1. Introduction
Phenols, ubiquitous secondary metabolites in plants, play a vital role in plant defense mechanisms [
1]. They enhance plant protection against various abiotic stresses, including reactive oxygen species [
2], drought [
3], and biotic stresses, like microbes [
4] and herbivores [
5].
Sparganium stoloniferum is a medicinal plant distributed in Asia, including China and Korea [
6,
7], known for its high tolerance to different environments [
8,
9,
10]. It has been used in China for over 1200 years, since the Tang Dynasty, to promote blood circulation and remove blood stasis. Interestingly, phenols, such as phenolic acids and flavonoids, are important bioactive substances found in the
S. stoloniferum rhizome (SL), exhibiting antiplatelet aggregation [
11,
12] and anticancer activities [
13,
14]. Therefore, phenols not only protect
S. stoloniferum from stress but also contribute to its medicinal properties.
Phenolic acids and flavonoids, as pharmaceutical substances in SL, originate from the phenylpropanoid biosynthesis pathway, which begins with aromatic amino acids, such as phenylalanine and tyrosine, the final products of the shikimate pathway [
15]. Therefore, amino acids serve as the foundation of phenol biosynthesis. Phenylalanine is initially converted to cinnamic acid by the deamination activity of phenylalanine ammonia-lyase (PAL, EC 4.3.1.24) [
16], followed by hydroxylation and frequent methylation activity of
trans-cinnamate 4-monooxygenase (C4H, EC 1.14.14.91) to produce
p-coumaric acid and other acids containing a phenylpropane (C6–C3) unit [
17]. Then,
p-coumaric acid is catalyzed by 4-coumarate: coenzyme A ligase (4CL, EC 6.2.1.12) to form
p-coumaroyl-CoA, which serves as a substrate for the biosynthesis of lignin and flavonoids [
18]. The accumulation of lignin and flavonoids in plants provides mechanical strength and chemical protection against harmful elements in the environment [
19]. During the process of lignin and flavonoid biosynthesis, various phenolic acids are generated to provide chemical defense [
20]. Therefore, phenylalanine ammonia-lyase (PAL), trans-cinnamate 4-monooxygenase (C4H), and 4-coumarate: coenzyme A ligase (4CL) are crucial enzymes influencing the biosynthesis of phenols in plants, affecting the defense and quality of the plant. The first three steps of the phenylpropanoid pathway are also referred to as the general phenylpropanoid pathway, which is linked to both the core and specialized metabolisms and provides precursors for all downstream metabolites [
20]. Apart from PAL, C4H, and 4CL, another crucial enzyme influencing flavonoid biosynthesis is flavonoid 3′,5′-hydroxylase (F3′5′H, EC 1.14.14.81), which hydroxylates the B-ring of flavonoids at the 3′- and 5′-position [
21].
During the growth of SL, the phenylpropanoid biosynthesis pathway and associated genes of differentially expressed proteins (DEPs) were notably active in the early growth stage. Additionally, differential metabolites (DMs) and differentially expressed genes (DEGs) were highly enriched in phenylpropanoid and flavonoid biosynthesis, and were upregulated during this stage, indicating the critical role of phenol biosynthesis in regulating SL growth. At the early growth stage of SL, DEGs and DEPs related to plant–pathogen interactions were upregulated, resulting in the increased generation of phenolic DMs [
22]. Therefore, the early growth stage is crucial, as it represents SL’s adaptation to the environment. In China, where
S. stoloniferum grows, the plant experiences abiotic stress, particularly long-term heat stress, with temperatures exceeding 30 °C at the early growth stage of SL. Previous research revealed significantly higher expression levels of genes related to phenol biosynthesis in the heat stress group compared to the non-stress group of SL, indicating heightened phenol biosynthesis under heat stress [
22]. Therefore, it is inferred that heat stress and pathogens can stimulate phenol biosynthesis to enhance SL defense. Furthermore, these stresses accompanying SL growth are significant factors contributing to the accumulation of phenolic bioactive substances in SL. The phenomenon of heat stress-induced accumulation of phenolic substances has been observed in various plant species. For instance, in
Artemisia sieberi alba, exposure to heat stress leads to increased accumulation of secondary metabolites, including phenols, flavonoids, and proline [
23]. Similarly, heat stress prompts the production of secondary metabolites, such as the tannins
Mentha piperita and
Catharanthus roseus [
24]. Furthermore, the situation wherein pathogen stress stimulates phenol production has also been found in other plants. Activities of enzymes involved in phenol biosynthesis, such as phenylalanine ammonia lyase and polyphenol oxidase, are heightened, leading to an increase in total phenolic content in chickpeas under the stress induced by
Pseudomonas,
Trichoderma, and
Rhizobium strains [
4]. Therefore, it is important to assess the impact of heat stress and pathogen stress on SL.
Here, we aimed to validate the changes in phenolic metabolite content when DEGs related to plant–pathogen interactions were upregulated or when high temperatures occurred, to confirm whether heat stress and microbial stress could induce phenol accumulation in SL, resulting in higher contents of bioactive phenols. The relationships between metabolite biosynthesis and gene regulation concerning phenols were elucidated using stress and growth models of SL. Additionally, the key defense genes C4H, 4CL, and F3′5′H from S. stoloniferum (SsC4H, Ss4CL, and SsF3′5′H) were cloned. The recombinant proteins SsC4H, Ss4CL and SsF3′5′H were expressed, and their functions were validated. Ss4CL exhibited a strong affinity for the substrate p-coumaric acid and efficiently catalyzed its conversion to p-coumaroyl-CoA. Overall, our results elucidate the phenolic defense mechanisms of SL under heat stress and microbial stress, revealing the formation mechanisms of bioactive phenols in SL. Therefore, our findings provide valuable evidence and new insights to improve the quality of the herbal medicine SL.
3. Discussion
Previous research indicated that DEGs related to plant–pathogen interaction pathways were upregulated when the phenol-based chemical defense was active at the early growth stage of SL [
22]. To validate the role of phenols in the growth and defense mechanisms of SL and the conclusion that phenols are synthesized as a chemical defense mechanism during the early growth stage of SL, targeted LC–MS/MS metabolomics was employed to detect phenol and amino acid content in SL at different growth stages. The determination results are consistent with that observed in untargeted LC–MS/MS metabolomics, indicating notably higher levels of phenolic acids and flavonoids during the early growth stage compared to later stages. Similarly, amino acids, such as phenylalanine, leucine, and proline, known for their role in plant stress response [
34,
35,
36], exhibited higher levels during the early growth stage of SL. Phenylalanine, the most abundant amino acid in SL, serves as a precursor to phenylpropanoid biosynthesis [
20], indicating active phenylpropanoid pathway activity in SL. Phenylalanine undergoes PAL deamination to produce
trans-cinnamic acid [
16], which further undergoes C4H oxidation and 4CL coenzyme A linkage, generating a series of lignin phenol precursors that are then transformed into diverse phenolic components by various phenol synthesis enzymes [
15]. Phenolic components play a crucial role as chemical defense agents in plants [
2,
4], with phenylalanine serving as a key defensive amino acid component in SL. Content analysis revealed that phenylalanine is the predominant amino acid component in SL, and both phenylalanine and most phenolic components exhibit higher levels during the early growth stage of SL compared to later stages, suggesting a greater reliance on phenolic compounds for chemical defense during early growth stages. Numerous studies have shown that many amino acids stored in plants are susceptible to various abiotic stresses [
36,
37]. Under stress conditions, plants experience elevated levels of proline and other amino acids [
23,
35]. Proline accumulation serves as an osmoprotectant, shielding plants from adverse environmental conditions, such as low and high temperatures, salinity, UV radiation, and osmotic stress [
34,
38]. Alanine enhances plant resistance to stress, boosts adaptability to environmental challenges, regulates the antioxidant system, and mitigates stress-induced damage, thereby bolstering overall resistance [
39]. The content of alanine and proline, amino acids abundant in SL, decreased as SL grew, suggesting a requirement for chemical defenses in the early growth stages to support the plant’s defense function. This observation supports the conclusion that SL primarily relies on chemical defense mechanisms during its early growth stages, alongside alterations in phenolic composition. Phenolic compounds, known for their pharmacological activity in SL [
11,
12,
13,
14], accumulate during the development of the medicinal herb, exhibiting a distinct pattern of content accumulation and gene regulation. The growth environment is complex, yet few diseases occur in SL, which are closely linked to its defense mechanisms. A primary mechanism for plants to combat stress involves reinforcing cell walls to create a physical barrier, bolstering resistance to abiotic stress [
40] and biotic stress [
4,
41,
42]. During the early growth stages of SL, characterized by low tissue hardness and high demand for lignin biosynthesis, the phenylpropanoid synthesis pathway is activated to produce lignin phenolic precursors with chemical defense properties, compensating for the lack of physical defense. Results from transcriptomic, proteomic, non-targeted metabolomic, and targeted metabolomic analyses collectively confirm the activation of phenolic chemical defense mechanisms during the early growth stages of SL [
22]. With the growth of SL, the levels of phenolic substances and defensive amino acids decline significantly, highlighting the combined defense mechanisms involving physical reinforcement of cell walls through lignin and the chemical defense of SL. The need for lignin synthesis results in the production of lignin phenolic precursors, serving as defensive compounds in SL and active ingredients in medicinal herbs, exhibiting pharmacological effects, such as anticoagulant and anticancer properties [
11,
12,
13,
14].
In response to rapid environmental changes, genes involved in the phenylpropanoid biosynthesis pathway are rapidly upregulated, leading to the accumulation of phenolic compounds [
43]. Studies have shown that exposure of plants to stress induces an increase in the production of phenolic compounds, which serve as defensive responses against pathogens under stress conditions [
44]. The results of this study are consistent with previous findings, indicating that the rapid upregulation of phenol biosynthesis genes is a plant response to adverse environmental factors, particularly as a crucial defense strategy against biotic and abiotic stress. Following microbial and heat stress treatments, changes in phenolic compounds were accompanied by the consumption of amino acid compounds. These changes were more significant in the microbial stress group compared to the heat stress group, suggesting that amino acid compounds are likely consumed and transformed after stress, providing a material basis for plant resistance. The response of plants to microbial stress was stronger than that to heat stress, indicating a higher intensity of the chemical defense response is needed to supplement the relatively weaker physical defense against microbial stress. Microbial stress directly impacts the rhizosphere soil and water environment, while heat stress affects the entire plant through air temperature regulation, with a weaker direct impact on water-growing plants compared to microbial stress. Phenols detected in this study included phenolic acids and flavonoids, with phenolic acids and flavonoids both at high levels in SL at the early growth stage, which is sensitive to the environment, indicating that phenols are crucial for SL to respond to the environment. However, the accumulation of phenolic acids and flavonoids was different when SL was exposed to heat stress or microbial stress, while the genes related to phenolic acids and flavonoid biosynthesis, like
PAL,
4CL,
C3′H,
CSE,
COMT,
CCoAOMT, and
CHS, were all upregulated. Gene expression could show a delayed effect on the eventual synthesis of secondary metabolites. According to previous research, post-transcriptional and post-translational mechanisms play roles in regulating SL growth [
22]. Furthermore, a similar phenomenon appeared in other plants, and a low correlation was shown between relative contents of monoterpene secondary metabolites and the expression of related genes in
Agastache rugosa due to detected genes located in the middle to upper reaches of the monoterpene biosynthesis pathway; the expression of these genes often has a lagging effect on the final formation of secondary metabolites [
45]. An asynchronous relationship existed between the gene expression level and relative contents in
Nepeta tenuifolia; genes showed different patterns to related metabolites. For instance,
IPR gene showed a sinusoidal expression pattern; however, the relative content of the direct product (2
S, 5
S)-isopulegone decreased gradually. The accumulation of (−)-pulegone dropped sharply and (+)-menthone showed a steep increase, but the expression of
NtPR gene was relatively low at this time point [
46]. Our results were identical to those of previous studies. In this study, most of the genes selected for the RT–qPCR analysis are involved in the phenylpropanoid pathway, which is upstream of the flavonoid synthesis pathway, sharing the general phenylpropanoid pathway. The
CHS and
CHI genes are genes located at the upstream of flavonoid synthesis pathway; therefore, the contents of flavonoids in SL under heat stress and microbial stress differed from the expression level of related genes. Based on the expression level of phenol biosynthesis related genes and the accumulation of phenolic metabolites during growth, it is still clear that phenol could be biosynthesized by SL in response to heat stress and microbial stress.
In previous research, when SL were exposed to heat stress, genes associated with phenol biosynthesis, such as
PAL,
4CL,
C3′H,
CSE,
COMT,
CCoAOMT, and
CHS, were upregulated briefly, while downstream genes related to lignin biosynthesis,
CCR, and
CAD, were downregulated [
22]. In this study, under microbial stress, the expression of genes related to phenol biosynthesis and downstream genes associated with lignin biosynthesis mirrored those observed under heat stress, indicating that both microbial and heat stresses can induce the synthesis of phenolic compounds in SL, affecting its chemical defense in the short term. This phenomenon does not only occur in SL; for example, in chickpea, the activity of proteins involved phenol biosynthesis was upregulated after microbial stress [
4]. Rapid upregulation of genes in the phenylpropanoid pathway and the accumulation of phenolics can be observed in response to environmental stress [
43]. LC–MS/MS analysis results also supported the hypothesis by confirming an increase in phenolic content in stressed SL. However, neither microbial nor heat stress promoted lignin biosynthesis at the gene level in the short term, possibly because the stress duration was too brief for SL to adjust lignin biosynthesis to a new equilibrium. This also suggests that the rate of physical defense formation in SL is slower compared to chemical defense. Therefore, the formation of a plant’s physical defense is relatively slow, whereas chemical defense can rapidly occur in response to stress.
SL synthesizes phenolic substances as a chemical defense mechanism, forming the foundation of its medicinal properties. The biosynthesis of phenolic compounds necessitates the general phenylpropanoid pathway, facilitated by PAL, C4H, and 4CL enzymes. These enzymes undergo significant upregulation during early SL growth, as well as under microbial and heat stress conditions, crucially contributing to phenolic substance synthesis. The catalytic function of Ss4CL in converting phenylalanine to
trans-cinnamic acid has been confirmed. To assess the function of Ss4CL, heterologous expression was performed in
E. coli. BL21 (DE3) cells. Enzyme kinetics analysis revealed that, under optimal conditions, Ss4CL exhibits a high substrate affinity for
trans-cinnamic acid with a
Km of 1.28 mmol·L
−1. Ss4CL catalyzes the formation of cinnamoyl-CoA from
trans-cinnamic acid and CoA. 4CL is a key enzyme in the phenylpropanoid biosynthesis pathway, catalyzing the formation of cinnamoyl-CoA,
p-coumaroyl-CoA, caffeoyl-CoA, feruloyl-CoA, 5-hydroxyferuloyl-CoA, and sinapoyl-CoA from cinnamic acid,
p-coumaric acid, caffeic acid, ferulic acid, 5-hydroxyferulic acid, and sinapic acid, respectively [
47]. These compounds serve as precursors in lignin biosynthesis, undergoing subsequent conversions into corresponding aldehydes and alcohols catalyzed by COMT, CCoAMOT, CCR, and CAD enzymes. The synthesis of
p-coumaroyl-CoA from
trans-cinnamic acid serves as a shared precursor for three monolignols and flavonoids, highlighting the role of 4CL in influencing their synthesis and contributing significantly to SL defense mechanisms and the production of medicinal phenolic compounds. Under optimal conditions, the
Vmax value for the
p-coumaric acid reaction catalyzed by Ss4CL was 7.34 nKat·mg
−1, higher than those for Sm4CL1 and Sm4CL2 from
Salvia miltiorrhiza [
18].
The C4H protein family plays a crucial role in the phenylpropanoid biosynthesis pathway in plants, catalyzing the conversion of
trans-cinnamic acid to
p-coumaric acid. It initiates the first oxidation step in the phenylpropanoid biosynthesis pathway, preceding the 4CL enzyme reaction. F3′5′H is crucial in flavonoid synthesis, catalyzing hydroxylation reactions at the 3′ and 3′ and 5′ positions on the B-ring of flavonoids [
21]. Because of its diverse substrates and resulting product variety, it plays a crucial role in flavonoid synthesis. Considering that both SsC4H and SsF3′5′H belong to the cytochrome P450 family, eukaryotic expression systems are preferable for their expression. We selected the yeast WAT11 for expressing SsC4H and SsF3′5′H proteins. However, since SsC4H and SsF3′5′H were localized in the microsomes, it is difficult to purify recombinant SsC4H and SsF3′5′H, so we conducted substrate-fed enzyme activity experiments. Enzyme activity experiments with Ss
C4H and SsF3′5′H proteins revealed that SsC4H efficiently catalyzes the conversion of
trans-cinnamic acid to
p-coumaric acid, while SsF3′5′H hydroxylates naringenin and eriodictyol to produce apigenin and luteolin, respectively.
This study demonstrates that both heat stress and microbial stress induce the production of phenolic compounds in SL for chemical defense. The mechanism of phenolic defense production is analogous to the chemical defense mechanism employed by SL during the early growth stage. Research has demonstrated that the phenolic chemical defense barrier forms more rapidly in SL compared to physical defense mechanisms based on lignin. This suggests that the accumulation of secondary metabolites serves not only as a plant adaptation to the environment but also as a defense strategy employed by the plant itself. Pharmacologically active phenolic substances produced as a result of SL’s defense physiological activities confer medicinal value, rendering it a natural herb abundant in phenolic compounds. This offers novel insights into cultivating high-quality SL medicinal materials.
4. Materials and Methods
4.1. LC–MS/MS Analysis of SL at Different Growth Stages
The SL samples at different growth stages for LC–MS/MS analysis were S. stoloniferum rhizome obtained from the botanical garden of Nanjing University of Chinese Medicine in June, September, and December 2021. Healthy S. stoloniferum plants were selected and cleaned using ddH2O, and then the S. stoloniferum rhizomes were cut into 5 mm pieces, dried at 40 °C for 48 h, and ground into powder, before being named SL6, SL9, and SL12. Standard SL material was bought from Solarbio Science & Technology Co., Ltd., Beijing, China, named BZYC, and set as the control sample. An accurate weighing of 2 g of solid sample was performed, followed by extraction of metabolites using a solution (methanol:water, 4:1, v/v). The mixture was extracted by refluxing extraction for 1 h, and the solvent was removed by rotary steaming and dried by nitrogen blowing. The precipitation was redissolved in methanol to a final volume of 5 mL and was then filtered by a 0.22 μm nylon membrane. The supernatant and the supernatant diluted 20-fold were ready for LC–MS/MS analysis.
Information on the
p-coumaric acid standard substances is shown in
Table S5. Apart from the amino acid mixed solution standard substance, all other standard substances were prepared with 50% methanol to form a 1 mg·mL
−1 single standard solution. Then, accurately, 100 μL of the 1 mg/mL single standard solution was taken and made up to 10 mL with 50% methanol, resulting in a 10 μg·mL
−1 mixed standard solution A. Accurately, 1 mL of the 100 μg·mL
−1 amino acid mixed solution standard substance mother liquor was mixed with 9 mL of 50% methanol to obtain a 10 μg·mL
−1 mixed standard solution B. Accurately, 100 μL of mixed standard solution A and 100 μL of mixed standard solution B were combined with 800 μL of 50% methanol to produce a 1 μg·mL
−1 mixed standard solution C. The concentrations mentioned above were theoretical concentrations. The actual concentrations of the standard substance configuration information and the mixed standards are shown in
Tables S6 and S7. Due to the inclusion of phenylalanine during single standard weighing and the presence of phenylalanine in the amino acid mixed standard substance, the concentration of phenylalanine in mixed standard solution C is 2.6917 μg·mL
−1.
The instrument platform for LC–MS/MS analysis consisted of the AB Sciex ExionLC™ AD UHPLC and AB Sciex Qtrap 5500 system. The sample was separated using an Eclipse Plus C18 column (4.6 mm I.D. × 100 mm, 3.5 μm) and then entered into mass spectrometry detection. The mobile phases consisted of methanol (solvent A) and 0.1% formic acid in 5 mM ammonium acetate (solvent B). The solvent gradient changed according to the following conditions: from 0 to 4 min, 91% B; from 4 to 6 min, 91% B to 79% B; from 6 to 10 min, 79% B to 65% B; from 10 to 12 min, 65% B to 62% B; from 12 to 16 min, 62% B to 54% B; from 16 to 20 min, 54% B to 36% B; from 20 to 21 min, 36% B to 5% B for equilibrating the systems. The sample injection volume was 5 µL and the flow rate was set to 0.8 mL·min
−1. The column temperature was maintained at 40 °C. During the period of analysis, all samples were stored at 4 °C. Three technical replicates were used. A spectrometer equipped with an electrospray ionization (ESI) source operated in either positive or negative ion mode. The optimal conditions in positive ion mode were set as follows: CUR 35 psi, TEM 600 °C, GS1 55 psi, GS2 55 psi, ISVF 4500 V, CAD 9 psi, EP −10 V. The optimal conditions in negative ion mode were set as follows: CUR 35 psi, TEM 600 °C, GS1 55 psi, GS2 55 psi, ISVF −4500 V, CAD 9 psi, EP −10 V. The mass spectrometry parameters for all tested compounds after optimization are shown in
Table S8.
Data were analyzed using SCIEX OS-Q software (Version 1.4.0.18067). Three biological replicates were used. A t-test was conducted for the comparison of groups and a p value ≤ 0.05 was regarded as statistically significant. Statistical analyses were performed, and graphs were generated using GraphPad Prism software (version 9.0).
4.2. DNA Extraction, PCR Amplification and 16S rRNA Sequencing
Three SL growth areas were selected, including the eastern area (Dongyang City, Zhejiang Province, E 120°19′12″, N 29°16′48″, altitude 85 m), the southern area (Shangrao City, Jiangxi Province, E 117°40′12″, N 28°30′36″, altitude 235 m), and the central area (Yueyang City, Hunan Province, E 112°30′36”, N 28°31′12″, altitude 28 m). Each sampling site was divided into three 5 m2 plots with 10 m intervals, and three replicates were taken. Soil samples were collected using a soil sampler at five points within each plot following the diagonal five-point method. The soil was sampled at a depth of 5–10 cm below ground and 0–20 cm near SL, mixed uniformly, and one-fifth of the mixture was taken as a single soil sample. Soil samples collected from Dongyang City, Shangrao City and Yueyang City were named SDY, SHF, and SYY, respectively. A total of 200 mg of each soil sample was taken, placed in a sterile tube, mixed with 1 mL 70% ethanol, centrifuged at 10,000× g at room temperature for 3 min, and then the upper liquid was discarded. PBS solution was added and centrifuged at 10,000× g at room temperature for 3 min, and then the upper liquid was discarded. The tube was inverted for 1 min until no liquid flowed out. The sample tube was placed in a 55 °C oven for 10 min. DNA extraction was carried out using the E.Z.N.A™ Mag-Bind Soil DNA Kit (Omega, New York, NY, USA), and the soil microbial genomic DNA was quantified precisely using the Qubit 3.0 DNA quantitation assay kit (Life, Lewisburg, PA, USA, USA).
The primers used in PCR were the V3-V4 universal primers of the Miseq sequencing platform: 341F primer—CCCTACACGACGCTCTTCCGATCTG (barcode) CCTACGGGNGGCWGCAG and 805R primer—GACTGGAGTTCCTTGGCACCCGAGAATTCCAGACTACHVGGGTATCTAATCC. The PCR reaction system was 30 μL, with the components in each tube being as follows: DNA template 20 ng, 2×Taq Master Mix 15 µL, Bar-PCR primer F (10 μM) 1 μL, primer R (10 μM) 1 μL, finally made up to 30 µL with water. The amplification program was as follows: 94 °C, 3 min; 94 °C for 30 s, 45 °C for 20 s, 65 °C for 30 s, 5 cycles; then 94 °C for 20 s, 55 °C for 20 s, 72 °C for 30 s, 20 cycles; finally 72 °C for 5 min. The second round of PCR introduced Illumina bridge PCR-compatible primers. The second round PCR reaction system was 30 μL, with the components in each tube being as follows: DNA template 20 ng, 2×Taq Master Mix 15 µL, Bar-PCR primer F (10 μM) 1 μL, Primer R (10 μM) 1 μL, finally made up to 30 µL with water. The amplification program was as follows: 94 °C, 3 min; 94 °C for 20 s, 55 °C for 20 s, 72 °C for 30 s, 5 cycles; then 72 °C for 5 min.
The PCR products were purified using Agencourt AMPure XP beads (Beckman, Brea, CA, USA). A volume of magnetic beads that was 0.6 times the volume of the 25 μL PCR product was added and mixed well. The tube was placed on a magnetic stand for 5 min, and then the supernatant was carefully removed. A total of 30 μL wash buffer was added and mixed well. The tube was placed on a magnetic stand for 5 min, and then the supernatant was carefully removed. A total of 90 μL of 70% ethanol was added, and then the tube was placed on the magnetic stand to allow the magnetic beads to be adsorbed to the other side of the PCR tube. The supernatant was removed, and then the tube was placed in a 55 °C oven for 5 min. A total of 30 μL elution buffer was added, and then the tube was placed on a magnetic stand for 5 min. The supernatant was transferred to a clean 1.5 mL centrifuge tube. The recovered DNA was quantified using the Qubit 3.0 DNA assay kit (Life, USA). For sequencing, a total of 10 ng of DNA from each sample was taken, and the final DNA concentration for sequencing was 20 pmol.
4.3. Sequence Analysis and Taxonomic Identification of the Bacterial Community
Sample sequences were differentiated by barcodes. Firstly, the primers and adapter sequences were removed. Then, the paired reads are merged into a single sequence based on the overlap relationship between paired-end reads. Subsequently, quality control was applied to filter each sample sequence, removing nonspecific amplification sequences and chimeras to obtain valid data for further data analysis. Sequences were clustered based on distances, and then grouped into OTUs using cluster similarity at 0.97. Representative sequences were chosen from each OTU cluster based on their abundance, and alpha diversity analysis was performed using the OTU abundance data from each sample. Alpha diversity indexes, including Chao, ACE, Simpson, and Shannon were used, and coverage was calculated using Mothur (Version 1.48.1).
4.4. Pseudomonas Syringae Microbial Stress on SL
S. stoloniferum sample in this section was collected from the botanical garden of the Nanjing University of Chinese Medicine. The aboveground parts were trimmed, and healthy and uniform-sized rhizomes were selected and rinsed with tap water before being planted in nutrient soil in a cultivation water basin for germination. During this period, the water depth was maintained at 3–5 cm, and the plants were cultivated in a greenhouse with air temperatures ranging from 20 °C at 6 a.m. to 30 °C at 2 p.m. After germination, seedlings with similar growth were selected, transplanted into new pots, and cultivated for 35 days. The P. syringae pattern strain (strain number: SHBCC D10978; Shanghai Bioresource Collection Center, Shanghai, China) was cultivated on nutrient agar at 30 °C for 2 days until a bacterial lawn formed. The lawns were harvested and resuspended to an optical density of 0.2 at 600 nm. The bacterial solution was sprayed onto the soil of S. stoloniferum plants in the microbial stress group, and the SL sample was named PS. The negative control group was sprayed with water instead of P. syringae bacterial solution, and the sample was named BL. The rhizomes were collected 3 days after the initial infection.
4.5. LC–MS/MS Analysis of Microbial and Heat Stress SL
The PS and BL samples for LC–MS/MS analysis were the samples taken after microbial stress and non-stress treatment in
Section 4.4; then, the
S. stoloniferum rhizomes were cleaned with ddH
2O, cut into 5 mm pieces, dried at 40 °C for 48 h, and ground into powder. The HT sample for LC–MS/MS analysis was
S. stoloniferum collected from the botanical garden of the Nanjing University of Chinese Medicine. The aboveground parts were trimmed, and healthy and uniform-sized rhizomes were selected and rinsed with tap water before being planted in nutrient soil in a cultivation water basin for germination. During this period, the water depth was maintained at 3–5 cm, and the plants were cultivated in a greenhouse with air temperatures ranging from 20 °C at 6 a.m. to 30 °C at 2 p.m. After germination, seedlings with similar growth were selected, transplanted into new pots, and cultivated for 35 days in the greenhouse with air temperatures ranging from 20 °C at 6 a.m. to 30 °C at 2 p.m.
S. stoloniferum plants in the heat stress group were cultivated in a greenhouse with air temperatures ranging from 25 °C at 6 a.m. to 40 °C at 2 p.m.
S. stoloniferum plants in the negative control group were cultivated in a greenhouse with air temperatures ranging from 20 °C at 6 a.m. to 30 °C at 2 p.m. Then, the
S. stoloniferum rhizomes were cut into 5 mm pieces, dried at 40 °C for 48 h, and ground into powder. An accurate weighing of 1 g solid sample was performed, followed by the extraction of metabolites using a solution (ethanol:water, 3:2,
v/
v). The mixture was ultrasounded at 40 kHz for 60 min. After centrifugation at 10,000×
g at 4 °C for 15 min, the supernatant was filtered using a 0.22 μm nylon membrane. The supernatant and the supernatant diluted 20-fold were ready for LC–MS/MS analysis.
The LC–MS/MS analysis method was the same as in
Section 4.1. Data were analyzed using SCIEX OS-Q software (Version 1.4.0.18067). Three biological replicates were used. ANOVA was conducted for comparison of groups and a
p value ≤ 0.05 was regarded as statistically significant. Statistical analyses were performed, and graphs were generated using GraphPad Prism software (version 9.0).
4.6. RT–qPCR Analysis of Microbial Stress SL
The PS and BL samples for LC–MS/MS analysis were the samples taken after microbial stress and non-stress treatment in
Section 4.4; then, the
S. stoloniferum rhizomes were cleaned via ddH
2O and cut into 5 mm pieces for RNA extraction. RNA extraction, cDNA synthesis, and RT–qPCR of SL samples under microbial stress group and negative control group were performed, and the primers and methods were the same as those described in the literature [
22].
4.7. Identification and Enzymatic Activity Assay of Recombinant Protein Ss4CL
BamH I and EcoR I restriction enzyme sites on both the Ss4CL gene-coding region and the pET28a expression vector were analyzed using SnapGene software (version 4.2.4). The selected restriction enzyme sites were used for vector construction, and the Ss4CL-CDS primer pair sequences are listed as follows: Ss4CL-CEF—CAGCAAATGGGTCGCGGATCCATGGGTTCGGTTAATTCGCC and Ss4CL-CER—TTGTCGACGGAGCTCGAATTCTTAAGCTGTAAGTCTTGCTCTCAGATC. The pET28a-Ss4CL recombinant vector was transformed into Escherichia coli DH5α competent cells (Tsingke, Beijing, China). Positive colonies were confirmed by PCR and sequenced by Shanghai Sangon Biotech Co., Ltd., Shanghai, China. Then, the pET28a-Ss4CL recombinant vector was transformed into E. coli BL21 (DE3) chemically competent cells (Tsingke, China) to induce expression. Protein expression was analyzed using 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The recombinant Ss4CL protein was purified using a BBI Ni-NTA gravity column (Sangon, Shanghai, China), BBI binding/wash buffer (Sangon, China), and BBI elution buffer (Sangon, China). The protein concentration was determined using a BCA protein quantitation assay kit (KeyGEN, Nanjing, China).
The standard substance of
p-coumaryl-CoA (Lot number: A14IS222210) was purchased from Shanghai Yuanye Biotechnology Co., Ltd., Shanghai, China. Information on the
p-coumaric acid standard substances is shown in
Table S5. In 100 mM Tri-HCl buffer (pH 7.4), 100 mM MgCl
2, 100 mM ATP, 10 mM CoA, different
p-coumaric acid concentrations were added as substrates, and approximately 10 μg of recombinant Ss4CL were added to reach a total volume of 1 mL. The reaction was carried out at 45 °C for 30 min, and absorbance was measured at 334 nm using an ultraviolet–visible spectrophotometer to calculate
Km,
Vmax,
Kcat, and
Kcat/
Km. The products from enzymatic reactions using the recombinant Ss4CL proteins and two negative controls, including the products from enzymatic reactions using the boiled recombinant Ss4CL proteins and the products from enzymatic reactions using the pET28a vector, were analyzed by an instrument platform for quantitative LC–MS/MS analysis, consisting of an ExionLC™ AD UHPLC System (AB Sciex, Framingham, MA, USA) and an AB Sciex Qtrap 5500 (AB Sciex, USA). Samples were separated using a ZORBAX Eclipse Plus C
18 column (2.1 mm I.D. × 50 mm, 1.8 μm) and analyzed by mass spectrometry. The mobile phase consisted of methanol (solvent A) and 0.1% formic acid in 5 mM ammonium acetate (solvent B). To equilibrate the systems, the solvent gradient was changed according to the following conditions: from 0–0.5 min, 90% B; from 0.5–3.5 min, 90% B to 0% B; from 3.5–4 min, 0% B; from 4–4.1 min, 0% B to 90% B; from 4.1–5 min, 90% B. The sample injection volume was 5 µL and the flow rate was set to 0.3 mL·min
−1. The column temperature was maintained at 40 °C. All samples were stored at 4 °C during the analysis period. Mass spectrometric data were collected in negative ion mode. Mass spectrometric data were collected in positive and negative ion modes. The optimal positive conditions were set as follows: CUR 10 psi, TEM 400 °C, GS1 30 psi, GS2 30 psi, ISVF 4500 V, CAD 10 psi, EP 10 V. The optimal negative conditions were set as follows: CUR 10 psi, TEM 400 °C, GS1 30 psi, GS2 30 psi, ISVF −4500 V, CAD 10 psi, EP −10 V. The optimized mass spectrum parameters of
p-coumaric acid were shown in
Table S8. For
p-coumaryl-CoA, Q1 Mass was 914.7 Da, Q3 Mass was 407.3 Da and 428.1 Da, DP was 150 V, CE was 42.85 V and 42.92 V, and CXP was 15 V. Data were analyzed using SCIEX OS-Q software (Version 1.4.0.18067). Three biological replicates were used.
4.8. Indentication and Enzymatic Activity Assay of Recombinant Protein SsC4H and SsF3′5′H
BamH I and EcoR I restriction enzyme sites on both the SsC4H and SsF3′5′H gene-coding region and the pYedp60 expression vector were analyzed using SnapGene software. The selected restriction enzyme sites were used for vector construction and the SsC4H-CDS primer pair sequences and SsF3′5′H-CDS primer pair sequences are listed as follows: SsC4H-CEF—ACACACTAAATTACCGGATCCTTATCTATAGCCTTGGACTAGGTAGTAGTAGT, SsC4H-CER—TGGGAGATCCCCCGCGAATTCATGGATCTCCTCCTCCTCGAGA, SsF3′5′H-CEF—ACACACTAAATTACCGGATCCGCTGATAGACTTTATTTAATATAGGATTTATTCA and SsF3′5′H-CER—TGGGAGATCCCCCGCGAATTCTCATTCATAAGCTGCACGCACA. PCR amplification was performed using SL cDNA as a template. After detection by 1% agarose gel electrophoresis, the PCR product was recovered and ligated into the pCE2-TA Blunt-Zero vector (Vazyme, Nanjing, China). The recombinant plasmid was transformed into E. coli DH5α competent cells (Tsingke, China). Positive colonies were confirmed by PCR and sequenced by Shanghai Sangon Biotech Co., Ltd. After confirming the sequence, the pYedp60-SsC4H recombinant vector and pYedp60-SsF3′5′H recombinant vector was transformed into WAT11 chemically competent cells to induce expression, respectively.
Here,
trans-Cinnamic acid standard substance (Lot number: Y11M10C88100) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. Information on apigenin, luteolin, naringenin, eriodictyol, and
p-coumaric acid standard substances are shown in
Table S5. Then,
trans-Cinnamic acid was added into pYedp60-
SsF3′5′H-WAT11 bacterial solution as a substrate up to a final concentration of 0.5 mM. Naringenin and apigenin were added into pYedp60-
SsF3′5′H-WAT11 bacterial solution as substrates to a final concentration of 0.5 mM, respectively. The reaction was carried out at 16 °C and 150 rpm for 12 h. The products from enzyme activity reactions using the recombinant target proteins and two negative controls including the products from enzymatic reactions using the boiled recombinant target proteins and the products from enzymatic reactions using pYedp60 vector were analyzed by an instrument platform for quantitative LC–MS/MS analysis consisting of an ExionLC™ AD UHPLC System (AB Sciex, USA) and an AB Sciex Qtrap 5500 (AB Sciex, USA). Samples were separated using a ZORBAX Eclipse Plus C
18 column (2.1 mm I.D. × 50 mm, 1.8 μm) and analyzed by mass spectrometry. The mobile phase consisted of methanol (solvent A) and 0.1% formic acid in 5 mM ammonium acetate (solvent B). To equilibrate the systems, the solvent gradient was changed according to the following conditions: from 0 to 1 min, 95% B; from 1 to 4 min, 95% B to 5% B; from 4 to 4.1 min, 5% B to 95% B; from 4.1 to 6 min, 95% B. The sample injection volume was 5 µL and the flow rate was set to 0.3 mL·min
−1. The column temperature was maintained at 40 °C. All samples were stored at 4 °C during the analysis period. Mass spectrometric data were collected in negative ion mode. Mass spectrometric data were collected in negative ion mode. The optimal negative conditions were set as follows: CUR 10 psi; TEM 400 °C; GS1 30 psi; GS2 30 psi; ISVF −4500 V; CAD 10 psi; EP −10 V. The optimized mass spectrum parameters of apigenin, luteolin, naringenin, eriodictyol, and
p-coumaric acid were shown in the
Table S8. Data were analyzed using SCIEX OS-Q software (Version 1.4.0.18067). Three biological replicates were used.
4.9. Structure Prediction of Ss4CL, SsC4H, and SsF3′5′H and Molecular Docking Studies
The structures of Ss4CL, SsC4H, and SsF3′5′H were predicted using AlphaFold2. Molecular docking studies were performed using the BIOVIA Discovery Studio 2019 software. Briefly, the predicted structure model of Ss4CL, SsC4H, and SsF3′5′H output by AlphaFold2 was docked with p-coumaric acid (compound CID: 637542), trans-cinnamic acid (compound CID: 444539), and apigenin (compound CID: 5280443), respectively. The Ss4CL, SsC4H, and SsF3′5′H molecules were added with non-polar molecules, and the receptor, ligand, and binding site were defined. LibDock molecular docking was performed under the following conditions: the number of hotspots was set to 100; docking tolerance was set to 0.25; docking preferences were set to high quality; and the conformation method was set to fast.