Effects of Foliar Dressing with Chemical Nano-Selenum and Na2SeO3 on the Antioxidant System and Accumulation of Se and Bioactive Components in Cyclocarya paliurus (Sweet Tea Tree)
Abstract
:1. Introduction
2. Results
2.1. The Effects of Na2SeO3 and Che-SeNPs on the Se Concentration in C. paliurus
2.2. The Effects of Na2SeO3 and Che-SeNPs on the Concentrations of Secondary Metabolites in C. paliurus
2.3. The Effects of Che-SeNPs and Na2SeO3 on the Antioxidant Activity of C. paliurus
2.4. The Effects of Che-SeNPs and Na2SeO3 on the Malondialdehyde Content of C. paliurus
2.5. Effect of Se Speciation in C. paliurus
2.6. Relative Gene Expression
3. Discussion
3.1. The Effect of Se on Secondary Metabolites in C. paliurus
3.2. Effects of Se on the Antioxidant System of C. paliurus
3.3. Molecular Mechanism of Organic Se Transformation in C. paliurus
4. Materials and Methods
4.1. Treatment of Plant Materials
4.2. Determination of Se and Secondary Metabolites Content in Leaves of C. paliurus
4.3. Determination of Antioxidant System
4.4. Screening and Expression Pattern Analysis of Se-Metabolism-Related Genes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dey, S.; Raychaudhuri, S.S. Selenium Biofortification Improves Bioactive Composition and Antioxidant Status in Plantago ovata Forsk., a Medicinal Plant. Genes Environ. 2023, 45, 38–50. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Xie, X.; Wang, L. Selenium Nutrition and Human Health. Food Ind. 2022, 43, 325–330. [Google Scholar]
- Bai, X.; Zhou, H.; Luo, D.; Chen, D.; Fan, J.; Shao, X.; Zhou, J.; Liu, W. A Rational Combination of Cyclocarya paliurus Triterpene Acid Complex (TAC) and Se-Methylselenocysteine (MSC) Improves Glucose and Lipid Metabolism Via the PI3K/Akt/GSK3β Pathway. Molecules 2023, 28, 5499. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Zhou, G.; Qin, H.; Guan, Y.; Wang, T.; Ni, W.; Xie, H.; Xing, Y.; Tian, G.; Lyu, M.; et al. Metabolomics Combined with Physiology and Transcriptomics Reveal Key Metabolic Pathway Responses in Apple Plants Exposure to Different Selenium Concentrations. J. Hazard. Mater. 2024, 464, 132953. [Google Scholar] [CrossRef] [PubMed]
- Ran, M.; Wu, J.; Jiao, Y.; Li, J. Biosynthetic Selenium Nanoparticles (Bio-Senps) Mitigate the Toxicity of Antimony (Sb) in Rice (Oryza sativa L.) by Limiting Sb Uptake, Improving Antioxidant Defense System and Regulating Stress-Related Gene Expression. J. Hazard. Mater. 2024, 470, 134263. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Yu, Y.; Li, J.; Wan, Y.; Huang, Q.; Guo, Y.; Li, H. Effects of Different Forms of Selenium Fertilizers on Se Accumulation, Distribution, and Residual Effect in Winter Wheat–Summer Maize Rotation System. J. Agric. Food Chem. 2017, 65, 1116–1123. [Google Scholar] [CrossRef]
- Mrština, T.; Praus, L.; Száková, J.; Kaplan, L.; Tlustoš, P. Foliar Selenium Biofortification of Soybean: The Potential for Transformation of Mineral Selenium into Organic Forms. Front. Plant Sci. 2024, 15, 1379877. [Google Scholar] [CrossRef] [PubMed]
- Eghlima, G.; Chegini, K.G.; Farzaneh, M.; Aghamir, F. Effect of Common Horsetail Extract on Growth Characteristics, Essential Oil Yield and Chemical Compositions of Basil (Ocimum basilicum L.). Sci. Rep. 2024, 14, 11082. [Google Scholar] [CrossRef]
- Jia, Y.; Kang, L.; Wu, Y.; Zhou, C.; Cai, R.; Zhang, H.; Li, J.; Chen, Z.; Kang, D.; Zhang, L.; et al. Nano-Selenium Foliar Intervention-Induced Resistance of Cucumber to Botrytis cinerea by Activating Jasmonic Acid Biosynthesis and Regulating Phenolic Acid and Cucurbitacin. Pest Manag. Sci. 2023, 80, 554–568. [Google Scholar] [CrossRef]
- Hussain, B.; Yin, X.; Lin, Q.; Hamid, Y.; Usman, M.; Hashmi, M.L.-u.-R.; Lu, M.; Imran Taqi, M.; He, Z.; Yang, X.e. Mitigating Cadmium Exposure Risk in Rice with Foliar Nano-Selenium: Investigations through Caco-2 Human Cell Line in-Vivo Bioavailability Assay. Environ. Pollut. 2024, 356, 124356. [Google Scholar] [CrossRef]
- Di, X.; Jing, R.; Qin, X.; Liang, X.; Wang, L.; Xu, Y.; Sun, Y.; Huang, Q. The Role and Transcriptomic Mechanism of Cell Wall in the Mutual Antagonized Effects between Selenium Nanoparticles and Cadmium in Wheat. J. Hazard. Mater. 2024, 472, 134549. [Google Scholar] [CrossRef] [PubMed]
- Aly, R.A.M.; Abdel-Halim, K.Y. Effect of Bio-Fertilizer and Foliar Spray of Selenium of Growth, Yield and Quality of Potato Plants. Acad. J. Life Sci. 2020, 6, 1–7. [Google Scholar] [CrossRef]
- Li, J.; Yang, W.; Guo, A.; Qi, Z.; Chen, J.; Huang, T.; Yang, Z.; Gao, Z.; Sun, M.; Wang, J. Combined Foliar and Soil Selenium Fertilizer Increased the Grain Yield, Quality, Total Se, and Organic Se Content in Naked Oats. J. Cereal Sci. 2021, 100, 103265. [Google Scholar] [CrossRef]
- Pezzarossa, B.; Remorini, D.; Gentile, M.L.; Massai, R. Effects of Foliar and Fruit Addition of Sodium Selenate on Selenium Accumulation and Fruit Quality. J. Sci. Food Agric. 2011, 92, 781–786. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, B.; Shang, X.; Fang, S.; Ensminger, I. RNA in Situ Hybridization and Expression of Related Genes Regulating the Accumulation of Triterpenoids in Cyclocarya paliurus. Tree Physiol. 2021, 41, 2189–2197. [Google Scholar] [CrossRef]
- Xi, H.; Xu, W.; He, F.; Liu, Z.; Wang, Y.; Xie, J. Spatial Metabolome of Biosynthesis and Metabolism in Cyclocarya paliurus Leaves. Food Chem. 2024, 443, 138519. [Google Scholar] [CrossRef]
- Chen, X.; Wang, X.; Shen, M.; Chen, Y.; Yu, Q.; Yang, J.; Xie, J. Combined RNA-Seq and Molecular Biology Technology Revealed the Protective Effect of Cyclocarya paliurus Polysaccharide on H2O2-Induced Oxidative Damage in L02 Cells Thought Regulating Mitochondrial Function, Oxidative Stress and PI3k/Akt and MAPK Signaling Pathways. Food Res. Int. 2022, 155, 111080. [Google Scholar] [CrossRef]
- Li, J.; He, J.; He, H.; Wang, X.; Zhang, S.; He, Y.; Zhang, J.; Yuan, C.; Wang, H.; Xu, D.; et al. Sweet Triterpenoid Glycoside from Cyclocarya paliurus Ameliorates Obesity-Induced Insulin Resistance through Inhibiting the Tlr4/Nf-Κb/Nlrp3 Inflammatory Pathway. Curr. Res. Food Sci. 2024, 8, 100677. [Google Scholar] [CrossRef]
- Yao, X.; Lin, Z.; Jiang, C.; Gao, M. Cyclocarya paliurus Prevents High Fat Diet Induced Hyperlipidemia and Obesity in Sprague-Dawley Rats. Can. J. Physiol. Pharmacol. 2015, 93, 677–686. [Google Scholar] [CrossRef]
- Zhang, S.; He, J.; Li, J.; He, H.; He, Y.; Wang, X.; Shu, H.; Zhang, J.; Xu, D.; Zou, K. Triterpenoid Compounds from Cyclocarya paliurus: A Review of Their Phytochemistry, Quality Control, Pharmacology, and Structure–Activity Relationship. Am. J. Chin. Med. 2023, 51, 2041–2075. [Google Scholar] [CrossRef]
- Luo, D.; Bai, X.; Chen, D.; Xiang, J.; Fan, J. Effects of Selenium-Enriched Cyclocarya paliurus and Polygonatum sibiricum Compounds on Lowering Uric Acid in Mice with Hyperuricemia. Pharm. Today 2021, 31, 353–356. [Google Scholar] [CrossRef]
- Shao, X.; Xiang, J.; Fan, J. Clinical Effect of Selenium-Enriched Cylocarya paliurus Solomonseal Rhizome Tea on Blood Lipid Regulation in Patients with Hyperlipidemia. Guide China Med. 2023, 21, 49–52. [Google Scholar] [CrossRef]
- Shao, X.; Xiang, J.; Fan, J. The Effects of Selenium-Enriched Qingqian Willow Yellow Essence Tea on Reducing Hba1c in Diabetic Patients. Guide China Med. 2024, 22, 128–130. [Google Scholar] [CrossRef]
- Abdalla, M.A.; Mühling, K.H. Selenium Exerts an Intriguing Alteration of Primary and Secondary Plant Metabolites: Advances, Challenges, and Prospects. Crit. Rev. Plant Sci. 2023, 42, 34–52. [Google Scholar] [CrossRef]
- Fan, Z.; Jia, W.; Du, A.; Xia, Z.; Kang, J.; Xue, L.; Sun, Y.; Shi, L. Discovery of Se-Containing Flavone in Se-Enriched Green Tea and the Potential Application Value in the Immune Regulation. Food Chem. 2022, 394, 133468. [Google Scholar] [CrossRef] [PubMed]
- Qi, Z.; Duan, A.; Ng, K. Selenosugar, Selenopolysaccharide, and Putative Selenoflavonoid in Plants. Compr. Rev. Food Sci. Food Saf. 2024, 23, e13329. [Google Scholar] [CrossRef]
- Mimmo, T.; Tiziani, R.; Valentinuzzi, F.; Lucini, L.; Nicoletto, C.; Sambo, P.; Scampicchio, M.; Pii, Y.; Cesco, S. Selenium Biofortification in Fragaria × Ananassa: Implications on Strawberry Fruits Quality, Content of Bioactive Health Beneficial Compounds and Metabolomic Profile. Front. Plant Sci. 2017, 8, 1887. [Google Scholar] [CrossRef] [PubMed]
- Abdalla, M.A.; Famuyide, I.; Wooding, M.; McGaw, L.J.; Mühling, K.H. Secondary Metabolite Profile and Pharmacological Opportunities of Lettuce Plants Following Selenium and Sulfur Enhancement. Pharmaceutics 2022, 14, 2267. [Google Scholar] [CrossRef]
- Li, L.; Yu, J.; Li, L.; Rao, S.; Wu, S.; Wang, S.; Cheng, S.; Cheng, H. Treatment of Ginkgo biloba with Exogenous Sodium Selenite Affects Its Physiological Growth, Changes Its Phytohormones, and Synthesizes Its Terpene Lactones. Molecules 2022, 27, 7548. [Google Scholar] [CrossRef]
- Li, M.; Zhao, Z.; Zhou, J.; Zhou, D.; Chen, B.; Huang, L.; Zhang, Z.; Liu, X. Effects of a Foliar Spray of Selenite or Selenate at Different Growth Stages on Selenium Distribution and Quality of Blueberries. J. Sci. Food Agric. 2018, 98, 4700–4706. [Google Scholar] [CrossRef]
- Niu, H.; Zhan, K.; Cheng, X.; Deng, Y.; Hou, C.; Zhao, M.; Peng, C.; Chen, G.; Hou, R.; Li, D.; et al. Selenium Foliar Application Contributes to Decrease Ratio of Water-Soluble Fluoride and Improve Physio-Biochemical Components in Tea Leaves. Ecotoxicol. Environ. Saf. 2023, 266, 115568. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Dong, Y.; Zhu, N.; Jin, H. Foliar Application of Biosynthetic Nano-Selenium Alleviates the Toxicity of Cd, Pb, and Hg in Brassica chinensis by Inhibiting Heavy Metal Adsorption and Improving Antioxidant System in Plant. Ecotoxicol. Environ. Saf. 2022, 240, 113681. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Wang, S.; Wu, S.; Rao, S.; Li, L.; Cheng, S.; Cheng, H. Morphological and Physiological Indicators and Transcriptome Analyses Reveal the Mechanism of Selenium Multilevel Mitigation of Cadmium Damage in Brassica juncea. Plants 2023, 12, 1583. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Chang, F.; Dong, Q.; Jia, P.; Luan, H.; Wang, X.; Zhang, J.; Yuan, X.; Zhang, X.; Yang, S.; et al. Selenium Application During Fruit Development Can Effectively Inhibit Browning of Fresh-cut Apples by Enhancing Antioxidant Capacity and Suppressing Polyphenol Oxidase Activity. J. Plant Physiol. 2023, 287, 154050. [Google Scholar] [CrossRef]
- Wang, M.; Mu, C.; Li, Y.; Wang, Y.; Ma, W.; Ge, C.; Cheng, C.; Shi, G.; Li, H.; Zhou, D. Foliar Application of Selenium Nanoparticles Alleviates Cadmium Toxicity in Maize (Zea mays L.) Seedlings: Evidence on Antioxidant, Gene Expression, and Metabolomics Analysis. Sci. Total Environ. 2023, 899, 165521. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, Z.; Fang, S.; Liu, Y.; Shang, X. Integrative Analysis of Metabolome and Transcriptome Reveals Molecular Regulatory Mechanism of Flavonoid Biosynthesis in Cyclocarya paliurus under Salt Stress. Ind. Crops Prod. 2021, 170, 113823. [Google Scholar] [CrossRef]
- Xia, Q.; Wang, Z.; Chen, X.; Dong, X.; Cheng, S.; Zhang, S. Effects on the Synthesis and Accumulation of Triterpenes in Leaves of Cyclocarya paliurus under MeJA Treatment. Forests 2023, 14, 1735. [Google Scholar] [CrossRef]
- Qin, J.; Yue, X.; Ling, Y.; Zhou, Y.; Li, N.; Shang, X.; Fang, S. Nitrogen Form and Ratio Impact Phenolic Accumulation and Relative Gene Expression in Cyclocarya paliurus. Trees 2021, 35, 685–696. [Google Scholar] [CrossRef]
Treatment | Sampling Time (d) | Content of Different Se Forms (μg/g DW) | |||
---|---|---|---|---|---|
SeCys2 | MeSeCys | Se4+ | SeMet | ||
CK | 10 | 0.01329 ± 0.00060a | 0.01689 ± 0.00059b | 0.01464 ± 0.00390b | — |
Che-SeNPs | 0.00261 ± 0.00028b | 0.11256 ± 0.00581b | 0.07568 ± 0.00640b | 0.01582 ± 0.06102c | |
Na2SeO3 | — | 3.41292 ± 0.85489a | 2.31044 ± 0.57598a | 0.02058 ± 0.03565b | |
CK | 15 | 0.01015 ± 0.01544a | 0.04717 ± 0.00230d | 0.03159 ± 0.00116d | — |
Che-SeNPs | — | 0.14418 ± 0.00860a | 0.09492 ± 0.00627a | — | |
Na2SeO3 | — | 0.06318 ± 0.00383b | 0.04130 ± 0.00148b | — | |
CK | 20 | — | 0.01422 ± 0.02915d | 0.01311 ± 0.01399d | — |
Che-SeNPs | — | 0.14723 ± 0.00411b | 0.09673 ± 0.00517b | — | |
Na2SeO3 | — | 1.29495 ± 0.05173a | 0.86270 ± 0.03334a | 0.00377 ± 0.00653a | |
CK | 25 | — | 0.03250 ± 0.03041b | 0.03093 ± 0.00198b | — |
Che-SeNPs | — | 0.00968 ± 0.01113c | 0.00941 ± 0.00041c | 0.00306 ± 0.00521a | |
Na2SeO3 | — | 0.07881 ± 0.00618a | 0.05159 ± 0.00500a | 0.00218 ± 0.00475b | |
CK | 30 | 0.00918 ± 0.00363a | — | 0.0012 ± 0.00536a | 0.00501 ± 0.00295b |
Che-SeNPs | 0.00024 ± 0.00112b | — | — | 0.00333 ± 0.01032c | |
Na2SeO3 | — | — | — | 0.00984 ± 0.01277a |
Primer Name | Primer Sequence (5′ to 3′) |
---|---|
18s | F: AGTATGGTCGCAAGGCTGAAA |
R: CAGACAAATCGCTCCACCAA | |
APR | F: GACCGCACTCATTCTCTATC |
R: TCCTCCACCTCTACCTTCT | |
APS | F: GTCGTCGGCTTCTTGAGATG |
R: TCGTAGTAGTCAACCAGCACTT | |
CS | F: CTCCAGGAAGGCTTGTTG |
R: GCACGCTACGGATGATAG | |
GR | F: GTGGAACTTGACGAGACAG |
R: CAACTGCCTGCTCTTCAC | |
MMT | F: AAGCCTTCTCAGACTTGGTAG |
R: ACTGATAGTGGCACAGAATT | |
SMT | F: CAGAGTGTGCCTCCATTG |
R: GCTTCCGTATAGATGTAATCAG | |
SR | F: GGTCTCAGGTCCTCCAACTC |
R: CATCCGTCAACATCTCCTCATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Xia, Q.; Wang, Z.; Dong, Y.; Dong, X.; Zhang, S.; Cheng, S. Effects of Foliar Dressing with Chemical Nano-Selenum and Na2SeO3 on the Antioxidant System and Accumulation of Se and Bioactive Components in Cyclocarya paliurus (Sweet Tea Tree). Int. J. Mol. Sci. 2024, 25, 7433. https://doi.org/10.3390/ijms25137433
Chen X, Xia Q, Wang Z, Dong Y, Dong X, Zhang S, Cheng S. Effects of Foliar Dressing with Chemical Nano-Selenum and Na2SeO3 on the Antioxidant System and Accumulation of Se and Bioactive Components in Cyclocarya paliurus (Sweet Tea Tree). International Journal of Molecular Sciences. 2024; 25(13):7433. https://doi.org/10.3390/ijms25137433
Chicago/Turabian StyleChen, Xiaoling, Qinghui Xia, Zijue Wang, Yulan Dong, Xingxing Dong, Shaopeng Zhang, and Shuiyuan Cheng. 2024. "Effects of Foliar Dressing with Chemical Nano-Selenum and Na2SeO3 on the Antioxidant System and Accumulation of Se and Bioactive Components in Cyclocarya paliurus (Sweet Tea Tree)" International Journal of Molecular Sciences 25, no. 13: 7433. https://doi.org/10.3390/ijms25137433