Effects of the MCF-7 Exhausted Medium on hADSC Behaviour
Abstract
:1. Introduction
2. Results
2.1. MCF-7-E.M Counteracts Adipose-Derived Mesenchymal Stem Cell (ADSC) Expression of Key Adipogenic Genes
2.2. In Cells Exposed to MCF-7-E.M, Gene Expression of Osteogenic Markers Is Reduced
2.3. Morphological Changes in ADSCs Exposed to MCF-7-E.M
2.4. Exhausted Medium Interferes with Cell Differentiation
2.5. miRNA Expression in ADSCs Exposed to MCF-7-E.M
3. Discussion
4. Materials and Methods
4.1. Stem Cell Isolation and Expansion, and Experimental Design
ADSC Treatment
4.2. RNA Extraction and Gene Expression Analysis
4.3. Extraction and Expression of miRNAs
4.4. Colorimetric Assays to Assess Stem Cells’ Differentiation
4.4.1. Oil Red Staining
4.4.2. Alizarin Red Assay
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Poliwoda, S.; Noor, N.; Downs, E.; Schaaf, A.; Cantwell, A.; Ganti, L.; Kaye, A.D.; Mosel, L.I.; Carroll, C.B.; Viswanath, O.; et al. Stem cells: A comprehensive review of origins and emerging clinical roles in medical practice. Orthop. Rev. 2022, 14, 37498. [Google Scholar] [CrossRef]
- Rajabzadeh, N.; Fathi, E.; Farahzadi, R. Stem cell-based regenerative medicine. Stem Cell Investig. 2019, 6, 19. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Li, S.; Yu, Q.; Chen, T.; Liu, D. Application of stem cells in regeneration medicine. MedComm 2023, 4, e291. [Google Scholar] [CrossRef] [PubMed]
- Ullah, I.; Subbarao, R.B.; Rho, G.J. Human mesenchymal stem cells-current trends and future prospective. Biosci. Rep. 2015, 35, e00191. [Google Scholar] [CrossRef] [PubMed]
- Hassan, H.T.; El-Sheemy, M. Adult bone-marrow stem cells and their potential in medicine. J. R. Soc. Med. 2004, 97, 465–471. [Google Scholar] [CrossRef] [PubMed]
- Bellu, E.; Garroni, G.; Balzano, F.; Satta, R.; Montesu, M.A.; Kralovic, M.; Fedacko, J.; Cruciani, S.; Maioli, M. Isolating stem cells from skin: Designing a novel highly efficient non-enzymatic approach. Physiol. Res. 2019, 68 (Suppl. S4), S385–S388. [Google Scholar] [CrossRef] [PubMed]
- Frese, L.; Dijkman, P.E.; Hoerstrup, S.P. Adipose Tissue-Derived Stem Cells in Regenerative Medicine. Transfus. Med. Hemotherapy 2016, 43, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Bertolini, F.; Lohsiriwat, V.; Petit, J.Y.; Kolonin, M.G. Adipose tissue cells, lipotransfer and cancer: A challenge for scientists, oncologists and surgeons. Biochim. Biophys. Acta. 2012, 1826, 209–214. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Liu, Y.; Chen, Y.; Yuan, L.; Liu, H.; Wang, J.; Liu, Q.; Zhang, Y. Adipose-Derived Stem Cells: Current Applications and Future Directions in the Regeneration of Multiple Tissues. Stem Cells Int. 2020, 2020, 8810813. [Google Scholar] [CrossRef]
- Ning, K.; Liu, S.; Yang, B.; Wang, R.; Man, G.; Wang, D.E.; Xu, H. Update on the effects of energy metabolism in bone marrow mesenchymal stem cells differentiation. Mol. Metab. 2022, 58, 101450. [Google Scholar] [CrossRef]
- Clause, K.C.; Liu, L.J.; Tobita, K. Directed stem cell differentiation: The role of physical forces. Cell Commun. Adhes. 2010, 17, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Putra, V.D.L.; Kilian, K.A.; Tate, M.L.K. Biomechanical, biophysical and biochemical modulators of cytoskeletal remodelling and emergent stem cell lineage commitment. Commun. Biol. 2023, 6, 75. [Google Scholar] [CrossRef] [PubMed]
- Saulite, L.; Jekabsons, K.; Klavins, M.; Muceniece, R.; Riekstina, U. Effects of malvidin, cyanidin and delphinidin on human adipose mesenchymal stem cell differentiation into adipocytes, chondrocytes and osteocytes. Phytomedicine 2019, 53, 86–95. [Google Scholar] [CrossRef] [PubMed]
- Cruciani, S.; Garroni, G.; Balzano, F.; Pala, R.; Bellu, E.; Cossu, M.L.; Ginesu, G.C.; Ventura, C.; Maioli, M. Tuning Adipogenic Differentiation in ADSCs by Metformin and Vitamin D: Involvement of miRNAs. Int. J. Mol. Sci. 2020, 21, 6181. [Google Scholar] [CrossRef] [PubMed]
- Picerno, A.; Stasi, A.; Franzin, R.; Curci, C.; di Bari, I.; Gesualdo, L.; Sallustio, F. Why stem/progenitor cells lose their regenerative potential. World J. Stem Cells 2021, 13, 1714–1732. [Google Scholar] [CrossRef] [PubMed]
- Cruciani, S.; Santaniello, S.; Montella, A.; Ventura, C.; Maioli, M. Orchestrating stem cell fate: Novel tools for regenerative medicine. World J. Stem Cells 2019, 11, 464–475. [Google Scholar] [CrossRef] [PubMed]
- Chacón-Martínez, C.A.; Koester, J.; Wickström, S.A. Signaling in the stem cell niche: Regulating cell fate, function and plasticity. Development 2018, 145, dev165399. [Google Scholar] [CrossRef] [PubMed]
- Pennings, S.; Liu, K.J.; Qian, H. The Stem Cell Niche: Interactions between Stem Cells and Their Environment. Stem Cells Int. 2018, 2018, 4879379. [Google Scholar] [CrossRef] [PubMed]
- Farahzadi, R.; Valipour, B.; Montazersaheb, S.; Fathi, E. Targeting the stem cell niche micro-environment as therapeutic strategies in aging. Front. Cell Dev. Biol. 2023, 11, 1162136. [Google Scholar] [CrossRef]
- Basoli, V.; Santaniello, S.; Cruciani, S.; Ginesu, G.C.; Cossu, M.L.; Delitala, A.P.; Serra, P.A.; Ventura, C.; Maioli, M. Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2017, 18, 981. [Google Scholar] [CrossRef]
- Cruciani, S.; Garroni, G.; Ventura, C.; Danani, A.; Nečas, A.; Maioli, M. Stem cells and physical energies: Can we really drive stem cell fate? Physiol. Res. 2019, 68 (Suppl. S4), S375–S384. [Google Scholar] [CrossRef]
- Cruciani, S.; Garroni, G.; Pala, R.; Cossu, M.L.; Ginesu, G.C.; Ventura, C.; Maioli, M. Metformin and Vitamin D Modulate Inflammation and Autophagy during Adipose-Derived Stem Cell Differentiation. Int. J. Mol. Sci. 2021, 22, 6686. [Google Scholar] [CrossRef] [PubMed]
- Santaniello, S.; Cruciani, S.; Basoli, V.; Balzano, F.; Bellu, E.; Garroni, G.; Ginesu, G.C.; Cossu, M.L.; Facchin, F.; Delitala, A.P.; et al. Melatonin and Vitamin D Orchestrate Adipose Derived Stem Cell Fate by Modulating Epigenetic Regulatory Genes. Int. J. Med. Sci. 2018, 15, 1631–1639. [Google Scholar] [CrossRef] [PubMed]
- Shim, J.; Nam, J.W. The expression and functional roles of microRNAs in stem cell differentiation. BMB Rep. 2016, 49, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.Q.; Ahmed, E.I.; Elareer, N.R.; Junejo, K.; Steinhoff, M.; Uddin, S. Role of miRNA-Regulated Cancer Stem Cells in the Pathogenesis of Human Malignancies. Cells 2019, 8, 840. [Google Scholar] [CrossRef] [PubMed]
- Coradduzza, D.; Cruciani, S.; Arru, C.; Garroni, G.; Pashchenko, A.; Jedea, M.; Zappavigna, S.; Caraglia, M.; Amler, E.; Carru, C.; et al. Role of miRNA-145, 148, and 185 and Stem Cells in Prostate Cancer. Int. J. Mol. Sci. 2022, 23, 1626. [Google Scholar] [CrossRef]
- Garroni, G.; Balzano, F.; Cruciani, S.; Pala, R.; Coradduzza, D.; Azara, E.; Bellu, E.; Cossu, M.L.; Ginesu, G.C.; Carru, C.; et al. Adipose-Derived Stem Cell Features and MCF-7. Cells 2021, 10, 1754. [Google Scholar] [CrossRef] [PubMed]
- Balzano, F.; Garroni, G.; Cruciani, S.; Bellu, E.; Dei Giudici, S.; Oggiano, A.; Capobianco, G.; Dessole, S.; Ventura, C.; Maioli, M. Behavioral Changes in Stem-Cell Potency by HepG2-Exhausted Medium. Cells 2020, 9, 1890. [Google Scholar] [CrossRef]
- You, L.; Guo, X.; Huang, Y. Correlation of Cancer Stem-Cell Markers OCT4, SOX2, and NANOG with Clinicopathological Features and Prognosis in Operative Patients with Rectal Cancer. Yonsei Med. J. 2018, 59, 35–42. [Google Scholar] [CrossRef]
- Barcellos-de-Souza, P.; Comito, G.; Pons-Segura, C.; Taddei, M.L.; Gori, V.; Becherucci, V.; Bambi, F.; Margheri, F.; Laurenzana, A.; Del Rosso, M.; et al. Mesenchymal stem cells are recruited and activated into carcinoma-associated fibroblasts by prostate cancer microenvironment-derived TGF-β1. Stem Cells. 2016, 34, 2536–2547. [Google Scholar] [CrossRef]
- Cheng, Y.Q.; Wang, S.B.; Liu, J.H.; Jin, L.; Liu, Y.; Li, C.Y.; Su, Y.R.; Liu, Y.R.; Sang, X.; Wan, Q.; et al. Modifying the tumour microenvironment and reverting tumour cells: New strategies for treating malignant tumours. Cell Prolif. 2020, 53, e12865. [Google Scholar] [CrossRef]
- Sisakhtnezhad, S.; Alimoradi, E.; Akrami, H. External factors influencing mesenchymal stem cell fate in vitro. Eur. J. Cell Biol. 2017, 96, 13–33. [Google Scholar] [CrossRef]
- Benayahu, D. Mesenchymal stem cell differentiation and usage for biotechnology applications: Tissue engineering and food manufacturing. Biomater. Transl. 2022, 3, 17–23. [Google Scholar] [CrossRef]
- Saffari, T.M.; Saffari, S.; Vyas, K.S.; Mardini, S.; Shin, A.Y. Role of adipose tissue grafting and adipose-derived stem cells in peripheral nerve surgery. Neural Regen. Res. 2022, 17, 2179–2184. [Google Scholar] [CrossRef]
- Dang, W.; Wu, J.; Wang, G.; Zhen, Y.; An, Y. Role of adipose-derived stem cells in breast cancer. Chin. J. Plast. Reconstr. Surg. 2023, 5, 73–79. [Google Scholar] [CrossRef]
- Wang, L.; Cheng, T.; Zheng, G. The impact of tumor microenvironments on stem cells. Transl. Cancer Res. 2013, 2, 5. [Google Scholar] [CrossRef]
- Comşa, Ş.; Cîmpean, A.M.; Raica, M. The Story of MCF-7 Breast Cancer Cell Line: 40 years of Experience in Research. Anticancer Res. 2015, 35, 3147–3154. [Google Scholar]
- Chen, G.; Liu, W.; Yan, B. Breast Cancer MCF-7 Cell Spheroid Culture for Drug Discovery and Development. J. Cancer Ther. 2022, 13, 117–130. [Google Scholar] [CrossRef] [PubMed]
- Nallasamy, P.; Nimmakayala, R.K.; Parte, S.; Are, A.C.; Batra, S.K.; Ponnusamy, M.P. Tumor microenvironment enriches the stemness features: The architectural event of therapy resistance and metastasis. Mol. Cancer 2022, 21, 225. [Google Scholar] [CrossRef]
- Lefterova, M.I.; Haakonsson, A.K.; Lazar, M.A.; Mandrup, S. PPARγ and the global map of adipogenesis and beyond. Trends Endocrinol. Metab. 2014, 25, 293–302. [Google Scholar] [CrossRef]
- Wu, H.; Li, X.; Shen, C. Peroxisome proliferator-activated receptor gamma in white and brown adipocyte regulation and differentiation. Physiol. Res. 2020, 69, 759–773. [Google Scholar] [CrossRef]
- Goldberg, I.J.; Eckel, R.H.; Abumrad, N.A. Regulation of fatty acid uptake into tissues: Lipoprotein lipase—And CD36-mediated pathways. J. Lipid Res. 2009, 50, S86–S90. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Xiaoli, A.M.; Yang, F. Regulation and Metabolic Significance of De Novo Lipogenesis in Adipose Tissues. Nutrients 2018, 10, 1383. [Google Scholar] [CrossRef] [PubMed]
- Bartelt, A.; Weigelt, C.; Cherradi, M.L.; Niemeier, A.; Tödter, K.; Heeren, J.; Scheja, L. Effects of adipocyte lipoprotein lipase on de novo lipogenesis and white adipose tissue browning. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids. 2013, 1831, 934–942. [Google Scholar] [CrossRef]
- Thiagarajan, L.; Abu-Awwad, H.A.M.; Dixon, J.E. Osteogenic Programming of Human Mesenchymal Stem Cells with Highly Efficient Intracellular Delivery of RUNX2. Stem Cells Transl. Med. 2017, 6, 2146–2159. [Google Scholar] [CrossRef]
- Berendsen, A.D.; Olsen, B.R. Regulation of adipogenesis and osteogenesis in mesenchymal stem cells by vascular endothelial growth factor A. J. Intern. Med. 2015, 277, 674–680. [Google Scholar] [CrossRef] [PubMed]
- Park, K.-H.; Kang, J.W.; Lee, E.-M.; Kim, J.S.; Rhee, Y.H.; Kim, M.; Jeong, S.J.; Park, Y.G.; Kim, S.H. Melatonin promotes osteoblastic differentiation through the BMP/ERK/Wnt signaling pathways. J. Pineal Res. 2011, 51, 187–194. [Google Scholar] [CrossRef]
- Nakamura, A.; Dohi, Y.; Akahane, M.; Ohgushi, H.; Nakajima, H.; Funaoka, H.; Takakura, Y. Osteocalcin secretion as an early marker of in vitro osteogenic differentiation of rat mesenchymal stem cells. Tissue Eng. Part. C Methods. 2009, 15, 169–180. [Google Scholar] [CrossRef]
- Hanna, H.; Mir, L.M.; Andre, F.M. In vitro osteoblastic differentiation of mesenchymal stem cells generates cell layers with distinct properties. Stem Cell Res. Ther. 2018, 9, 203. [Google Scholar] [CrossRef]
- Marupanthorn, K.; Tantrawatpan, C.; Kheolamai, P.; Tantikanlayaporn, D.; Manochantr, S. Bone morphogenetic protein-2 enhances the osteogenic differentiation capacity of mesenchymal stromal cells derived from human bone marrow and umbilical cord. Int. J. Mol. Med. 2017, 39, 654–662. [Google Scholar] [CrossRef]
- Sun, J.; Li, J.; Li, C.; Yu, Y. Role of bone morphogenetic protein-2 in osteogenic differentiation of mesenchymal stem cells. Mol. Med. Rep. 2015, 12, 4230–4237. [Google Scholar] [CrossRef]
- Ansari, S.; Ito, K.; Hofmann, S. Alkaline Phosphatase Activity of Serum Affects Osteogenic Differentiation Cultures. ACS Omega 2022, 7, 12724–12733. [Google Scholar] [CrossRef]
- Hoemann, C.D.; El-Gabalawy, H.; McKee, M.D. In vitro osteogenesis assays: Influence of the primary cell source on alkaline phosphatase activity and mineralization. Pathol. Biol. 2009, 57, 318–323. [Google Scholar] [CrossRef]
- Trivedi, S.; Srivastava, K.; Gupta, A.; Saluja, T.S.; Kumar, S.; Mehrotra, D.; Singh, S.K. A quantitative method to determine osteogenic differentiation aptness of scaffold. J. Oral. Biol. Craniofac. Res. 2020, 10, 158–160. [Google Scholar] [CrossRef]
- Martin, E.C.; Qureshi, A.T.; Dasa, V.; Freitas, M.A.; Gimble, J.M.; Davis, T.A. MicroRNA regulation of stem cell differentiation and diseases of the bone and adipose tissue: Perspectives on miRNA biogenesis and cellular transcriptome. Biochimie 2016, 124, 98–111. [Google Scholar] [CrossRef]
- Hang, W.; Feng, Y.; Sang, Z.; Yang, Y.; Zhu, Y.; Huang, Q.; Xi, X. Downregulation of miR-145-5p in cancer cells and their derived exosomes may contribute to the development of ovarian cancer by targeting CT. Int. J. Mol. Med. 2018, 43, 256–266. [Google Scholar] [CrossRef]
- Lei, Z.; Shi, H.; Li, W.; Yu, D.; Shen, F.; Yu, X.; Lu, D.; Sun, C.; Liao, K. miR-185 inhibits non-small cell lung cancer cell proliferation and invasion through targeting of SOX9 and regulation of Wnt signaling. Mol. Med. Rep. 2017, 17, 1742–1752. [Google Scholar] [CrossRef]
- Okumura, S.; Hirano, Y.; Komatsu, Y. Stable duplex-linked antisense targeting miR-148a inhibits breast cancer cell proliferation. Sci. Rep. 2021, 11, 11467. [Google Scholar] [CrossRef]
- Li, C.; Ren, S.; Xiong, H.; Chen, J.; Jiang, T.; Guo, J.; Yan, C.; Chen, Z.; Yang, X.; Xu, X. MiR-145-5p overexpression rejuvenates aged adipose stem cells and accelerates wound healing. Biol. Open 2024, 13, bio060117. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhu, W.; Wang, L.; Wu, J.; Ding, F.; Song, Y. miR-145-5p suppresses osteogenic differentiation of adipose-derived stem cells by targeting semaphorin 3A. Vitr. Cell. Dev. Biol. Anim. 2019, 55, 189–202. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Chen, Y.; Zhang, Y.; Zhang, Y.; Chen, L.; Mo, D. Up-regulated miR-145 expression inhibits porcine preadipocytes differentiation by targeting IRS1. Int. J. Biol. Sci. 2012, 8, 1408–1417. [Google Scholar] [CrossRef] [PubMed]
- Tian, L.; Zheng, F.; Li, Z.; Wang, H.; Yuan, H.; Zhang, X.; Ma, Z.; Li, X.; Gao, X.; Wang, B. miR-148a-3p regulates adipocyte and osteoblast differentiation by targeting lysine-specific demethylase 6b. Gene 2017, 627, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.; Zhang, M.; Tong, M.; Yang, L.; Pang, L.; Chen, L.; Xu, G.; Chi, X.; Hong, Q.; Ni, Y.; et al. miR-148a is Associated with Obesity and Modulates Adipocyte Differentiation of Mesenchymal Stem Cells through Wnt Signaling. Sci. Rep. 2015, 5, 9930. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Liu, W.; Song, Z.; Chang, D. miR-148a overexpression inhibits cell proliferation and induces cell apoptosis by suppressing the Wnt/?-catenin signal pathway in breast cancer MCF-7 cells. Int. J. Clin. Exp. Pathol. 2016, 9, 3349–3356. [Google Scholar]
- Wang, B.; Li, J.; Sun, M.; Sun, L.; Zhang, X. miRNA expression in breast cancer varies with lymph node metastasis and other clinicopathologic features. IUBMB Life 2014, 66, 371–377. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Wang, Y.Y.; Xu, Y.; Zhang, L.; Zhu, J.; Si, P.C.; Wang, Y.W.; Ma, R. A two-miRNA signature of upregulated miR-185-5p and miR-362-5p as a blood biomarker for breast cancer. Pathol. Res. Pract. 2021, 222, 153458. [Google Scholar] [CrossRef] [PubMed]
- Cui, Q.; Xing, J.; Yu, M.; Wang, Y.; Xu, J.; Gu, Y.; Nan, X.; Ma, W.; Liu, H.; Zhao, H. Mmu-miR-185 depletion promotes osteogenic differentiation and suppresses bone loss in osteoporosis through the Bgn-mediated BMP/Smad pathway. Cell Death Dis. 2019, 10, 172. [Google Scholar] [CrossRef] [PubMed]
- Chang, H.; Wang, Y.; Liu, H.; Nan, X.; Wong, S.; Peng, S.; Gu, Y.; Zhao, H.; Feng, H. Mutant Runx2 regulates amelogenesis and osteogenesis through a miR-185-5p-Dlx2 axis. Cell Death Dis. 2017, 8, 3221. [Google Scholar] [CrossRef]
- Ning, C.; Li, G.; You, L.; Ma, Y.; Jin, L.; Ma, J.; Li, X.; Li, M.; Liu, H. MiR-185 inhibits 3T3-L1 cell differentiation by targeting SREBP-1. Biosci. Biotechnol. Biochem. 2017, 81, 1747–1754. [Google Scholar] [CrossRef]
- Welch, D.R.; Hurst, D.R. Defining the Hallmarks of Metastasis. Cancer Res. 2019, 79, 3011–3027. [Google Scholar] [CrossRef]
Name | Reverse | Forward |
---|---|---|
PPAR-γ | GTGAAGACCAGCCTCTTTGC | AATCCGTCTTCATCCACAGG |
aP2 | TCATTTTCCCACTCCAGCCC | AGACATTCTACGGGCAGCAC |
LPL | GGGACCCTCTGGTGAATGTG | CAGGATGTGGCCCGGTTTAT |
ACOT2 | TCTTGGCCTCGAATGGTATC | GAGGTCTTCACACTGCACCA |
RUNX2 | TCGTCCACTCCGGCCCACAA | CTGTGCTCGGTGCTGCCCTC |
BMP2 | GGCTGACCTGAGTGCCTGCG | GCGTTGCTGCTTCCCCAGGT |
OCN | GACACCCTAGACCGGGCCGT | GAGCCCCAGTCCCCTACCCG |
ALP | GCATTGGTGTTGTACGTCTTG | CAACCCTGGGGAGGAGAC |
GAPDH | GACAAGCTTCCCGTTCTCAG | GAGTCAACGGATTTGGTCGT |
Accession ID Number | Symbol | Sequence |
---|---|---|
MIMAT0000437 | hsa-miR-145-5p | GUCCAGUUUUCCCAGGAAUCCCU |
MIMAT0000243 | hsa-miR-148a-3p | UCAGUGCACUACAGAACUUUGU |
MIMAT0004611 | hsa-miR-185-3p | AGGGGCUGGCUUUCCUCUGGUC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Garroni, G.; Cruciani, S.; Serra, D.; Pala, R.; Coradduzza, D.; Cossu, M.L.; Ginesu, G.C.; Ventura, C.; Maioli, M. Effects of the MCF-7 Exhausted Medium on hADSC Behaviour. Int. J. Mol. Sci. 2024, 25, 7026. https://doi.org/10.3390/ijms25137026
Garroni G, Cruciani S, Serra D, Pala R, Coradduzza D, Cossu ML, Ginesu GC, Ventura C, Maioli M. Effects of the MCF-7 Exhausted Medium on hADSC Behaviour. International Journal of Molecular Sciences. 2024; 25(13):7026. https://doi.org/10.3390/ijms25137026
Chicago/Turabian StyleGarroni, Giuseppe, Sara Cruciani, Diletta Serra, Renzo Pala, Donatella Coradduzza, Maria Laura Cossu, Giorgio Carlo Ginesu, Carlo Ventura, and Margherita Maioli. 2024. "Effects of the MCF-7 Exhausted Medium on hADSC Behaviour" International Journal of Molecular Sciences 25, no. 13: 7026. https://doi.org/10.3390/ijms25137026