Evaluation of Cross-Talk and Alleviate Potential of Cytotoxic Factors Induced by Deoxynivalenol in IPEC-J2 Cells Interference with Curcumin
Abstract
:1. Introduction
2. Results
2.1. Cross-Talk between CUR Targets with DON-Induced Cytotoxicity Factors
2.2. Evaluation of the Efficacy of CUR in Alleviating Cytotoxicity of IPEC-J2 Induced by DON
2.3. Verification of CUR on the Inhibition of TNF-α/NF-κB Signaling Pathways Induced by DON
2.4. CUR Treatment Rescues the Apoptosis of IPEC-J2 Cells Induced by DON
2.5. CUR Treatment Reduces DON-Induced ERS through PERK/CHOP Pathways
2.6. Cytological Validation of CUR to Attenuate DON-Induced Oxidative Stress in IPEC-J2 Cells
3. Discussion
4. Materials and Methods
4.1. Cell and Cell Culture
4.2. Chemicals and Reagents
4.3. DON and CUR Treatment
4.4. Assessment of Cell Viability by CCK-8 Method
4.5. Measurement of Reactive Oxygen Species (ROS)
4.6. Determination of Oxidative Stress Indices
4.7. Mitochondrial Membrane Potential (MMP) Assay
4.8. Total RNA Extraction and Quantitative Real-Time PCR (RT-qPCR)
4.9. Extraction of Total Cellular Protein and Western Blotting Analysis
4.10. Apoptosis Detection Using Flow Cytometry
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Hao, W.; Guan, S.; Li, A.; Wang, J.; An, G.; Hofstetter, U.; Schatzmayr, G. Mycotoxin Occurrence in Feeds and Raw Materials in China: A Five-Year Investigation. Toxins 2023, 15, 63. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Song, G.; Lim, W. Effects of mycotoxin-contaminated feed on farm animals. J. Hazard Mater. 2020, 389, 122087. [Google Scholar] [CrossRef]
- Ganesan, A.R.; Mohan, K.; Karthick Rajan, D.; Pillay, A.A.; Palanisami, T.; Sathishkumar, P.; Conterno, L. Distribution, toxicity, interactive effects, and detection of ochratoxin and deoxynivalenol in food: A review. Food Chem. 2022, 378, 131978. [Google Scholar] [CrossRef]
- Karlovsky, P. Biological detoxification of the mycotoxin deoxynivalenol and its use in genetically engineered crops and feed additives. Appl. Microbiol. Biotechnol. 2011, 91, 491–504. [Google Scholar] [CrossRef]
- Wu, Q.; Dohnal, V.; Kuca, K.; Yuan, Z. Trichothecenes: Structure-toxic activity relationships. Curr. Drug Metab. 2013, 14, 641–660. [Google Scholar] [CrossRef]
- Pierron, A.; Alassane-Kpembi, I.; Oswald, I.P. Impact of mycotoxin on immune response and consequences for pig health. Anim. Nutr. 2016, 2, 63–68. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Meng, L.; Liu, H.; Wang, J.; Zheng, N. The Compromised Intestinal Barrier Induced by Mycotoxins. Toxins 2020, 12, 619. [Google Scholar] [CrossRef]
- Pierron, A.; Alassane-Kpembi, I.; Oswald, I.P. Impact of two mycotoxins deoxynivalenol and fumonisin on pig intestinal health. Porcine Health Manag. 2016, 2, 21. [Google Scholar] [CrossRef]
- Akbari, P.; Braber, S.; Gremmels, H.; Koelink, P.J.; Verheijden, K.A.; Garssen, J.; Fink-Gremmels, J. Deoxynivalenol: A trigger for intestinal integrity breakdown. FASEB J. 2014, 28, 2414–2429. [Google Scholar] [CrossRef]
- Kozieł, M.J.; Ziaja, M.; Piastowska-Ciesielska, A.W. Intestinal Barrier, Claudins and Mycotoxins. Toxins 2021, 13, 758. [Google Scholar] [CrossRef]
- Tang, M.; Yuan, D.; Liao, P. Berberine improves intestinal barrier function and reduces inflammation, immunosuppression, and oxidative stress by regulating the NF-κB/MAPK signaling pathway in deoxynivalenol-challenged piglets. Environ. Pollut. 2021, 289, 117865. [Google Scholar] [CrossRef] [PubMed]
- Claeys, L.; Romano, C.; De Ruyck, K.; Wilson, H.; Fervers, B.; Korenjak, M.; Zavadil, J.; Gunter, M.J.; De Saeger, S.; De Boevre, M.; et al. Mycotoxin exposure and human cancer risk: A systematic review of epidemiological studies. Compr. Rev. Food Sci. Food Saf. 2020, 19, 1449–1464. [Google Scholar] [CrossRef] [PubMed]
- Djouina, M.; Waxin, C.; Caboche, S.; Lecointe, K.; Steimle, A.; Beury, D.; Desai, M.S.; Hot, D.; Dubuquoy, L.; Launay, D.; et al. Low dose dietary contamination with deoxynivalenol mycotoxin exacerbates enteritis and colorectal cancer in mice. Sci. Total Environ. 2023, 900, 165722. [Google Scholar] [CrossRef] [PubMed]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, K.; Kozieł, M.J.; Habrowska-Górczyńska, D.E.; Urbanek, K.A.; Domińska, K.; Piastowska-Ciesielska, A.W. Deoxynivalenol induces apoptosis and autophagy in human prostate epithelial cells via PI3K/Akt signaling pathway. Arch. Toxicol. 2022, 96, 231–241. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Deng, X.; Zhou, C.; Wu, W.; Zhang, H. Deoxynivalenol Induces Inflammation in IPEC-J2 Cells by Activating P38 Mapk And Erk1/2. Toxins 2020, 12, 180. [Google Scholar] [CrossRef]
- Zhang, Z.; Fan, K.; Meng, J.; Nie, D.; Zhao, Z.; Han, Z. Deoxynivalenol hijacks the pathway of Janus kinase 2/signal transducers and activators of transcription 3 (JAK2/STAT-3) to drive caspase-3-mediated apoptosis in intestinal porcine epithelial cells. Sci. Total Environ. 2023, 864, 161058. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, J.; Zhang, X.; Wang, C.; Huang, Y.; Dai, K.; Zhang, X. TNF-α-induced LRG1 promotes angiogenesis and mesenchymal stem cell migration in the subchondral bone during osteoarthritis. Cell Death Dis. 2017, 8, e2715. [Google Scholar] [CrossRef] [PubMed]
- Bakshi, H.A.; Quinn, G.A.; Nasef, M.M.; Mishra, V.; Aljabali, A.A.A.; El-Tanani, M.; Serrano-Aroca, Á.; Webba Da Silva, M.; McCarron, P.A.; Tambuwala, M.M. Crocin Inhibits Angiogenesis and Metastasis in Colon Cancer via TNF-α/NF-kB/VEGF Pathways. Cells 2022, 11, 1502. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhang, Y.; Zhao, J.; Cao, L.; Zhu, L.; Huang, Y.; Chen, X.; Rahman, S.U.; Feng, S.; Li, Y.; et al. Deoxynivalenol Induces Inflammatory Injury in IPEC-J2 Cells via NF-κB Signaling Pathway. Toxins 2019, 11, 733. [Google Scholar] [CrossRef]
- Li, J.; Bai, Y.; Ma, K.; Ren, Z.; Li, J.; Zhang, J.; Shan, A. Dihydroartemisinin alleviates deoxynivalenol induced liver apoptosis and inflammation in piglets. Ecotoxicol. Environ. Saf. 2022, 241, 113811. [Google Scholar] [CrossRef]
- Kang, T.H.; Kang, K.S.; Lee, S.I. Deoxynivalenol Induces Apoptosis via FOXO3a-Signaling Pathway in Small-Intestinal Cells in Pig. Toxics 2022, 10, 535. [Google Scholar] [CrossRef]
- Wiseman, R.L.; Mesgarzadeh, J.S.; Hendershot, L.M. Reshaping endoplasmic reticulum quality control through the unfolded protein response. Mol. Cell 2022, 82, 1477–1491. [Google Scholar] [CrossRef]
- Zhang, J.; Zhao, Q.; Xue, Z.; Zhang, S.; Ren, Z.; Chen, S.; Zhou, A.; Chen, H.; Liu, Y. Deoxynivalenol induces endoplasmic reticulum stress-associated apoptosis via the IRE1/JNK/CHOP pathway in porcine alveolar macrophage 3D4/21 cells. Food Chem. Toxicol. 2023, 180, 114033. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Qiao, L.; Dou, X.; Chang, J.; Zhang, Y.; Xu, C. Selenium nanoparticles alleviate deoxynivalenol-induced intestinal epithelial barrier dysfunction by regulating endoplasmic reticulum stress in IPEC-J2 cells. Toxicology 2023, 494, 153593. [Google Scholar] [CrossRef]
- Chang, C.; Wang, K.; Zhou, S.N.; Wang, X.D.; Wu, J.E. Protective Effect of Saccharomyces boulardii on Deoxynivalenol-Induced Injury of Porcine Macrophage via Attenuating p38 MAPK Signal Pathway. Appl. Biochem. Biotechnol. 2017, 182, 411–427. [Google Scholar] [CrossRef]
- Jia, H.; Liu, N.; Zhang, Y.; Wang, C.; Yang, Y.; Wu, Z. 3-Acetyldeoxynivalenol induces cell death through endoplasmic reticulum stress in mouse liver. Environ. Pollut. 2021, 286, 117238. [Google Scholar] [CrossRef]
- Pan, S.; Yan, J.; Xu, X.; Chen, Y.; Chen, X.; Li, F.; Xing, H. Current Development and Future Application Prospects of Plants-Derived Polyphenol Bioactive Substance Curcumin as a Novel Feed Additive in Livestock and Poultry. Int. J. Mol. Sci. 2022, 23, 1905. [Google Scholar] [CrossRef]
- Miłobȩdzka, J.; Kostanecki, S.; Lampe, V. Zur Kenntnis des Curcumins. Berichte Der Dtsch. Chem. Ges. 1910, 43, 2163–2170. [Google Scholar] [CrossRef]
- Kotha, R.R.; Luthria, D.L. Curcumin: Biological, Pharmaceutical, Nutraceutical, and Analytical Aspects. Molecules 2019, 24, 2930. [Google Scholar] [CrossRef] [PubMed]
- Priyadarsini, K.I. Chemical and structural features influencing the biological activity of curcumin. Curr. Pharm. Des. 2013, 19, 2093–2100. [Google Scholar] [CrossRef] [PubMed]
- Buhrmann, C.; Brockmueller, A.; Mueller, A.L.; Shayan, P.; Shakibaei, M. Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis. Int. J. Mol. Sci. 2021, 22, 7645. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.O.; Li, C.W.; Xia, W.; Cha, J.H.; Chan, L.C.; Wu, Y.; Chang, S.S.; Lin, W.C.; Hsu, J.M.; Hsu, Y.H.; et al. Deubiquitination and Stabilization of PD-L1 by CSN5. Cancer Cell 2016, 30, 925–939. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Tang, Q.; Duan, P.; Yang, L. Curcumin as a therapeutic agent for blocking NF-κB activation in ulcerative colitis. Immunopharmacol. Immunotoxicol. 2018, 40, 476–482. [Google Scholar] [CrossRef] [PubMed]
- Shishodia, S.; Aggarwal, B.B. Nuclear factor-kappaB activation: A question of life or death. J. Biochem. Mol. Biol. 2002, 35, 28–40. [Google Scholar] [CrossRef]
- Chen, B.; Li, H.; Ou, G.; Ren, L.; Yang, X.; Zeng, M. Curcumin attenuates MSU crystal-induced inflammation by inhibiting the degradation of IκBα and blocking mitochondrial damage. Arthritis Res. Ther. 2019, 21, 193. [Google Scholar] [CrossRef] [PubMed]
- Giordano, A.; Tommonaro, G. Curcumin and Cancer. Nutrients 2019, 11, 2376. [Google Scholar] [CrossRef]
- Sha, J.; Li, J.; Wang, W.; Pan, L.; Cheng, J.; Li, L.; Zhao, H.; Lin, W. Curcumin induces G0/G1 arrest and apoptosis in hormone independent prostate cancer DU-145 cells by down regulating Notch signaling. Biomed. Pharmacother. 2016, 84, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Rokavec, M.; Huang, Z.; Hermeking, H. Curcumin activates a ROS/KEAP1/NRF2/miR-34a/b/c cascade to suppress colorectal cancer metastasis. Cell Death Differ. 2023, 30, 1771–1785. [Google Scholar] [CrossRef]
- Li, R.; Fang, H.; Shen, J.; Jin, Y.; Zhao, Y.; Wang, R.; Fu, Y.; Tian, Y.; Yu, H.; Zhang, J. Curcumin Alleviates LPS-Induced Oxidative Stress, Inflammation and Apoptosis in Bovine Mammary Epithelial Cells via the NFE2L2 Signaling Pathway. Toxins 2021, 13, 208. [Google Scholar] [CrossRef]
- Schmitz, M.L.; Shaban, M.S.; Albert, B.V.; Gökçen, A.; Kracht, M. The Crosstalk of Endoplasmic Reticulum (ER) Stress Pathways with NF-κB: Complex Mechanisms Relevant for Cancer, Inflammation and Infection. Biomedicines 2018, 6, 58. [Google Scholar] [CrossRef] [PubMed]
- Shakeri, A.; Zirak, M.R.; Wallace Hayes, A.; Reiter, R.; Karimi, G. Curcumin and its analogues protect from endoplasmic reticulum stress: Mechanisms and pathways. Pharmacol. Res. 2019, 146, 104335. [Google Scholar] [CrossRef] [PubMed]
- Jo, S.L.; Yang, H.; Lee, H.W.; Hong, E.J. Curcumae radix Reduces Endoplasmic Reticulum Stress in Mice with Chronic Neuroinflammation. Biomedicines 2023, 11, 2107. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhu, J.; Lin, Q.; Yu, M.; Lu, J.; Feng, J.; Hu, C. Effects of Curcumin on Mitochondrial Function, Endoplasmic Reticulum Stress, and Mitochondria-Associated Endoplasmic Reticulum Membranes in the Jejunum of Oxidative Stress Piglets. J. Agric. Food Chem. 2022, 70, 8974–8985. [Google Scholar] [CrossRef] [PubMed]
- Anand, P.; Kunnumakkara, A.B.; Newman, R.A.; Aggarwal, B.B. Bioavailability of curcumin: Problems and promises. Mol. Pharm. 2007, 4, 807–818. [Google Scholar] [CrossRef] [PubMed]
- Mirzaei, H.; Shakeri, A.; Rashidi, B.; Jalili, A.; Banikazemi, Z.; Sahebkar, A. Phytosomal curcumin: A review of pharmacokinetic, experimental and clinical studies. Biomed. Pharmacother. 2017, 85, 102–112. [Google Scholar] [CrossRef] [PubMed]
- Shoba, G.; Joy, D.; Joseph, T.; Majeed, M.; Rajendran, R.; Srinivas, P.S. Influence of piperine on the pharmacokinetics of curcumin in animals and human volunteers. Planta Med. 1998, 64, 353–356. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Liang, S.; Zan, G.; Wang, X.; Gao, C.; Yan, H.; Wang, X.; Zhou, J. Selenomethionine Alleviates DON-Induced Oxidative Stress via Modulating Keap1/Nrf2 Signaling in the Small Intestinal Epithelium. J. Agric. Food Chem. 2023, 71, 895–904. [Google Scholar] [CrossRef]
- Wu, Q.H.; Wang, X.; Yang, W.; Nüssler, A.K.; Xiong, L.Y.; Kuča, K.; Dohnal, V.; Zhang, X.J.; Yuan, Z.H. Oxidative stress-mediated cytotoxicity and metabolism of T-2 toxin and deoxynivalenol in animals and humans: An update. Arch. Toxicol. 2014, 88, 1309–1326. [Google Scholar] [CrossRef]
- Soleimani, V.; Sahebkar, A.; Hosseinzadeh, H. Turmeric (Curcuma longa) and its major constituent (curcumin) as nontoxic and safe substances: Review. Phytother. Res. 2018, 32, 985–995. [Google Scholar] [CrossRef]
- Velusami, C.C.; Boddapati, S.R.; Hongasandra Srinivasa, S.; Richard, E.J.; Joseph, J.A.; Balasubramanian, M.; Agarwal, A. Safety evaluation of turmeric polysaccharide extract: Assessment of mutagenicity and acute oral toxicity. Biomed. Res. Int. 2013, 2013, 158348. [Google Scholar] [CrossRef]
- Sui-Shneg, Z. Study on the acute oral toxicity and genetic toxicity of curcumin. Chin. J. Health Lab. Technol. 2011, 21, 1707–1709. [Google Scholar]
- Holder, G.M.; Plummer, J.L.; Ryan, A.J. The metabolism and excretion of curcumin (1,7-bis-(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) in the rat. Xenobiotica 1978, 8, 761–768. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.H.; Huang, T.M.; Lin, J.K. Biotransformation of curcumin through reduction and glucuronidation in mice. Drug Metab. Dispos. 1999, 27, 486–494. [Google Scholar]
- Pauletto, M.; Giantin, M.; Tolosi, R.; Bassan, I.; Barbarossa, A.; Zaghini, A.; Dacasto, M. Curcumin Mitigates AFB1-Induced Hepatic Toxicity by Triggering Cattle Antioxidant and Anti-inflammatory Pathways: A Whole Transcriptomic In Vitro Study. Antioxidants 2020, 9, 1059. [Google Scholar] [CrossRef]
- Chen, S.; Yang, S.; Wang, M.; Chen, J.; Huang, S.; Wei, Z.; Cheng, Z.; Wang, H.; Long, M.; Li, P. Curcumin inhibits zearalenone-induced apoptosis and oxidative stress in Leydig cells via modulation of the PTEN/Nrf2/Bip signaling pathway. Food Chem. Toxicol. 2020, 141, 111385. [Google Scholar] [CrossRef]
- Zhao, P.; Feng, L.; Jiang, W.; Wu, P.; Liu, Y.; Ren, H.; Jin, X.; Zhang, L.; Mi, H.; Zhou, X. Unveiling the emerging role of curcumin to alleviate ochratoxin A-induced muscle toxicity in grass carp (Ctenopharyngodon idella): In vitro and in vivo studies. J. Anim. Sci. Biotechnol. 2024, 15, 72. [Google Scholar] [CrossRef]
- Varfolomeev, E.; Vucic, D. Intracellular regulation of TNF activity in health and disease. Cytokine 2018, 101, 26–32. [Google Scholar] [CrossRef]
- de Souza, M.C.; Vieira, A.J.; Beserra, F.P.; Pellizzon, C.H.; Nóbrega, R.H.; Rozza, A.L. Gastroprotective effect of limonene in rats: Influence on oxidative stress, inflammation and gene expression. Phytomedicine 2019, 53, 37–42. [Google Scholar] [CrossRef]
- He, X.; Shu, J.; Xu, L.; Lu, C.; Lu, A. Inhibitory effect of Astragalus polysaccharides on lipopolysaccharide-induced TNF-a and IL-1β production in THP-1 cells. Molecules 2012, 17, 3155–3164. [Google Scholar] [CrossRef]
- Li, M.; Tang, D.; Yang, T.; Qian, D.; Xu, R. Apoptosis Triggering, an Important Way for Natural Products From Herbal Medicines to Treat Pancreatic Cancers. Front. Pharmacol. 2021, 12, 796300. [Google Scholar] [CrossRef]
- Katsori, A.M.; Palagani, A.; Bougarne, N.; Hadjipavlou-Litina, D.; Haegeman, G.; Vanden Berghe, W. Inhibition of the NF-κB signaling pathway by a novel heterocyclic curcumin analogue. Molecules 2015, 20, 863–878. [Google Scholar] [CrossRef]
- Zhong, W.; Qian, K.; Xiong, J.; Ma, K.; Wang, A.; Zou, Y. Curcumin alleviates lipopolysaccharide induced sepsis and liver failure by suppression of oxidative stress-related inflammation via PI3K/AKT and NF-κB related signaling. Biomed. Pharmacother. 2016, 83, 302–313. [Google Scholar] [CrossRef]
- Milacic, V.; Banerjee, S.; Landis-Piwowar, K.R.; Sarkar, F.H.; Majumdar, A.P.; Dou, Q.P. Curcumin inhibits the proteasome activity in human colon cancer cells in vitro and in vivo. Cancer Res. 2008, 68, 7283–7292. [Google Scholar] [CrossRef]
- Shishodia, S.; Potdar, P.; Gairola, C.G.; Aggarwal, B.B. Curcumin (diferuloylmethane) down-regulates cigarette smoke-induced NF-kappaB activation through inhibition of IkappaBalpha kinase in human lung epithelial cells: Correlation with suppression of COX-2, MMP-9 and cyclin D1. Carcinogenesis 2003, 24, 1269–1279. [Google Scholar] [CrossRef]
- Ashkenazi, A.; Fairbrother, W.J.; Leverson, J.D.; Souers, A.J. From basic apoptosis discoveries to advanced selective BCL-2 family inhibitors. Nat. Rev. Drug Discov. 2017, 16, 273–284. [Google Scholar] [CrossRef]
- Zhang, J.; Guo, J.; Yang, N.; Huang, Y.; Hu, T.; Rao, C. Endoplasmic reticulum stress-mediated cell death in liver injury. Cell Death Dis. 2022, 13, 1051. [Google Scholar] [CrossRef]
- Yang, S.; Zhang, Y.; Luo, Y.; Xu, B.; Yao, Y.; Deng, Y.; Yang, F.; Ye, T.; Wang, G.; Cheng, Z.; et al. Hinokiflavone induces apoptosis in melanoma cells through the ROS-mitochondrial apoptotic pathway and impairs cell migration and invasion. Biomed. Pharmacother. 2018, 103, 101–110. [Google Scholar] [CrossRef]
- Nicholson, D.W. Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ. 1999, 6, 1028–1042. [Google Scholar] [CrossRef]
- van der Pol, A.; van Gilst, W.H.; Voors, A.A.; van der Meer, P. Treating oxidative stress in heart failure: Past, present and future. Eur. J. Heart Fail 2019, 21, 425–435. [Google Scholar] [CrossRef]
- Circu, M.L.; Aw, T.Y. Intestinal redox biology and oxidative stress. Semin. Cell Dev. Biol. 2012, 23, 729–737. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.T.; Napier, D.L.; Kim, J.; Li, C.; Lee, E.Y.; Weiss, H.L.; Wang, Q.; Evers, B.M. Ketogenesis alleviates TNFα-induced apoptosis and inflammatory responses in intestinal cells. Free Radic. Biol. Med. 2021, 172, 90–100. [Google Scholar] [CrossRef] [PubMed]
- Krishnaswamy, R.; Devaraj, S.N.; Padma, V.V. Lutein protects HT-29 cells against Deoxynivalenol-induced oxidative stress and apoptosis: Prevention of NF-kappaB nuclear localization and down regulation of NF-kappaB and Cyclo-Oxygenase-2 expression. Free Radic. Biol. Med. 2010, 49, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Wang, X.; Li, L.; Liu, J.; Ding, Y.; Zhao, T.; Zhang, Y. Atomic-scale simulations of the deoxynivalenol degradation induced by reactive oxygen plasma species. Food Res. Int. 2022, 162, 111939. [Google Scholar] [CrossRef]
- Lopresti, A.L. The Problem of Curcumin and Its Bioavailability: Could Its Gastrointestinal Influence Contribute to Its Overall Health-Enhancing Effects? Adv. Nutr. 2018, 9, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Lee, B.M.; Kim, H.S. Potential protective roles of curcumin against cadmium-induced toxicity and oxidative stress. J. Toxicol. Environ. Health B Crit. Rev. 2021, 24, 95–118. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, D.S.; Blower, M.D. The endoplasmic reticulum: Structure, function and response to cellular signaling. Cell Mol. Life Sci. 2016, 73, 79–94. [Google Scholar] [CrossRef] [PubMed]
- Oakes, S.A.; Papa, F.R. The role of endoplasmic reticulum stress in human pathology. Annu. Rev. Pathol. 2015, 10, 173–194. [Google Scholar] [CrossRef]
- Ron, D.; Walter, P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol. 2007, 8, 519–529. [Google Scholar] [CrossRef]
- Muñoz, J.P.; Ivanova, S.; Sánchez-Wandelmer, J.; Martínez-Cristóbal, P.; Noguera, E.; Sancho, A.; Díaz-Ramos, A.; Hernández-Alvarez, M.I.; Sebastián, D.; Mauvezin, C.; et al. Mfn2 modulates the UPR and mitochondrial function via repression of PERK. Embo. J. 2013, 32, 2348–2361. [Google Scholar] [CrossRef]
- Donnelly, N.; Gorman, A.M.; Gupta, S.; Samali, A. The eIF2α kinases: Their structures and functions. Cell Mol. Life Sci. 2013, 70, 3493–3511. [Google Scholar] [CrossRef]
- Wang, L.; Chen, J.; Ning, C.; Lei, D.; Ren, J. Endoplasmic Reticulum Stress Related Molecular Mechanisms in Nonalcoholic Fatty Liver Disease (NAFLD). Curr. Drug Targets 2018, 19, 1087–1094. [Google Scholar] [CrossRef]
- Yu, S.; Jia, B.; Yang, Y.; Liu, N.; Wu, A. Involvement of PERK-CHOP pathway in fumonisin B1- induced cytotoxicity in human gastric epithelial cells. Food Chem. Toxicol. 2020, 136, 111080. [Google Scholar] [CrossRef]
- Galli, G.M.; Griss, L.G.; Boiago, M.M.; Petrolli, T.G.; Glombowsky, P.; Bissacotti, B.F.; Copetti, P.M.; da Silva, A.D.; Schetinger, M.R.; Sareta, L.; et al. Effects of curcumin and yucca extract addition in feed of broilers on microorganism control (anticoccidial and antibacterial), health, performance and meat quality. Res. Vet. Sci. 2020, 132, 156–166. [Google Scholar] [CrossRef]
- Galli, G.M.; Da Silva, A.S.; Biazus, A.H.; Reis, J.H.; Boiago, M.M.; Topazio, J.P.; Migliorini, M.J.; Guarda, N.S.; Moresco, R.N.; Ourique, A.F.; et al. Feed addition of curcumin to laying hens showed anticoccidial effect, and improved egg quality and animal health. Res. Vet. Sci. 2018, 118, 101–106. [Google Scholar] [CrossRef]
- Liu, Y.; Azad, M.; Zhu, Q.; Yu, Z.; Kong, X. Dietary bile acid supplementation alters plasma biochemical and hormone indicators, intestinal digestive capacity, and microbiota of piglets with normal birth weight and intrauterine growth retardation. Front. Microbiol. 2022, 13, 1053128. [Google Scholar] [CrossRef]
- Niu, Y.; He, J.; Ahmad, H.; Shen, M.; Zhao, Y.; Gan, Z.; Zhang, L.; Zhong, X.; Wang, C.; Wang, T. Dietary Curcumin Supplementation Increases Antioxidant Capacity, Upregulates Nrf2 and Hmox1 Levels in the Liver of Piglet Model with Intrauterine Growth Retardation. Nutrients 2019, 11, 2978. [Google Scholar] [CrossRef]
- Yang, K.Y.; Lin, L.C.; Tseng, T.Y.; Wang, S.C.; Tsai, T.H. Oral bioavailability of curcumin in rat and the herbal analysis from Curcuma longa by LC-MS/MS. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2007, 853, 183–189. [Google Scholar] [CrossRef]
- Sharma, R.A.; McLelland, H.R.; Hill, K.A.; Ireson, C.R.; Euden, S.A.; Manson, M.M.; Pirmohamed, M.; Marnett, L.J.; Gescher, A.J.; Steward, W.P. Pharmacodynamic and pharmacokinetic study of oral Curcuma extract in patients with colorectal cancer. Clin. Cancer Res. 2001, 7, 1894–1900. [Google Scholar]
- Vareed, S.K.; Kakarala, M.; Ruffin, M.T.; Crowell, J.A.; Normolle, D.P.; Djuric, Z.; Brenner, D.E. Pharmacokinetics of curcumin conjugate metabolites in healthy human subjects. Cancer Epidemiol. Biomarkers Prev. 2008, 17, 1411–1417. [Google Scholar] [CrossRef]
- Carroll, R.E.; Benya, R.V.; Turgeon, D.K.; Vareed, S.; Neuman, M.; Rodriguez, L.; Kakarala, M.; Carpenter, P.M.; McLaren, C.; Meyskens, F.L., Jr.; et al. Phase IIa clinical trial of curcumin for the prevention of colorectal neoplasia. Cancer Prev. Res. 2011, 4, 354–364. [Google Scholar] [CrossRef]
- Liu, W.; Zhai, Y.; Heng, X.; Che, F.Y.; Chen, W.; Sun, D.; Zhai, G. Oral bioavailability of curcumin: Problems and advancements. J. Drug Target 2016, 24, 694–702. [Google Scholar] [CrossRef]
- Burdeos, G.C.; Blank, R.; Wolffram, S. Influence of quercetin on the global DNA methylation pattern in pigs. Food Funct. 2020, 11, 7421–7426. [Google Scholar] [CrossRef]
- Yu, Q.; Fang, C.; Ma, Y.; He, S.; Ajuwon, K.M.; He, J. Dietary resveratrol supplement improves carcass traits and meat quality of Pekin ducks. Poult. Sci. 2021, 100, 100802. [Google Scholar] [CrossRef]
- Armanini, E.H.; Boiago, M.M.; Cécere, B.G.O.; Oliveira, P.V.; Teixeira, C.J.S.; Strapazzon, J.V.; Bottari, N.B.; Silva, A.D.; Fracasso, M.; Vendruscolo, R.G.; et al. Protective effects of silymarin in broiler feed contaminated by mycotoxins: Growth performance, meat antioxidant status, and fatty acid profiles. Trop. Anim. Health Prod. 2021, 53, 442. [Google Scholar] [CrossRef]
Gene Symbols | Nucleotide Sequence of Primers (5′→3′) | Product Length (bp) | Accession No. |
---|---|---|---|
β-Actin | F: CTGGAACGGTGAAGGTGA R: TTTGGAAAGGCAGGGACT | 218 | XM_021086047.1 |
IL-1β | F: CCACAAATCTCTAGTGCTGGCT R: CAGGGTGGGCGTGTTATCT | 199 | XM_021085847.1 |
NF-κB | F: AAGAGCAGCGTGGTGGGCAGTG R: CCGGAACGGTCTCCATCACAATC | 163 | XM_021079371.1 |
IL-6 | F: AGGCCGTGCAGATTAGTACC R: ATTTGTGGTGGGGTTAGGGG | 95 | NM_001252429.1 |
IL-8 | F: GCCTTCTTGGCAGTTTTCCTG R: TGGAAAGGTGTGGAATGCGTA | 113 | NM_213867.1 |
TNF-α | F: TTATCGGCCCCCAGAAGGAA R: CGACGGGCTTATCTGAGGTT | 102 | NM_214022.1 |
GRP78 | F: ATATAAGCGGAGCAGGCGAC R: GAGCTCTCACACACACGGAA | 87 | XM_001927795.7 |
eIF2α | F: AGAATGCCGGGTCTGAGTTG R: GGATACGCCTTCTGGAGAGC | 172 | XM_001928339.4 |
ATF4 | F: AGTCCTTTTCTGCGAGTGGG R: CTGCTGCCTCTAATACGCCA | 80 | XM_021090887.1 |
CHOP | F: AGCTCTGATTGACCGGATGG R: AAGGTCAGCAGTAGCCCAAG | 83 | XM_005674378.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Li, A.; Yu, H.; Wang, C.; Wang, T.; Zhang, J. Evaluation of Cross-Talk and Alleviate Potential of Cytotoxic Factors Induced by Deoxynivalenol in IPEC-J2 Cells Interference with Curcumin. Int. J. Mol. Sci. 2024, 25, 6984. https://doi.org/10.3390/ijms25136984
Wang Q, Li A, Yu H, Wang C, Wang T, Zhang J. Evaluation of Cross-Talk and Alleviate Potential of Cytotoxic Factors Induced by Deoxynivalenol in IPEC-J2 Cells Interference with Curcumin. International Journal of Molecular Sciences. 2024; 25(13):6984. https://doi.org/10.3390/ijms25136984
Chicago/Turabian StyleWang, Qiyuan, Aike Li, Hao Yu, Chuanqi Wang, Ting Wang, and Jing Zhang. 2024. "Evaluation of Cross-Talk and Alleviate Potential of Cytotoxic Factors Induced by Deoxynivalenol in IPEC-J2 Cells Interference with Curcumin" International Journal of Molecular Sciences 25, no. 13: 6984. https://doi.org/10.3390/ijms25136984