Investigating the Anti-Inflammatory, Analgesic, and Chondroprotective Effects of Gynostemma pentaphyllum (Thunb.) Makino in Osteoarthritis: An In Vitro and In Vivo Study
Abstract
:1. Introduction
2. Results
2.1. HPLC Analysis
2.2. Effect on AAW Reponses
2.3. Analgesic Effects on MIA-Induced OA Model
2.4. Improving Effects of GP on Joint Cartilage Damage in OA Rat Model
2.5. Effects of GP on Inflammatory Cytokines in OA Rat Model
2.6. Effects of GP on Cytokine Responses in Cartilage
2.7. Effects of GP on Cytokine Responses in LPS-Treated RAW264.7 Cells
3. Discussion
4. Materials and Methods
4.1. Preparation of Gynostemma Pentaphyllum Extract (GP)
4.2. Analysis of GP Using High-Performance Liquid Chromatography (HPLC)
4.3. Animals
4.4. AAW Response
4.5. Design of OA Model and Sample Treatment
4.6. Weight-Bearing Measurement of the Hind Limb
4.7. Assessment of Chondral Degradation
4.8. Serum Analysis of MIA-Induced OA Animal Model
4.9. Cell Culture
4.10. Analysis of Cell Viability and Nitric Oxidate (NO) Production
4.11. Measurement of mRNA Expression Levels Using qRT-PCR
4.12. Analysis of Protein Expression by Western Blotting
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tong, L.; Yu, H.; Huang, X.; Shen, J.; Xiao, G.; Chen, L.; Wang, H.; Xing, L.; Chen, D. Current Understanding of Osteoarthritis Pathogenesis and Relevant New Approaches. Bone Res. 2022, 10, 60. [Google Scholar] [CrossRef]
- Tchkonia, T.; Palmer, A.K.; Kirkland, J.L. New Horizons: Novel Approaches to Enhance Healthspan Through Targeting Cellular Senescence and Related Aging Mechanisms. J. Clin. Endocrinol. Metab. 2021, 106, e1481–e1487. [Google Scholar] [CrossRef]
- Scott, A.J.; Ellison, M.; Sinclair, D.A. The Economic Value of Targeting Aging. Nat. Aging 2021, 1, 616–623. [Google Scholar] [CrossRef]
- Cao, F.; Xu, Z.; Li, X.-X.; Fu, Z.-Y.; Han, R.-Y.; Zhang, J.-L.; Wang, P.; Hou, S.; Pan, H.-F. Trends and Cross-Country Inequalities in the Global Burden of Osteoarthritis, 1990–2019: A Population-Based Study. Ageing Res. Rev. 2024, 99, 102382. [Google Scholar] [CrossRef]
- Robinson, W.H.; Lepus, C.M.; Wang, Q.; Raghu, H.; Mao, R.; Lindstrom, T.M.; Sokolove, J. Low-Grade Inflammation as a Key Mediator of the Pathogenesis of Osteoarthritis. Nat. Rev. Rheumatol. 2016, 12, 580–592. [Google Scholar] [CrossRef] [PubMed]
- Van den Bosch, M.H.J.; Blom, A.B.; van der Kraan, P.M. Inflammation in Osteoarthritis: Our View on Its Presence and Involvement in Disease Development over the Years. Osteoarthr. Cartil. 2024, 32, 355–364. [Google Scholar] [CrossRef] [PubMed]
- Childs, B.G.; Durik, M.; Baker, D.J.; van Deursen, J.M. Cellular Senescence in Aging and Age-Related Disease: From Mechanisms to Therapy. Nat. Med. 2015, 21, 1424–1435. [Google Scholar] [CrossRef] [PubMed]
- Chaib, S.; Tchkonia, T.; Kirkland, J.L. Cellular Senescence and Senolytics: The Path to the Clinic. Nat. Med. 2022, 28, 1556–1568. [Google Scholar] [CrossRef]
- Motta, F.; Barone, E.; Sica, A.; Selmi, C. Inflammaging and Osteoarthritis. Clin. Rev. Allergy Immunol. 2023, 64, 222–238. [Google Scholar] [CrossRef]
- Fulop, T.; Larbi, A.; Pawelec, G.; Khalil, A.; Cohen, A.A.; Hirokawa, K.; Witkowski, J.M.; Franceschi, C. Immunology of Aging: The Birth of Inflammaging. Clin. Rev. Allergy Immunol. 2023, 64, 109–122. [Google Scholar] [CrossRef]
- Han, D.; Fang, Y.; Tan, X.; Jiang, H.; Gong, X.; Wang, X.; Hong, W.; Tu, J.; Wei, W. The Emerging Role of Fibroblast-like Synoviocytes-Mediated Synovitis in Osteoarthritis: An Update. J. Cell Mol. Med. 2020, 24, 9518–9532. [Google Scholar] [CrossRef]
- De Roover, A.; Escribano-Núñez, A.; Monteagudo, S.; Lories, R. Fundamentals of Osteoarthritis: Inflammatory Mediators in Osteoarthritis. Osteoarthr. Cartil. 2023, 31, 1303–1311. [Google Scholar] [CrossRef] [PubMed]
- Yao, Q.; Wu, X.; Tao, C.; Gong, W.; Chen, M.; Qu, M.; Zhong, Y.; He, T.; Chen, S.; Xiao, G. Osteoarthritis: Pathogenic Signaling Pathways and Therapeutic Targets. Signal Transduct. Target. Ther. 2023, 8, 56. [Google Scholar] [CrossRef] [PubMed]
- Pereira, T.V.; Jüni, P.; Saadat, P.; Xing, D.; Yao, L.; Bobos, P.; Agarwal, A.; Hincapié, C.A.; da Costa, B.R. Viscosupplementation for Knee Osteoarthritis: Systematic Review and Meta-Analysis. BMJ 2022, 378, e069722. [Google Scholar] [CrossRef] [PubMed]
- Gibbs, A.J.; Gray, B.; Wallis, J.A.; Taylor, N.F.; Kemp, J.L.; Hunter, D.J.; Barton, C.J. Recommendations for the Management of Hip and Knee Osteoarthritis: A Systematic Review of Clinical Practice Guidelines. Osteoarthr. Cartil. 2023, 31, 1280–1292. [Google Scholar] [CrossRef]
- Gregori, D.; Giacovelli, G.; Minto, C.; Barbetta, B.; Gualtieri, F.; Azzolina, D.; Vaghi, P.; Rovati, L.C. Association of Pharmacological Treatments With Long-Term Pain Control in Patients With Knee Osteoarthritis: A Systematic Review and Meta-Analysis. JAMA 2018, 320, 2564–2579. [Google Scholar] [CrossRef]
- Da Costa, B.R.; Pereira, T.V.; Saadat, P.; Rudnicki, M.; Iskander, S.M.; Bodmer, N.S.; Bobos, P.; Gao, L.; Kiyomoto, H.D.; Montezuma, T.; et al. Effectiveness and Safety of Non-Steroidal Anti-Inflammatory Drugs and Opioid Treatment for Knee and Hip Osteoarthritis: Network Meta-Analysis. BMJ 2021, 375, n2321. [Google Scholar] [CrossRef]
- Richard, M.J.; Driban, J.B.; McAlindon, T.E. Pharmaceutical Treatment of Osteoarthritis. Osteoarthr. Cartil. 2023, 31, 458–466. [Google Scholar] [CrossRef]
- Motta, F.; Timilsina, S.; Gershwin, M.E.; Selmi, C. Steroid-Induced Osteonecrosis. J. Transl. Autoimmun. 2022, 5, 100168. [Google Scholar] [CrossRef]
- Deyle, G.D.; Allen, C.S.; Allison, S.C.; Gill, N.W.; Hando, B.R.; Petersen, E.J.; Dusenberry, D.I.; Rhon, D.I. Physical Therapy versus Glucocorticoid Injection for Osteoarthritis of the Knee. N. Engl. J. Med. 2020, 382, 1420–1429. [Google Scholar] [CrossRef]
- Mobasheri, A.; Loeser, R. Clinical Phenotypes, Molecular Endotypes and Theratypes in OA Therapeutic Development. Nat. Rev. Rheumatol. 2024, 20, 525–526. [Google Scholar] [CrossRef]
- Manivong, S.; Cullier, A.; Audigié, F.; Banquy, X.; Moldovan, F.; Demoor, M.; Roullin, V.G. New Trends for Osteoarthritis: Biomaterials, Models and Modeling. Drug Discov. Today 2023, 28, 103488. [Google Scholar] [CrossRef]
- Ren, J.-L.; Yang, L.; Qiu, S.; Zhang, A.-H.; Wang, X.-J. Efficacy Evaluation, Active Ingredients, and Multitarget Exploration of Herbal Medicine. Trends Endocrinol. Metab. 2023, 34, 146–157. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Yu, M.; Wang, H.; Wei, Y. Natural Anti-Inflammatory Products for Osteoarthritis: From Molecular Mechanism to Drug Delivery Systems and Clinical Trials. Phytother. Res. 2023, 37, 4321–4352. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Yu, L.; Li, W.; Ge, G.; Ma, Y.; Xiao, L.; Qiao, Y.; Huang, W.; Huang, W.; Wei, M.; et al. Prevention and Treatment of Inflammatory Arthritis with Traditional Chinese Medicine: Underlying Mechanisms Based on Cell and Molecular Targets. Ageing Res. Rev. 2023, 89, 101981. [Google Scholar] [CrossRef]
- Jo, H.-G.; Lee, G.-Y.; Baek, C.Y.; Song, H.S.; Lee, D. Analgesic and Anti-Inflammatory Effects of Aucklandia Lappa Root Extracts on Acetic Acid-Induced Writhing in Mice and Monosodium Iodoacetate-Induced Osteoarthritis in Rats. Plants 2020, 10, 42. [Google Scholar] [CrossRef] [PubMed]
- Jo, H.-G.; Baek, C.Y.; Kim, D.; Lee, D.; Song, H.S. Stem of Sorbus Commixta Hedl. Extract Inhibits Cartilage Degradation and Arthritic Pain in Experimental Model via Anti-Inflammatory Activity. Nutrients 2023, 15, 3774. [Google Scholar] [CrossRef]
- Jo, H.G.; Baek, C.Y.; Kim, D.; Kim, S.; Han, Y.; Park, C.; Song, H.S.; Lee, D. Network Analysis, in Vivo, and in Vitro Experiments Identified the Mechanisms by Which Piper Longum L. [Piperaceae] Alleviates Cartilage Destruction, Joint Inflammation, and Arthritic Pain. Front. Pharmacol. 2023, 14, 1282943. [Google Scholar] [CrossRef]
- Jo, H.-G.; Baek, C.Y.; Lee, J.; Hwang, Y.; Baek, E.; Hwang, J.H.; Lee, D. Anti-Inflammatory, Analgesic, Functional Improvement, and Chondroprotective Effects of Erigeron Breviscapus (Vant.) Hand.-Mazz. Extract in Osteoarthritis: An In Vivo and In Vitro Study. Nutrients 2024, 16, 1035. [Google Scholar] [CrossRef]
- Jo, H.-G.; Baek, C.-Y.; Song, H.S.; Lee, D. Network Pharmacology and Experimental Verifications to Discover Scutellaria Baicalensis Georgi’s Effects on Joint Inflammation, Destruction, and Pain in Osteoarthritis. Int. J. Mol. Sci. 2024, 25, 2127. [Google Scholar] [CrossRef]
- Fang, S.; Zhang, B.; Xiang, W.; Zheng, L.; Wang, X.; Li, S.; Zhang, T.; Feng, D.; Gong, Y.; Wu, J.; et al. Natural Products in Osteoarthritis Treatment: Bridging Basic Research to Clinical Applications. Chin. Med. 2024, 19, 25. [Google Scholar] [CrossRef] [PubMed]
- Jo, H.-G.; Seo, J.; Lee, D. Clinical Evidence Construction of East Asian Herbal Medicine for Inflammatory Pain in Rheumatoid Arthritis Based on Integrative Data Mining Approach. Pharmacol. Res. 2022, 185, 106460. [Google Scholar] [CrossRef]
- Su, C.; Li, N.; Ren, R.; Wang, Y.; Su, X.; Lu, F.; Zong, R.; Yang, L.; Ma, X. Progress in the Medicinal Value, Bioactive Compounds, and Pharmacological Activities of Gynostemma Pentaphyllum. Molecules 2021, 26, 6249. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Ma, C.; Li, H.; Dev, S.; He, J.; Qu, X. Medicinal Value and Potential Therapeutic Mechanisms of Gynostemma pentaphyllum (Thunb.) Makino and Its Derivatives: An Overview. Curr. Top. Med. Chem. 2019, 19, 2855–2867. [Google Scholar] [CrossRef] [PubMed]
- Gong, L.; Yin, J.; Zhang, Y.; Huang, R.; Lou, Y.; Jiang, H.; Sun, L.; Jia, J.; Zeng, X. Neuroprotective Mechanisms of Ginsenoside Rb1 in Central Nervous System Diseases. Front. Pharmacol. 2022, 13, 914352. [Google Scholar] [CrossRef]
- Ling, G.; Zhang, M.; Chen, C.; Wang, Y.; Gao, Q.; Li, J.; Yuan, H.; Jin, W.; Lin, W.; Yang, L. Progress of Ginsenoside Rb1 in Neurological Disorders. Front. Pharmacol. 2024, 15, 1280792. [Google Scholar] [CrossRef]
- Ni, X.-C.; Wang, H.-F.; Cai, Y.-Y.; Yang, D.; Alolga, R.N.; Liu, B.; Li, J.; Huang, F.-Q. Ginsenoside Rb1 Inhibits Astrocyte Activation and Promotes Transfer of Astrocytic Mitochondria to Neurons against Ischemic Stroke. Redox Biol. 2022, 54, 102363. [Google Scholar] [CrossRef]
- Liu, D.; Cai, Z.-J.; Yang, Y.-T.; Lu, W.-H.; Pan, L.-Y.; Xiao, W.-F.; Li, Y.-S. Mitochondrial Quality Control in Cartilage Damage and Osteoarthritis: New Insights and Potential Therapeutic Targets. Osteoarthr. Cartil. 2022, 30, 395–405. [Google Scholar] [CrossRef]
- Tudorachi, N.B.; Totu, E.E.; Fifere, A.; Ardeleanu, V.; Mocanu, V.; Mircea, C.; Isildak, I.; Smilkov, K.; Cărăuşu, E.M. The Implication of Reactive Oxygen Species and Antioxidants in Knee Osteoarthritis. Antioxidants 2021, 10, 985. [Google Scholar] [CrossRef]
- Muvhulawa, N.; Dludla, P.V.; Ziqubu, K.; Mthembu, S.X.H.; Mthiyane, F.; Nkambule, B.B.; Mazibuko-Mbeje, S.E. Rutin Ameliorates Inflammation and Improves Metabolic Function: A Comprehensive Analysis of Scientific Literature. Pharmacol. Res. 2022, 178, 106163. [Google Scholar] [CrossRef]
- Sun, C.-L.; Wei, J.; Bi, L.-Q. Rutin Attenuates Oxidative Stress and Proinflammatory Cytokine Level in Adjuvant Induced Rheumatoid Arthritis via Inhibition of NF-κB. Pharmacology 2017, 100, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Xie, P.; Luo, H.-T.; Pei, W.-J.; Xiao, M.-Y.; Li, F.-F.; Gu, Y.-L.; Piao, X.-L. Saponins Derived from Gynostemma Pentaphyllum Regulate Triglyceride and Cholesterol Metabolism and the Mechanisms: A Review. J. Ethnopharmacol. 2024, 319, 117186. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.-B.; Yao, C.-L.; Hou, J.-R.; Nie, M.; Li, Y.; Wei, W.-L.; Zhang, J.-Q.; Qu, H.; Li, J.-Y.; Bi, Q.-R.; et al. Systematical Characterization of Gypenosides in Gynostemma Pentaphyllum and the Chemical Composition Variation of Different Origins. J. Pharm. Biomed. Anal. 2023, 232, 115328. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.E.; Malfait, A.-M. Osteoarthritis Pain: What Are We Learning from Animal Models? Best Pract. Res. Clin. Rheumatol. 2017, 31, 676–687. [Google Scholar] [CrossRef] [PubMed]
- Jimi, E.; Huang, F.; Nakatomi, C. NF-κB Signaling Regulates Physiological and Pathological Chondrogenesis. Int. J. Mol. Sci. 2019, 20, 6275. [Google Scholar] [CrossRef]
- Shen, P.; Serve, S.; Wu, P.; Liu, X.; Dai, Y.; Durán-Hernández, N.; Nguyen, D.T.M.; Fuchs, M.; Maleitzke, T.; Reisener, M.-J.; et al. NOS Inhibition Reverses TLR2-Induced Chondrocyte Dysfunction and Attenuates Age-Related Osteoarthritis. Proc. Natl. Acad. Sci. USA 2023, 120, e2207993120. [Google Scholar] [CrossRef]
- Li, X.; Ellman, M.; Muddasani, P.; Wang, J.H.-C.; Cs-Szabo, G.; van Wijnen, A.J.; Im, H.-J. Prostaglandin E2 and Its Cognate EP Receptors Control Human Adult Articular Cartilage Homeostasis and Are Linked to the Pathophysiology of Osteoarthritis. Arthritis Rheum. 2009, 60, 513–523. [Google Scholar] [CrossRef]
- Sun, Q.; Zhang, Y.; Ding, Y.; Xie, W.; Li, H.; Li, S.; Li, Y.; Cai, M. Inhibition of PGE2 in Subchondral Bone Attenuates Osteoarthritis. Cells 2022, 11, 2760. [Google Scholar] [CrossRef]
- Grillet, B.; Pereira, R.V.S.; Van Damme, J.; Abu El-Asrar, A.; Proost, P.; Opdenakker, G. Matrix Metalloproteinases in Arthritis: Towards Precision Medicine. Nat. Rev. Rheumatol. 2023, 19, 363–377. [Google Scholar] [CrossRef]
- Roy, H.S.; Murugesan, P.; Kulkarni, C.; Arora, M.; Nagar, G.K.; Guha, R.; Chattopadhyay, N.; Ghosh, D. On-Demand Release of a Selective MMP-13 Blocker from an Enzyme-Responsive Injectable Hydrogel Protects Cartilage from Degenerative Progression in Osteoarthritis. J. Mater. Chem. B 2024, 12, 5325–5338. [Google Scholar] [CrossRef]
- Plsikova Matejova, J.; Spakova, T.; Harvanova, D.; Lacko, M.; Filip, V.; Sepitka, R.; Mitro, I.; Rosocha, J. A Preliminary Study of Combined Detection of COMP, TIMP-1, and MMP-3 in Synovial Fluid: Potential Indicators of Osteoarthritis Progression. Cartilage 2021, 13, 1421S–1430S. [Google Scholar] [CrossRef]
- Chiranthanut, N.; Teekachunhatean, S.; Panthong, A.; Khonsung, P.; Kanjanapothi, D.; Lertprasertsuk, N. Toxicity Evaluation of Standardized Extract of Gynostemma Pentaphyllum Makino. J. Ethnopharmacol. 2013, 149, 228–234. [Google Scholar] [CrossRef]
- Du Sert, N.P.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al. The ARRIVE Guidelines 2.0: Updated Guidelines for Reporting Animal Research. PLoS Biol. 2020, 18, e3000410. [Google Scholar] [CrossRef]
- Guingamp, C.; Gegout-Pottie, P.; Philippe, L.; Terlain, B.; Netter, P.; Gillet, P. Mono-iodoacetate-induced Experimental Osteoarthritis. A Dose-response Study of Loss of Mobility, Morphology, and Biochemistry. Arthritis Rheum. 1997, 40, 1670–1679. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Onodera, T.; Terkawi, M.A.; Iwasaki, K.; Hishimura, R.; Liang, D.; Miyazaki, T.; Iwasaki, N. Local Administration of Low-Dose Nerve Growth Factor Antibody Reduced Pain in a Rat Osteoarthritis Model. Int. J. Mol. Sci. 2021, 22, 2552. [Google Scholar] [CrossRef] [PubMed]
Condition | |
---|---|
Colum | Agilent Zorbax Extend C18 column (250 mm × 4.6 mm, 5 μm; Agilent, Santa Clara, CA, USA) |
Mobile phase | (A) 0.1% Phosphoric acid, (B) acetonitrile |
Flow rate | 0–5 min, 20–20%; 5–10 min, 20–40%; 10–15 min,40–40%; 15–25 min, 40–80%; 25–35 min, 80–20%; 35–40 min, 20–20% (B) |
Injection volume | 1.0 mL/min |
Detection wavelength | 203 nm |
Temperature | 30 °C |
Group | AAW Inducer (10 mL/kg, i.p.) | Sample (10 mL/kg, P.O.) | n |
---|---|---|---|
CON | 0.7% acetic acid | DW | 8 |
IBU 200 | 0.7% acetic acid | ibuprofen 200 mg/kg | 8 |
GP 200 | 0.7% acetic acid | GP 200 mg/kg | 8 |
GP 600 | 0.7% acetic acid | GP 600 mg/kg | 8 |
Group | OA Inducer (50 μL, Intra-Articular) | Sample (10 mL/kg, P.O.) | n |
---|---|---|---|
Sham | Saline | DW | 9 |
CON | MIA 40 mg/mL | DW | 9 |
INDO 3 | MIA 40 mg/mL | indomethacin 3 mg/kg | 9 |
GP 300 | MIA 40 mg/mL | GP 300 mg/kg | 9 |
Grade | Cartilage Appearance |
---|---|
0 | Normal knee cartilage surface |
1 | The surface of the knee is slightly yellow discolored or exhibits some bruising |
2 | Erosion that reaches the superficial or middle layer of cartilage |
3 | Extensive erosion to subchondral bone |
4 | Large-scale erosion with massive exposure of subchondral bone |
Gene Name | Amplicon Size | Accession No. | Direction | Sequence |
---|---|---|---|---|
IL-1β | 196 bp | M98820 | F | AACTCAACTGTGAAATAGCAGC |
R | TCCACAGCCACAATGAGTG | |||
IL-6 | 146 bp | M26744 | F | TCCGCAAGAGACTTCCAGC |
R | CCTCCGACTTGTGAAGTGG | |||
NOS2 | 151 bp | NM_012611 | F | AGTCAACTACAAGCCCCACG |
R | GCAGCTTGTCCAGGGATTCT | |||
Ptger2 | 120 bp | AF302686 | F | TGTGTGTACTGTCCGTCTGC |
R | CAGGGATCCAGTCTCGGTGT | |||
MMP-1 | 102 bp | NM_001134530 | F | AACTTGGGTGAAGACGTCCA |
R | TCCTGTCACTTTCAGCCCAA | |||
MMP-3 | 182 bp | NM_133523 | F | GTACGGCTGTGTGCTCATCC |
R | TCAGCCCAAGGAACTTCTGC | |||
MMP-8 | 156 bp | NM_022221 | F | TCTGTTCTTCTTCCACACACAG |
R | GCAATCATAGTGGCATTCCT | |||
MMP-13 | 198 bp | NM_133530 | F | ACCTTCTTCTTGTTGAGTTGGA |
R | CTGCATTTCTCGGAGTCTA | |||
GAPDH | 135 bp | AF106860 | F | CTTGTGACAAAGTGGACATTGTT |
R | TGACCAGCTTCCCATTCTC |
Gene Name | Amplicon Size | Accession No. | Direction | Sequence |
---|---|---|---|---|
IL-1β | 132 bp | NM_008361 | F | CCAGCTTCAAATCTCGCAGC |
R | GTGCTCATGTCCTCATCCTGG | |||
IL-6 | 110 bp | NM_031168 | F | CACTTCACAAGTCGGAGGCT |
R | CAAGTGCATCATCGTTGTTC | |||
NOS2 | 160 bp | NM_001313922 | F | ACCAAGATGGCCTGGAGGAA |
R | CCGACCTGATGTTGCCATTG | |||
Ptger2 | 160 bp | NM_008964 | F | CTGGTAACGGAATTGGTGC |
R | TGGCCAGACTAAAGAAGGTC | |||
COX-2 | 144 bp | NM_011198 | F | ATCCATGTCAAAACCGTGGG |
R | TTGGGGTGGGCTTCAGCAG | |||
TNF-α | 140 bp | NM_013693 | F | GAGAAGTTCCCAAATGGCCT |
R | AGCCACTCCAGCTGCTCCT | |||
MMP-3 | 91 bp | NM_010809 | F | AAGTTCCTCGGGTTGGAGAT |
R | ACCAACATCAGGAACACCAC | |||
MMP-13 | 161 bp | NM_008607 | F | AACCAAGATGTGGAGTGCCT |
R | GACCAGACCTTGAAGGCTTT | |||
GAPDH | 208 bp | NM_001411840 | F | ATGGTGAAGGTCGGTGTG |
R | GCCGTGAGTGGAGTCATAC |
Antibody | Company | Cat No. |
---|---|---|
IL-1β | Abcam | Ab283818 |
IL-6 | Abcam | Ab259341 |
NOS2 | Boster | A00368-1 |
Ptger2 | Boster | M04963 |
MMP-3 | Abcam | Ab52915 |
MMP-8 | Abcam | Ab81286 |
MMP-13 | Abcam | Ab39012 |
GAPDH | Cell Signaling Tech | #2118 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jo, H.-G.; Baek, C.Y.; Hwang, Y.; Baek, E.; Park, C.; Song, H.S.; Lee, D. Investigating the Anti-Inflammatory, Analgesic, and Chondroprotective Effects of Gynostemma pentaphyllum (Thunb.) Makino in Osteoarthritis: An In Vitro and In Vivo Study. Int. J. Mol. Sci. 2024, 25, 9594. https://doi.org/10.3390/ijms25179594
Jo H-G, Baek CY, Hwang Y, Baek E, Park C, Song HS, Lee D. Investigating the Anti-Inflammatory, Analgesic, and Chondroprotective Effects of Gynostemma pentaphyllum (Thunb.) Makino in Osteoarthritis: An In Vitro and In Vivo Study. International Journal of Molecular Sciences. 2024; 25(17):9594. https://doi.org/10.3390/ijms25179594
Chicago/Turabian StyleJo, Hee-Geun, Chae Yun Baek, Yeseul Hwang, Eunhye Baek, Chanyoon Park, Ho Sueb Song, and Donghun Lee. 2024. "Investigating the Anti-Inflammatory, Analgesic, and Chondroprotective Effects of Gynostemma pentaphyllum (Thunb.) Makino in Osteoarthritis: An In Vitro and In Vivo Study" International Journal of Molecular Sciences 25, no. 17: 9594. https://doi.org/10.3390/ijms25179594