Effect of Torilis japonica Fruit Extract for Endothelium-Independent Vasorelaxation and Blood Pressure Lowering in Rats
Abstract
:1. Introduction
2. Results
2.1. Sample Extraction and DNA Identification
2.2. Qualitative and Quantitative HPLC Analysis of TJ Extracts
2.3. Vasodilatory Effects of TJE, TJW, and Torilin on the Isolated Thoracic Aortic Rings
2.4. Vasodilatory Effects of TJE on the Isolated Thoracic Aortic Rings with and without Endothelium
2.5. Vasodilatory Effects of TJE on the Thoracic Aortic Rings Pretreated with K+ Channel Blockers
2.6. Effects of TJE on Extracellular Ca2+-Induced Contraction Pre-Treated with PE, KCl, and Contractions with Nifedipine
2.7. Inhibitory Effect of TJE Pre-Treatment on Ang II-Induced Vasoconstriction
2.8. Anti-Hypertensive Effects of TJE in SHRs
3. Discussion
4. Materials and Methods
4.1. Materials and Chemicals
4.2. Animals
4.3. Sample Preparation
4.4. DNA Identification
4.5. HPLC Analysis of TJE and TJW
4.6. Analysis of the Vasodilatory Effects on the Thoracic Aortic Rings of SD Rats
4.7. Blood Pressure Measurement
4.8. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Poulter, N.R.; Prabhakaran, D.; Caulfield, M. Hypertension. Lancet 2015, 386, 801–812. [Google Scholar] [CrossRef] [PubMed]
- Mills, K.T.; Stefanescu, A.; He, J. The global epidemiology of hypertension. Nat. Rev. Nephrol. 2020, 16, 223–237. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Bentham, J.; Di Cesare, M.; Bixby, H.; Danaei, G.; Cowan, M.J.; Paciorek, C.J.; Singh, G.; Hajifathalian, K.; Bennett, J.E. Worldwide trends in blood pressure from 1975 to 2015: A pooled analysis of 1479 population-based measurement studies with 19·1 million participants. Lancet 2017, 389, 37–55. [Google Scholar] [CrossRef] [PubMed]
- Robles, N.R.; Macias, J.F. Hypertension in the elderly. Cardiovasc. Hematol. Agents Med. Chem. 2015, 12, 136–145. [Google Scholar] [CrossRef] [PubMed]
- Verdecchia, P.; Angeli, F.; Cavallini, C.; Aita, A.; Turturiello, D.; De Fano, M.; Reboldi, G. Sudden Cardiac Death in Hypertensive Patients. Hypertension 2019, 73, 1071–1078. [Google Scholar] [CrossRef] [PubMed]
- Laurent, S. Antihypertensive drugs. Pharmacol. Res. 2017, 124, 116–125. [Google Scholar] [CrossRef]
- Doroszko, A.; Janus, A.; Szahidewicz-Krupska, E.; Mazur, G.; Derkacz, A. Resistant Hypertension. Adv. Clin. Exp. Med. 2016, 25, 173–183. [Google Scholar] [CrossRef] [PubMed]
- Kloner, R. Erectile dysfunction and hypertension. Int. J. Impot. Res. 2007, 19, 296–302. [Google Scholar] [CrossRef] [PubMed]
- Giuliano, F.A.; Leriche, A.; Jaudinot, E.O.; de Gendre, A.S. Prevalence of erectile dysfunction among 7689 patients with diabetes or hypertension, or both. Urology 2004, 64, 1196–1201. [Google Scholar] [CrossRef]
- Javaroni, V.; Neves, M.F. Erectile dysfunction and hypertension: Impact on cardiovascular risk and treatment. Int. J. Hypertens. 2012, 2012, 627278. [Google Scholar] [CrossRef]
- Wespes, E. Smooth muscle pathology and erectile dysfunction. Int. J. Impot. Res. 2002, 14 (Suppl. 1), S17–S21. [Google Scholar] [CrossRef] [PubMed]
- Koroglu, G.; Kaya-Sezginer, E.; Yilmaz-Oral, D.; Gur, S. Management of Erectile Dysfunction: An Under-Recognition of Hypertension. Curr. Pharm. Des. 2018, 24, 3506–3519. [Google Scholar] [CrossRef] [PubMed]
- Vardi, Y.; Dayan, L.; Apple, B.; Gruenwald, I.; Ofer, Y.; Jacob, G. Penile and systemic endothelial function in men with and without erectile dysfunction. Eur. Urol. 2009, 55, 979–985. [Google Scholar] [CrossRef] [PubMed]
- Ghiadoni, L.; Versari, D.; Taddei, S. Phosphodiesterase 5 inhibition in essential hypertension. Curr. Hypertens. Rep. 2008, 10, 52–57. [Google Scholar] [CrossRef] [PubMed]
- Kitajima, J.; Suzuki, N.; Satoh, M.; Watanabe, M. Sesquiterpenoids of Torilis japonica fruit. Phytochemistry 2002, 59, 811–815. [Google Scholar] [CrossRef]
- Rahimpour, Y.; Doorandishan, M.; Dehsheikh, A.B.; Sourestani, M.M.; Mottaghipisheh, J. A Review on Torilis japonica: Ethnomedicinal, Phytochemical, and Biological Features. Chem. Biodivers. 2023, 20, e202201071. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.H.; Ahn, S.H.; Park, S.Y. Effects of Torilis Fructus Extract on the Relaxation of Corpus Cavernosum. J. Physiol. Pathol. Korean Med. 2018, 32, 24–29. [Google Scholar] [CrossRef]
- Kim, H.Y.; Eo, E.Y.; Park, H.; Kim, Y.C.; Park, S.; Shin, H.J.; Kim, K. Medicinal herbal extracts of Sophorae radix, Acanthopanacis cortex, Sanguisorbae radix and Torilis fructus inhibit coronavirus replication in vitro. Antivir. Ther. 2010, 15, 697–709. [Google Scholar] [CrossRef] [PubMed]
- Cho, W.I.; Choi, J.B.; Lee, K.; Chung, M.S.; Pyun, Y.R. Antimicrobial activity of torilin isolated from Torilis japonica fruit against Bacillus subtilis. J. Food Sci. 2008, 73, M37–M46. [Google Scholar] [CrossRef]
- Kim, G.T.; Kim, S.Y.; Kim, Y.M. Torilis japonica extract fraction compound, EGFR-targeted inhibition of cancer abnormal metastasis in A549 lung cancer cells. Oncol. Rep. 2017, 38, 1206–1212. [Google Scholar] [CrossRef]
- Song, D.H.; Jo, Y.H.; Ahn, J.H.; Kim, S.B.; Yun, C.Y.; Kim, Y.; Hwang, B.Y.; Lee, M.K. Sesquiterpenes from fruits of Torilis japonica with inhibitory activity on melanin synthesis in B16 cells. J. Nat. Med. 2018, 72, 155–160. [Google Scholar] [CrossRef]
- Seo, J.-W.; Lee, H.-J.; Youk, Y.-M.; Nam, G.-H.; Kim, Y.-M. Torilis japonica Extract Suppresses the Induction of Atopic Inflammation. Int. J. Mol. Sci. 2023, 24, 2102. [Google Scholar] [CrossRef]
- Endale, M.; Kim, T.H.; Kwak, Y.S.; Kim, N.M.; Kim, S.H.; Cho, J.Y.; Yun, B.S.; Rhee, M.H. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation. Mediat. Inflamm. 2017, 2017, 7250968. [Google Scholar] [CrossRef] [PubMed]
- Kwak, Y.G.; Kim, D.K.; Ma, T.Z.; Park, S.A.; Park, H.; Jung, Y.H.; Yoo, D.J.; Eun, J.S. Torilin from Torilis japonica (Houtt.) DC. blocks hKv1.5 channel current. Arch. Pharm. Res. 2006, 29, 834–839. [Google Scholar] [CrossRef]
- Song, I.B.; Ghimire, B.; Yu, C.Y.; Heo, K. Morphological and Anatomical Characteristics of Medicinal Fructus in Apiaceae. Korean J. Med. Crop Sci. 2015, 23, 400–405. [Google Scholar] [CrossRef]
- Lee, B.-Y.; Levin, G.A.; Downie, S.R. Relationships within the spiny-fruited umbellifers (Scandiceae subtribes Daucinae and Torilidinae) as assessed by phylogenetic analysis of morphological characters. Syst. Bot. 2001, 26, 622–642. [Google Scholar]
- Plaskova, A.; Mlcek, J. New insights of the application of water or ethanol-water plant extract rich in active compounds in food. Front. Nutr. 2023, 10, 1118761. [Google Scholar] [CrossRef]
- Jiang, Z.; Kempinski, C.; Chappell, J. Extraction and Analysis of Terpenes/Terpenoids. Curr. Protoc. Plant Biol. 2016, 1, 345–358. [Google Scholar] [CrossRef]
- Cerqueira, J.B.; Silva, L.F.; Lopes, L.G.; Moraes, M.E.; Nascimento, N.R. Relaxation of rabbit corpus cavernosum smooth muscle and aortic vascular endothelium induced by new nitric oxide donor substances of the nitrosyl-ruthenium complex. Int. Braz. J. Urol. 2008, 34, 638–647. [Google Scholar] [CrossRef] [PubMed]
- Knox, M.; Vinet, R.; Fuentes, L.; Morales, B.; Martínez, J.L. A Review of Endothelium-Dependent and -Independent Vasodilation Induced by Phytochemicals in Isolated Rat Aorta. Animals 2019, 9, 623. [Google Scholar] [CrossRef]
- Evora, P.R.; Evora, P.M.; Celotto, A.C.; Rodrigues, A.J.; Joviliano, E.E. Cardiovascular therapeutics targets on the NO-sGC-cGMP signaling pathway: A critical overview. Curr. Drug Targets 2012, 13, 1207–1214. [Google Scholar] [CrossRef] [PubMed]
- Corbin, J.D. Mechanisms of action of PDE5 inhibition in erectile dysfunction. Int. J. Impot. Res. 2004, 16 (Suppl. 1), S4–S7. [Google Scholar] [CrossRef] [PubMed]
- Baranowska, M.; Kozłowska, H.; Korbut, A.; Malinowska, B. Potassium channels in blood vessels: Their role in health and disease. Adv. Hyg. Exp. Med. 2007, 61, 596–605. [Google Scholar]
- Amberg, G.C.; Navedo, M.F. Calcium dynamics in vascular smooth muscle. Microcirculation 2013, 20, 281–289. [Google Scholar] [CrossRef] [PubMed]
- McFadzean, I.; Gibson, A. The developing relationship between receptor-operated and store-operated calcium channels in smooth muscle. Br. J. Pharmacol. 2002, 135, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Drapak, I.; Perekhoda, L.; Tsapko, T.; Berezniakova, N.; Tsapko, Y. Cardiovascular calcium channel blockers: Historical overview, development and new approaches in design. J. Heterocycl. Chem. 2017, 54, 2117–2128. [Google Scholar] [CrossRef]
- Kim, J.-E.; Choi, B.-K.; Choi, J.-Y.; Ryu, T.; Roh, W.S.; Song, S.-Y. Role of calcium channels responsible for phenylephrine-induced contraction in rat aorta 3 days after acute myocardial infarction. Korean J. Anesthesiol. 2014, 66, 143. [Google Scholar] [CrossRef]
- Coelho, R.R.; Souza, E.P.; Soares, P.M.; Meireles, A.V.P.; Santos, G.C.; Scarparo, H.C.; Assreuy, A.M.S.; Criddle, D.N. Effects of chloride channel blockers on hypotonicity-induced contractions of the rat trachea. Br. J. Pharmacol. 2004, 141, 367–373. [Google Scholar] [CrossRef]
- Reid, I.A.; Morris, B.J.; Ganong, W.F. The renin-angiotensin system. Annu. Rev. Physiol. 1978, 40, 377–410. [Google Scholar] [CrossRef] [PubMed]
- Studdy, P.R.; Lapworth, R.; Bird, R. Angiotensin-converting enzyme and its clinical significance—A review. J. Clin. Pathol. 1983, 36, 938–947. [Google Scholar] [CrossRef]
- Shade, R.E.; Davis, J.; Johnson, J.; Gotshall, R.; Spielman, W. Mechanism of action of antiotensin II and antidiuretic hormone on renin secretion. Am. J. Physiol.-Leg. Content 1973, 224, 926–929. [Google Scholar] [CrossRef] [PubMed]
- Te Riet, L.; van Esch, J.H.; Roks, A.J.; van den Meiracker, A.H.; Danser, A.J. Hypertension: Renin–angiotensin–aldosterone system alterations. Circ. Res. 2015, 116, 960–975. [Google Scholar] [CrossRef] [PubMed]
- McGrath, M.S.; Wentworth, B.J. The Renin–Angiotensin System in Liver Disease. Int. J. Mol. Sci. 2024, 25, 5807. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.-N.; Tain, Y.-L. Targeting the Renin–Angiotensin–Aldosterone System to Prevent Hypertension and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2021, 22, 2298. [Google Scholar] [CrossRef] [PubMed]
- Noureddine, F.Y.; Altara, R.; Fan, F.; Yabluchanskiy, A.; Booz, G.W.; Zouein, F.A. Correction: Noureddine et al. Impact of the Renin–Angiotensin System on the Endothelium in Vascular Dementia: Unresolved Issues and Future Perspectives. Int. J. Mol. Sci. 2020, 21, 4268. Int. J. Mol. Sci. 2024, 25, 2995. [Google Scholar] [CrossRef]
- Tain, Y.-L.; Hsu, C.-N. The Renin–Angiotensin System and Cardiovascular–Kidney–Metabolic Syndrome: Focus on Early-Life Programming. Int. J. Mol. Sci. 2024, 25, 3298. [Google Scholar] [CrossRef]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [PubMed]
- Cox, R.H. Basis for the altered arterial wall mechanics in the spontaneously hypertensive rat. Hypertension 1981, 3, 485–495. [Google Scholar] [CrossRef]
- Bernatova, I.; Conde, M.V.; Kopincova, J.; González, M.C.; Puzserova, A.; Arribas, S.M. Endothelial dysfunction in spontaneously hypertensive rats: Focus on methodological aspects. J. Hypertens. 2009, 27, S27–S31. [Google Scholar] [CrossRef]
- Berk, B.C.; Vallega, G.; Muslin, A.J.; Gordon, H.M.; Canessa, M.; Alexander, R.W. Spontaneously hypertensive rat vascular smooth muscle cells in culture exhibit increased growth and Na+/H+ exchange. J. Clin. Investig. 1989, 83, 822–829. [Google Scholar] [CrossRef]
- Uchino, K.; Frohlich, E.D.; Nishikimi, T.; Isshiki, T.; Kardon, M.B. Spontaneously hypertensive rats demonstrate increased renal vascular alpha 1-adrenergic receptor responsiveness. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1991, 260, R889–R893. [Google Scholar] [CrossRef] [PubMed]
- Etheridge, A.S.; Kroll, D.J.; Mathews, J.M. Inhibition of paclitaxel metabolism in vitro in human hepatocytes by Ginkgo biloba preparations. J. Diet. Suppl. 2009, 6, 104–110. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Gibbs, S.T.; Fang, L.; Miller, H.A.; Landowski, C.P.; Shin, H.C.; Lennernas, H.; Zhong, Y.; Amidon, G.L.; Yu, L.X.; et al. Why is it challenging to predict intestinal drug absorption and oral bioavailability in human using rat model. Pharm. Res. 2006, 23, 1675–1686. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Ford, C.S.; Ayres, K.L.; Toomey, N.; Haider, N.; Van Alphen Stahl, J.; Kelly, L.J.; Wikström, N.; Hollingsworth, P.M.; Duff, R.J.; Hoot, S.B. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. Soc. 2009, 159, 1–11. [Google Scholar] [CrossRef]
- Goldman, D.H.; Freudenstein, J.V.; Kores, P.J.; Molvray, M.; Jarrell, D.C.; Whitten, W.M.; Cameron, K.M.; Jansen, R.K.; Chase, M.W. Phylogenetics of Arethuseae (Orchidaceae) based on plastid matK and rbcL sequences. Syst. Bot. 2001, 26, 670–695. [Google Scholar]
- Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef]
- Jung, J.; Shin, S.; Park, J.; Lee, K.; Choi, H.Y. Hypotensive and Vasorelaxant Effects of Sanguisorbae Radix Ethanol Extract in Spontaneously Hypertensive and Sprague Dawley Rats. Nutrients 2023, 15, 4510. [Google Scholar] [CrossRef]
- Shin, S.; Park, J.; Choi, H.Y.; Lee, K. Hypotensive and Endothelium-Dependent Vasorelaxant Effects of Grayblue Spicebush Ethanol Extract in Rats. Foods 2023, 12, 4282. [Google Scholar] [CrossRef]
- Shin, S.; Park, J.; Choi, H.Y.; Bu, Y.; Lee, K. Sakuranetin as a Potential Regulator of Blood Pressure in Spontaneously Hypertensive Rats by Promoting Vasorelaxation through Calcium Channel Blockade. Biomedicines 2024, 12, 346. [Google Scholar] [CrossRef]
- Park, J.; Shin, S.; Bu, Y.; Choi, H.-Y.; Lee, K. Vasorelaxant and Blood Pressure-Lowering Effects of Cnidium monnieri Fruit Ethanol Extract in Sprague Dawley and Spontaneously Hypertensive Rats. Int. J. Mol. Sci. 2024, 25, 4223. [Google Scholar] [CrossRef] [PubMed]
Marker | Primer Sequence (5′–3′) | Annealing Temperature (°C) | Reference |
---|---|---|---|
ITS | ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC | 55 | [54] |
matK | matK-XF: TAATTTACGATCAATTCATTC matK-5R: GTTCTAGCACAAGAAAGTCG | 50 | [55] |
rbcL | rbcL-1F: ATGTCACCACAAACAGAAAC rbcL-1360R: CTTCACAAGCAGCAGCTAGTTC | 57 | [56] |
trnL | trnL-F: CGAAATCGGTAGACGCTACG trnL-R: ATTTGAACTGGTGACACGAG | 55 | [57] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.; Shin, S.; Kim, Y.; Bu, Y.; Choi, H.-Y.; Lee, K. Effect of Torilis japonica Fruit Extract for Endothelium-Independent Vasorelaxation and Blood Pressure Lowering in Rats. Int. J. Mol. Sci. 2024, 25, 8101. https://doi.org/10.3390/ijms25158101
Park J, Shin S, Kim Y, Bu Y, Choi H-Y, Lee K. Effect of Torilis japonica Fruit Extract for Endothelium-Independent Vasorelaxation and Blood Pressure Lowering in Rats. International Journal of Molecular Sciences. 2024; 25(15):8101. https://doi.org/10.3390/ijms25158101
Chicago/Turabian StylePark, Junkyu, Sujin Shin, Youngmin Kim, Youngmin Bu, Ho-Young Choi, and Kyungjin Lee. 2024. "Effect of Torilis japonica Fruit Extract for Endothelium-Independent Vasorelaxation and Blood Pressure Lowering in Rats" International Journal of Molecular Sciences 25, no. 15: 8101. https://doi.org/10.3390/ijms25158101