens, J.W.M.; Sleijfer, S.; Foekens, J.A.; Wang, Y. Allele-specific, non-extendable primer blocker PCR (AS-NEPB-PCR) for DNA mutation detection in cancer. J. Mol. Diagnostics 2013, 15, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, P.; Prasad, D. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech 2023, 13, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Cai, S.; Jung, C.; Bhadra, S.; Ellington, A.D. Phosphorothioated Primers Lead to Loop-Mediated Isothermal Amplification at Low Temperatures. Anal. Chem. 2018, 90, 8290–8294. [Google Scholar] [CrossRef] [PubMed]
- van Eijk, R.; Licht, J.; Schrumpf, M.; Yazdi, M.T.; Ruano, D.; Forte, G.I.; Nederlof, P.M.; Veselic, M.; Rabe, K.F.; Annema, J.T.; et al. Rapid KRAS, EGFR, BRAF and PIK3CA mutation analysis of fine needle aspirates from non-small-cell lung cancer using allele-specific qPCR. PLoS ONE 2011, 6, e17791. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Garcia, V.; Bartos, C.; Keraite, I.; Trivedi, U.; Brennan, P.M.; Kersaudy-Kerhoas, M.; Gharbi, K.; Oikonomidou, O.; Leslie, N.R. A simple and robust real-time qPCR method for the detection of PIK3CA mutations. Sci. Rep. 2018, 8, 4290. [Google Scholar] [CrossRef] [PubMed]
- Cao, G.; Chen, X.; Deng, Y.; Nie, F.; Liu, Y.; Wang, G.; Huo, D.; Hou, C. Single-nucleotide variant of PIK3CA H1047R gene assay by CRISPR/Cas12a combined with rolling circle amplification. Anal. Chim. Acta 2021, 1182, 338943. [Google Scholar] [CrossRef] [PubMed]
- Parthipan, S.; Sandrasagran, M.; Ishar, S.M. A Review of Mitochondrial SNP Determination using Allele-Specific PCR in Forensic Identification. Sains Malays. 2022, 51, 4019–4030. [Google Scholar] [CrossRef]
- Lang, A.H.; Drexel, H.; Geller-Rhomberg, S.; Stark, N.; Winder, T.; Geiger, K.; Muendlein, A. Optimized allele-specific real-time PCR assays for the detection of common mutations in KRAS and BRAF. J. Mol. Diagn. 2011, 13, 23–28. [Google Scholar] [CrossRef]
- Takeda, S.; Ichii, S.; Nakamura, Y. Detection of Kras mutation in sputum by mutant allelespecific amplification (MASA). Hum. Mutat. 1993, 2, 112–117. [Google Scholar] [CrossRef]
Abbreviation 1 | Oligonucleotide Sequence 5′ → 3′ |
---|---|
Z 0 | FAM-GGTGCGCTCCTGGACGTAGC |
Z 1-X | FAM-GGTGCGCTCCTGGACGTAG*C |
Z 2-X | FAM-GGTGCGCTCCTGGACGTA*GC |
Z 3-X | FAM-GGTGCGCTCCTGGACGT*AGC |
Z 4-X | FAM-GGTGCGCTCCTGGACG*TAGC |
Z 5-X | FAM-GGTGCGCTCCTGGAC*GTAGC |
Z 6-X | FAM-GGTGCGCTCCTGGA*CGTAGC |
Z 7-X | FAM-GGTGCGCTCCTGG*ACGTAGC |
Z 1,2-X | FAM-GGTGCGCTCCTGGACGTA*G*C |
Z 1,3-X | FAM-GGTGCGCTCCTGGACGT*AG*C |
T | CTGTTGTTTAGCTACGTCCAGGAGCGCACC |
T-1 | CTGTTGTTTATCTACGTCCAGGAGCGCACC |
T-2 | CTGTTGTTTAGATACGTCCAGGAGCGCACC |
T-1,2 | CTGTTGTTTATATACGTCCAGGAGCGCACC |
P | Cy5-GCTACGTC |
Mutation | Primers | Cq | ΔCq | Primers | Cq | ΔCq | ||
---|---|---|---|---|---|---|---|---|
WT | 1% | CqWT − Cq1% 1 | WT | 1% | CqWT−Cq1% 1 | |||
G12A | CTTC | 38.0 ± 0.3 | 32.4 ± 0.1 | 5.3 | CTGC | 32.8 ± 0.2 | 31.3 ± 0.2 | 1.5 |
COTTC | N/A | 32.3 ± 0.1 | 12.7 | COTGC | 34.9 ± 0.1 | 32.1 ± 0.2 | 2.8 | |
OCTTC | N/A | 33.6 ± 0.1 | 11.4 | OCTGC | 36.4 ± 0.2 | 32.3 ± 0.2 | 4.1 | |
CTOTC | N/A | 32.4 ± 0.1 | 12.6 | CTOGC | 36.8 ± 0.2 | 32.2 ± 0.2 | 4.6 | |
CSTTC | N/A | 32.4 ± 0.2 | 12.6 | CSTGC | 34.0 ± 0.3 | 31.5 ± 0.2 | 2.5 | |
SCTTC | N/A | 33.8 ± 0.2 | 11.2 | SCTGC | 37.0 ± 0.2 | 31.9 ± 0.2 | 5.1 | |
CTSTC | N/A | 32.5 ± 0.1 | 12.5 | CTSGC | 37.1 ± 0.2 | 31.7 ± 0.2 | 5.4 | |
CNTTC | N/A | 33.5 ± 0.4 | 11.5 | CNTGC | 38.2 ± 0.3 | 32.2 ± 0.2 | 6.0 | |
NCTTC | N/A | 36.8 ± 0.5 | 8.2 | NCTGC | 40.3 ± 0.4 | 32.5 ± 0.2 | 7.8 | |
CTNTC | N/A | 38.2 ± 0.2 | 6.8 | CTNGC | 39.3 ± 0.4 | 33.7 ± 0.2 | 5.6 | |
CDTTC | N/A | 33.9 ± 0.1 | 11.1 | CTDTC | N/A | 37.1 ± 0.3 | 7.9 | |
DCTTC | N/A | 38.0 ± 0.3 | 7.1 | |||||
G12V | CTAT | 35.4 ± 0.3 | 32.3 ± 0.1 | 3.1 | CTGT | 27.4 ± 0.1 | 27.0 ± 0.1 | 0.4 |
COTAT | 39.7 ± 0.3 | 33.1 ± 0.1 | 6.6 | COTGT | 28.2 ± 0.2 | 27.9 ± 0.1 | 0.3 | |
OCTAT | 29.8 ± 0.2 | 29.4 ± 0.1 | 0.4 | OCTGT | 29.8 ± 0.3 | 29.5 ± 0.1 | 0.3 | |
CTOAT | 42.4 ± 0.7 | 34.4 ± 0.1 | 8.0 | CTOGT | 36.5 ± 0.2 | 33.6 ± 0.1 | 2.9 | |
CSTAT | 38.5 ± 0.5 | 33.2 ± 0.1 | 5.3 | CSTGT | 28.1 ± 0.1 | 28.1 ± 0.1 | 0.1 | |
SCTAT | 39.6 ± 0.2 | 34.4 ± 0.1 | 5.2 | SCTGT | 32.8 ± 0.3 | 30.0 ± 0.1 | 2.8 | |
CTSAT | 41.1 ± 0.8 | 33.7 ± 0.2 | 7.4 | CTSGT | 30.2 ± 0.1 | 30.0 ± 0.1 | 0.3 | |
CNTAT | 42.0 ± 0.5 | 35.4 ± 0.8 | 6.6 | CNTGT | 29.2 ± 0.1 | 29.1 ± 0.1 | 0.1 | |
NCTAT | 42.0 ± 0.8 | 37.1 ± 0.8 | 4.9 | NCTGT | 33.3 ± 0.1 | 31.7 ± 0.2 | 1.6 | |
CTNAT | 44.3 ± 0.8 | 37.1 ± 0.8 | 7.2 | CTNGT | 30.5 ± 0.1 | 30.1 ± 0.1 | 0.4 | |
CDTAT | N/A | 37.8 ± 0.6 | 7.2 | DCTAT | N/A | 38.8 ± 0.2 | 6.2 | |
CTDAT | N/A | 37.6 ± 0.5 | 7.4 |
Primers | k-Ref | C*TTC | *CTTC | CT*TC | C*TGC | *CTGC | CT*GC |
native | 100.0 | 92.7 | 93.1 | ||||
O | - | 99.3 | 95.0 | 97.2 | 96.8 | 97.2 | 95.1 |
S | - | 96.8 | 96.1 | 96.5 | 100.1 | 96.1 | 100.1 |
N | - | 99.7 | 92.4 | 74.9 | 94.9 | 96.7 | 83.9 |
D | - | 90.0 | 83.6 | 80.0 | - | - | - |
Primers | k-Ref | C*TAT | *CTAT | CT*AT | C*TGT | *CTGT | CT*GT |
native | 100.0 | 93.1 | 92.8 | ||||
O | - | 92.1 | 92.4 | 97.2 | 92.3 | 95.7 | 96.5 |
S | - | 94.9 | 97.6 | 98.8 | 99.7 | 98.4 | 94.9 |
N | - | 84.5 | 89.0 | 92.4 | 97.6 | 98.4 | 77.1 |
D | - | 80.5 | 90.3 | 93.1 | - | - | - |
Mutation/ Primers | 1% DNA Cq Increase Compared to Native Primer, Cycles | PCR Efficiency, % | ΔCq = CqWT − Cq1% | Conclusion of Suitability for Further AS-PCR Studies | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
O | S | N | D | O | S | N | D | O | S | N | D | O | S | N | D | ||
G12A | C*TTC | −0.1 | 0.0 | 1.1 | 1.5 | 99 | 97 | 100 | 90 | 12.7 | 12.6 | 11.5 | 11.1 | ++ | ++ | ++ | + |
*CTTC | 1.2 | 1.4 | 4.4 | 5.6 | 95 | 96 | 92 | 84 | 11.4 | 11.2 | 8.2 | 7.9 | ++ | ++ | - | - | |
CT*TC | 0.0 | 0.1 | 5.8 | 4.7 | 97 | 97 | 75 | 80 | 12.6 | 12.5 | 6.8 | 7.1 | ++ | ++ | - | - | |
C*TGC | 0.8 | 0.2 | 0.9 | - | 97 | 100 | 95 | - | 2.8 | 2.5 | 6.0 | - | - | - | + | - | |
*CTGC | 1.0 | 0.6 | 1.2 | - | 97 | 96 | 97 | - | 4.1 | 5.1 | 7.8 | - | + | + | + | - | |
CT*GC | 0.9 | 0.4 | 2.4 | - | 95 | 100 | 84 | - | 4.6 | 5.4 | 5.6 | - | + | + | - | - | |
G12V | C*TAT | 0.8 | 0.9 | 3.1 | 5.5 | 92 | 95 | 85 | 81 | 6.6 | 5.3 | 6.6 | 7.2 | + | + | - | - |
*CTAT | −2.9 | 2.1 | 4.8 | 6.5 | 92 | 98 | 89 | 90 | 0.4 | 5.2 | 4.9 | 6.2 | - | + | - | - | |
CT*AT | 2.1 | 1.4 | 4.8 | 5.3 | 97 | 99 | 92 | 93 | 8.0 | 7.4 | 7.2 | 7.4 | + | + | - | - | |
C*TGT | −4.4 | −4.2 | −3.2 | - | 92 | 100 | 98 | - | 0.3 | 0.1 | 0.1 | - | - | - | - | - | |
*CTGT | −2.8 | −2.3 | −0.6 | - | 96 | 98 | 98 | - | 0.3 | 2.8 | 1.6 | - | - | - | - | - | |
CT*GT | 1.3 | −2.3 | −2.2 | - | 97 | 95 | 77 | - | 2.9 | 0.3 | 0.4 | - | - | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chubarov, A.S.; Baranovskaya, E.E.; Oscorbin, I.P.; Yushin, I.I.; Filipenko, M.L.; Pyshnyi, D.V.; Vasilyeva, S.V.; Lomzov, A.A. Phosphoramidate Azole Oligonucleotides for Single Nucleotide Polymorphism Detection by PCR. Int. J. Mol. Sci. 2024, 25, 617. https://doi.org/10.3390/ijms25010617
Chubarov AS, Baranovskaya EE, Oscorbin IP, Yushin II, Filipenko ML, Pyshnyi DV, Vasilyeva SV, Lomzov AA. Phosphoramidate Azole Oligonucleotides for Single Nucleotide Polymorphism Detection by PCR. International Journal of Molecular Sciences. 2024; 25(1):617. https://doi.org/10.3390/ijms25010617
Chicago/Turabian StyleChubarov, Alexey S., Elizaveta E. Baranovskaya, Igor P. Oscorbin, Ivan I. Yushin, Maxim L. Filipenko, Dmitrii V. Pyshnyi, Svetlana V. Vasilyeva, and Alexander A. Lomzov. 2024. "Phosphoramidate Azole Oligonucleotides for Single Nucleotide Polymorphism Detection by PCR" International Journal of Molecular Sciences 25, no. 1: 617. https://doi.org/10.3390/ijms25010617