Regulation and Role of Adiponectin Secretion in Rat Ovarian Granulosa Cells
Abstract
:1. Introduction
2. Results
2.1. FSH Stimulated Adiponectin Secretion through PKA Signaling in Rat Ovarian Granulosa Cells
2.2. AdipoRon Stimulated the Protein Expression of GLUTs and Glucose Absorption in Rat Ovarian Granulosa Cells
2.3. eCG Administration Significantly Stimulated Ovarian and Blood Adiponectin Levels during the Process of Hormone-Induced Ovarian Growth
2.4. Positive Correlation between Intraovarian Glucose Transporters and Adiponectin System in eCG-Injected Rats
3. Discussion
4. Methods
4.1. Animals
4.2. Primary Granulosa Cell Culture In Vitro
4.3. Histology
4.4. Immunohistochemistry
4.5. Glucose and Adiponectin Assay
4.6. Western Blot
4.7. Real-Time Quantitative PCR
4.8. Construction of Transcriptome Libraries
4.9. Transcriptome Analysis
4.10. Immunocytofluorescence
4.11. Statistical Analysis
5. Limitations of This Study
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
FSH | follicle-stimulating hormone |
PKA | protein kinase A system |
GLUTs | facilitative glucose transporters |
SLC2a | solute carrier family 2 member |
HIF | hypoxia inducible factor |
AMPK | adenosine 5′-monophosphate (AMP)-activated protein kinase |
DAPI | 4′,6-diamidino-2-phenylindole |
DMSO | dimethyl sulfoxide |
H89 | dihydrochloride |
FSK | Forskolin |
TC | theca cell |
GC | granulosa cell |
IC | interstitial cell |
O | oocyte |
eCG | equine chorionic gonadotropin |
AKT | protein kinase B |
ERK | extracellular signal-regulated kinase |
References
- Liu, Z.; Xiao, T.; Peng, X.; Li, G.; Hu, F. APPLs: More than just adiponectin receptor binding proteins. Cell Signal. 2017, 32, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Artimani, T.; Najafi, R. APPL1 as an important regulator of insulin and adiponectin-signaling pathways in the PCOS: A narrative review. Cell Biol. Int. 2020, 44, 1577–1587. [Google Scholar] [CrossRef]
- Fang, H.; Judd, R.L. Adiponectin regulation and function. Compr. Physiol. 2011, 8, 1031–1063. [Google Scholar]
- Lin, S.-C.; Hardie, D.G. AMPK: Sensing Glucose as well as Cellular Energy Status. Cell Metab. 2018, 27, 299–313. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zhao, S.; Zhang, Z.; Zhu, Y.; Gliniak, C.M.; Vishvanath, L.; An, Y.A.; Wang, M.-Y.; Deng, Y.; Zhu, Q.; et al. Adiponectin preserves metabolic fitness during aging. eLife 2021, 10, e65108. [Google Scholar] [CrossRef] [PubMed]
- Hajer, G.R.; van Haeften, T.W.; Visseren, F.L.J. Adipose tissue dysfunction in obesity, diabetes, and vascular diseases. Eur. Heart J. 2008, 29, 2959–2971. [Google Scholar] [CrossRef] [PubMed]
- Krause, M.P.; Milne, K.J.; Hawke, T.J. Adiponectin-Consideration for its Role in Skeletal Muscle Health. Int. J. Mol. Sci. 2019, 20, 1528. [Google Scholar] [CrossRef] [PubMed]
- Botta, A.; Elizbaryan, K.; Tashakorinia, P.; Lam, N.H.; Sweeney, G. An adiponectin-S1P autocrine axis protects skeletal muscle cells from palmitate-induced cell death. Lipids Health Dis. 2020, 19, 156. [Google Scholar] [CrossRef]
- Tanabe, H.; Fujii, Y.; Okada-Iwabu, M.; Iwabu, M.; Kano, K.; Kawana, H.; Hato, M.; Nakamura, Y.; Terada, T.; Kimura-Someya, T.; et al. Human adiponectin receptor AdipoR1 assumes closed and open structures. Commun. Biol. 2020, 3, 446. [Google Scholar] [CrossRef]
- Pilon, M. Paradigm shift: The primary function of the "Adiponectin Receptors" is to regulate cell membrane composition. Lipids Health Dis. 2021, 20, 43. [Google Scholar] [CrossRef]
- da Silva Rosa, S.C.; Liu, M.; Sweeney, G. Adiponectin Synthesis, Secretion and Extravasation from Circulation to Interstitial Space. Physiology 2021, 36, 134–149. [Google Scholar] [CrossRef]
- Kaiyrlykyzy, A.; Umbayev, B.; Masoud, A.-R.; Baibulatova, A.; Tsoy, A.; Olzhayev, F.; Alzhanova, D.; Zholdasbekova, G.; Davletov, K.; Akilzhanova, A.; et al. Circulating adiponectin levels, expression of adiponectin receptors, and methylation of adiponectin gene promoter in relation to Alzheimer’s disease. BMC Med. Genom. 2022, 15, 262. [Google Scholar] [CrossRef] [PubMed]
- Cheng, L.; Shi, H.; Jin, Y.; Li, X.; Pan, J.; Lai, Y.; Lin, Y.; Jin, Y.; Roy, G.; Zhao, A.; et al. Adiponectin Deficiency Leads to Female Subfertility and Ovarian Dysfunctions in Mice. Endocrinology 2016, 157, 4875–4887. [Google Scholar] [CrossRef] [PubMed]
- Das, N.; Kumar, T.R. Molecular regulation of follicle-stimulating hormone synthesis, secretion and action. J. Mol. Endocrinol. 2018, 60, R131–R155. [Google Scholar] [CrossRef] [PubMed]
- Merhi, Z.; Bazzi, A.A.; Bonney, E.A.; Buyuk, E. Role of adiponectin in ovarian follicular development and ovarian reserve. Biomed. Rep. 2019, 10, 337–342. [Google Scholar] [CrossRef]
- Ledoux, S.; Campos, D.B.; Lopes, F.L.; Dobias-Goff, M.; Palin, M.-F.; Murphy, B.D. Adiponectin induces periovulatory changes in ovarian follicular cells. Endocrinology 2006, 147, 5178–5186. [Google Scholar] [CrossRef]
- Chen, P.; Jia, R.; Liu, Y.; Cao, M.; Zhou, L.; Zhao, Z. Progress of Adipokines in the Female Reproductive System: A Focus on Polycystic Ovary Syndrome. Front. Endocrinol. 2022, 13, 881684. [Google Scholar] [CrossRef]
- Khoramipour, K.; Chamari, K.; Hekmatikar, A.A.; Ziyaiyan, A.; Taherkhani, S.; Elguindy, N.M.; Bragazzi, N.L. Adiponectin: Structure, Physiological Functions, Role in Diseases, and Effects of Nutrition. Nutrients 2021, 13, 1180. [Google Scholar] [CrossRef] [PubMed]
- Nishimoto, H.; Matsutani, R.; Yamamoto, S.; Takahashi, T.; Hayashi, K.G.; Miyamoto, A.; Hamano, S.; Tetsuka, M. Gene expression of glucose transporter (GLUT) 1, 3 and 4 in bovine follicle and corpus luteum. J. Endocrinol. 2006, 188, 111–119. [Google Scholar] [CrossRef]
- Wu, G.; Li, C.; Tao, J.; Liu, Z.; Li, X.; Zang, Z.; Fu, C.; Wei, J.; Yang, Y.; Zhu, Q.; et al. FSH mediates estradiol synthesis in hypoxic granulosa cells by activating glycolytic metabolism through the HIF-1α-AMPK-GLUT1 signaling pathway. J. Biol. Chem. 2022, 298, 101830. [Google Scholar] [CrossRef]
- Dupont, J.; Scaramuzzi, R.J. Insulin signalling and glucose transport in the ovary and ovarian function during the ovarian cycle. Biochem. J. 2016, 473, 1483–1501. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Tian, S.; Li, N.; Yang, Y.; Zhang, C. Effects of omega-3 polyunsaturated fatty acids on cellular development in human ovarian granulosa tumor cells (KGN). Front. Nutr. 2022, 9, 1017072. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, W.; Wang, Z.; Zheng, N.; Yuan, F.; Li, B.; Li, X.; Deng, L.; Lin, M.; Chen, X.; et al. Enhanced glycolysis in granulosa cells promotes the activation of primordial follicles through mTOR signaling. Cell Death Dis. 2022, 13, 87. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Fang, C.; Li, J.; Mo, C.; Wang, Y.; Li, J. Transcriptomic Diversification of Granulosa Cells during Follicular Development in Chicken. Sci. Rep. 2019, 9, 5462. [Google Scholar] [CrossRef]
- Holman, G.D. Structure, function and regulation of mammalian glucose transporters of the SLC2 family. Pflug. Arch. 2020, 472, 1155–1175. [Google Scholar] [CrossRef]
- Carbó, R.; Rodríguez, E. Relevance of Sugar Transport across the Cell Membrane. Int. J. Mol. Sci. 2023, 24, 6085. [Google Scholar] [CrossRef]
- Notarstefano, V.; Gioacchini, G.; Giorgini, E.; Montik, N.; Ciavattini, A.; Polidori, A.R.; Candela, F.A.; Vaccari, L.; Cignitti, M.; Carnevali, O. The Impact of Controlled Ovarian Stimulation Hormones on the Metabolic State and Endocannabinoid System of Human Cumulus Cells. Int. J. Mol. Sci. 2020, 21, 7124. [Google Scholar] [CrossRef]
- Heng, D.; Wang, Q.; Ma, X.; Tian, Y.; Xu, K.; Weng, X.; Hu, X.; Liu, W.; Zhang, C. Role of OCT4 in the Regulation of FSH-Induced Granulosa Cells Growth in Female Mice. Front. Endocrinol. 2019, 10, 915. [Google Scholar] [CrossRef]
- Poretsky, L.; Cataldo, N.A.; Rosenwaks, Z.; Giudice, L.C. The insulin-related ovarian regulatory system in health and disease. Endocr. Rev. 1999, 20, 535–582. [Google Scholar] [CrossRef]
- Liu, Y.; Vu, V.; Sweeney, G. Examining the Potential of Developing and Implementing Use of Adiponectin-Targeted Therapeutics for Metabolic and Cardiovascular Diseases. Front. Endocrinol. 2019, 10, 842. [Google Scholar] [CrossRef]
- Chadt, A.; Al-Hasani, H. Glucose transporters in adipose tissue, liver, and skeletal muscle in metabolic health and disease. Pflug. Arch. 2020, 472, 1273–1298. [Google Scholar] [CrossRef] [PubMed]
- Chabrolle, C.; Tosca, L.; Dupont, J. Regulation of adiponectin and its receptors in rat ovary by human chorionic gonadotrophin treatment and potential involvement of adiponectin in granulosa cell steroidogenesis. Reproduction 2007, 133, 719–731. [Google Scholar] [CrossRef] [PubMed]
- Messini, C.I.; Vasilaki, A.; Korona, E.; Anifandis, G.; Katsiani, E.; Georgoulias, P.; Dafopoulos, K.; Garas, A.; Daponte, A.; Messinis, I.E. Effect of adiponectin on estradiol and progesterone secretion from human luteinized granulosa cells in vitro. Syst. Biol. Reprod. Med. 2021, 67, 374–382. [Google Scholar] [CrossRef] [PubMed]
- Richards, J.S.; Liu, Z.; Kawai, T.; Tabata, K.; Watanabe, H.; Suresh, D.; Kuo, F.-T.; Pisarska, M.D.; Shimada, M. Adiponectin and its receptors modulate granulosa cell and cumulus cell functions, fertility, and early embryo development in the mouse and human. Fertil. Steril. 2012, 98, 471–479. [Google Scholar] [CrossRef]
- Keita, M.; Bessette, P.; Pelmus, M.; Ainmelk, Y.; Aris, A. Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer subtypes. J. Ovarian Res. 2010, 3, 3. [Google Scholar] [CrossRef] [PubMed]
- Seger, R.; Hanoch, T.; Rosenberg, R.; Dantes, A.; Merz, W.E.; Strauss, J.F.; Amsterdam, A. The ERK signaling cascade inhibits gonadotropin-stimulated steroidogenesis. J. Biol. Chem. 2017, 292, 8847. [Google Scholar] [CrossRef] [PubMed]
- Casarini, L.; Crépieux, P. Molecular Mechanisms of Action of FSH. Front. Endocrinol. 2019, 10, 305. [Google Scholar] [CrossRef] [PubMed]
- Duval, F.; Santos, E.D.; Poidatz, D.; Sérazin, V.; Gronier, H.; Vialard, F.; Dieudonné, M.-N. Adiponectin Inhibits Nutrient Transporters and Promotes Apoptosis in Human Villous Cytotrophoblasts: Involvement in the Control of Fetal Growth. Biol. Reprod. 2016, 94, 111. [Google Scholar] [CrossRef] [PubMed]
- Burkuš, J.; Navarrete Santos, A.; Schindler, M.; Babeľová, J.; Jung, J.S.; Špirková, A.; Kšiňanová, M.; Kovaříková, V.; Fischer, B.; Koppel, J.; et al. Adiponectin stimulates glucose uptake in mouse blastocysts and embryonic carcinoma cells. Reproduction 2020, 159, 227–239. [Google Scholar] [CrossRef]
- Achari, A.E.; Jain, S.K. Adiponectin, a Therapeutic Target for Obesity, Diabetes, and Endothelial Dysfunction. Int. J. Mol. Sci. 2017, 18, 1321. [Google Scholar] [CrossRef]
- Wang, T.; Wang, J.; Hu, X.; Huang, X.-J.; Chen, G.-X. Current understanding of glucose transporter 4 expression and functional mechanisms. World J. Biol. Chem. 2020, 11, 76–98. [Google Scholar] [CrossRef]
- Nicholas, D.A.; Knight, V.S.; Tonsfeldt, K.J.; Terasaka, T.; Molinar-Inglis, O.; Stephens, S.B.Z.; Trejo, J.; Kauffman, A.S.; Mellon, P.L.; Lawson, M.A. GLUT1-mediated glycolysis supports GnRH-induced secretion of luteinizing hormone from female gonadotropes. Sci. Rep. 2020, 10, 13063. [Google Scholar] [CrossRef]
- Bordbar, F.; Mohammadabadi, M.; Jensen, J.; Xu, L.; Li, J.; Zhang, L. Identification of Candidate Genes Regulating Carcass Depth and Hind Leg Circumference in Simmental Beef Cattle Using Illumina Bovine Beadchip and Next-Generation Sequencing Analyses. Animals 2022, 12, 1103. [Google Scholar] [CrossRef]
- Ahmadabadi, S.A.A.J.; Askari-Hemmat, H.; Mohammadabadi, M.; Fozi, M.A.; Mansouri, M. The Effect of Cannabis Seed on DLK1 Gene Expression in Heart Tissue of Kermani Lambs. 2023. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/20230347458 (accessed on 28 March 2024).
- Safaei, S.M.H.; Dadpasand, M.; Mohammadabadi, M.; Atashi, H.; Stavetska, R.; Klopenko, N.; Kalashnyk, O. An Origanum majorana Leaf Diet Influences Myogenin Gene Expression, Performance, and Carcass Characteristics in Lambs. Animals 2022, 13, 14. [Google Scholar] [CrossRef]
- Ott, R.; Stupin, J.H.; Melchior, K.; Schellong, K.; Ziska, T.; Dudenhausen, J.W.; Henrich, W.; Rancourt, R.C.; Plagemann, A. Alterations of adiponectin gene expression and DNA methylation in adipose tissues and blood cells are associated with gestational diabetes and neonatal outcome. Clin. Epigenetics 2018, 10, 131. [Google Scholar] [CrossRef]
- Galardo, M.N.; Riera, M.F.; Pellizzari, E.H.; Chemes, H.E.; Venara, M.C.; Cigorraga, S.B.; Meroni, S.B. Regulation of expression of Sertoli cell glucose transporters 1 and 3 by FSH, IL1 beta, and bFGF at two different time-points in pubertal development. Cell Tissue Res. 2008, 334, 295–304. [Google Scholar] [CrossRef]
- Lee, S.W.; Hwang, I.S.; Jung, G.; Kang, H.J.; Chung, Y.H. Relationship between metabolic syndrome and follicle-stimulating hormone in postmenopausal women. Medicine 2022, 101, e29216. [Google Scholar] [CrossRef]
- Cheng, Y.; Zhu, H.; Ren, J.; Wu, H.-Y.; Yu, J.-E.; Jin, L.-Y.; Pang, H.-Y.; Pan, H.-T.; Luo, S.-S.; Yan, J.; et al. Follicle-stimulating hormone orchestrates glucose-stimulated insulin secretion of pancreatic islets. Nat. Commun. 2023, 14, 6991. [Google Scholar] [CrossRef]
- Demers, G.; Griffin, G.; De Vroey, G.; Haywood, J.R.; Zurlo, J.; Bédard, M. Animal research. Harmonization of animal care and use guidance. Science 2006, 312, 700–701. [Google Scholar] [CrossRef]
- Laferriere, C.A.; Pang, D.S. Review of Intraperitoneal Injection of Sodium Pentobarbital as a Method of Euthanasia in Laboratory Rodents. J. Am. Assoc. Lab. Anim. Sci. 2020, 59, 254–263. [Google Scholar] [CrossRef]
- Yu, W.; Fan, S.; Wang, X.; Zhu, J.; Yuan, Z.; Han, Y.; Zhang, H.; Weng, Q. Seasonal change of circulating leptin associated with testicular activities of the wild ground squirrels (Citellus dauricus). Integr. Zool. 2023, 18, 76–92. [Google Scholar] [CrossRef] [PubMed]
- Fan, S.; Lu, W.; Zhang, H.; Yuan, Z.; Han, Y.; Weng, Q. Seasonal Change in Adiponectin Associated with Ovarian Morphology and Function in Wild Ground Squirrels (Citellus dauricus Brandt). Int. J. Mol. Sci. 2022, 23, 14698. [Google Scholar] [CrossRef] [PubMed]
- Xie, W.; Zhao, X.; Guo, L.; Han, Y.; Yuan, Z.; Zhang, H.; Weng, Q. Seasonal expressions of ERα, ERβ, EGF, EGFR, PI3K and Akt in the scent glands of the muskrats (Ondatra zibethicus). J. Steroid Biochem. Mol. Biol. 2021, 213, 105961. [Google Scholar] [CrossRef]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.-Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
Antibody | GC | TC | IC | O | ||||
---|---|---|---|---|---|---|---|---|
NC | eCG | NC | eCG | NC | eCG | NC | eCG | |
Adiponectin | − | +++ | − | + | − | ++ | − | ++ |
Accession Number | Gene Symbol | Primer Forward (5′-3′) | Primer Reverse (5′-3′) | Product Length |
---|---|---|---|---|
NM_138827 | Slc2a1 | AGGCCCTGGTCCTATTCCAT | CTTGTCACTTTGGCTGGCAC | 289 |
NM_012879 | Slc2a2 | TCATGTCGGTGGGACTTGTG | ACACGTAAGGCCCAAGGAAG | 252 |
NM_001412552 | Slc2a3 | CAGCTCCAGCAAGCAATTCG | AGCTACCTCAAACACACCCG | 137 |
NM_012751 | Slc2a4 | GGCTCTGACGTAAGGATGGG | AGTGTTCCAGTCACTCGCTG | 52 |
NM_207587 | Adipor1 | GTCCTGGTGGTGGCAGCGGCTT | CGGCCCGGAGGCTGTGCCAGTG | 266 |
NM_001037979 | Adipor2 | GACGGGCAACATTTGGACAC | AAAGGCAGAGAATGGCTCCC | 243 |
NM_022298 | Tubulin | GACTCGTCGTACTCCTGCTT | AAGACCTCTATGCCAACACC | 131 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Zhang, S.; Jia, Y.; Wang, X.; Liu, Y.; Zhang, H.; Yuan, Z.; Han, Y.; Weng, Q. Regulation and Role of Adiponectin Secretion in Rat Ovarian Granulosa Cells. Int. J. Mol. Sci. 2024, 25, 5155. https://doi.org/10.3390/ijms25105155
Zhou Y, Zhang S, Jia Y, Wang X, Liu Y, Zhang H, Yuan Z, Han Y, Weng Q. Regulation and Role of Adiponectin Secretion in Rat Ovarian Granulosa Cells. International Journal of Molecular Sciences. 2024; 25(10):5155. https://doi.org/10.3390/ijms25105155
Chicago/Turabian StyleZhou, Yue, Shuhao Zhang, Yurong Jia, Xi Wang, Yuning Liu, Haolin Zhang, Zhengrong Yuan, Yingying Han, and Qiang Weng. 2024. "Regulation and Role of Adiponectin Secretion in Rat Ovarian Granulosa Cells" International Journal of Molecular Sciences 25, no. 10: 5155. https://doi.org/10.3390/ijms25105155